ID: 1130089215

View in Genome Browser
Species Human (GRCh38)
Location 15:80805402-80805424
Sequence GAGCCAGGCGGTTCCCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130089211_1130089215 5 Left 1130089211 15:80805374-80805396 CCTTCTTTTCAGGTTTAAATTGC 0: 1
1: 0
2: 2
3: 18
4: 285
Right 1130089215 15:80805402-80805424 GAGCCAGGCGGTTCCCGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130089215 Original CRISPR GAGCCAGGCGGTTCCCGTGC TGG Intronic
900104528 1:976684-976706 GGGGCAGGCGGTTCCCGGGGCGG - Intronic
900105193 1:978126-978148 GAGGCAGGCGGTTCCCGGGGCGG - Intronic
900105229 1:978228-978250 GGGGCAGGCGGTTCCCGGGGCGG - Intronic
900188872 1:1345063-1345085 GAGCCAGGCGGGTGCTGTACTGG - Intronic
900350667 1:2233106-2233128 CAGCCAAGCGCTTTCCGTGCAGG + Intronic
900640495 1:3685960-3685982 CAGACAGGCGGTTCTAGTGCCGG + Intronic
901342621 1:8509176-8509198 GAGGCAGGCGGATCCCTTGAGGG - Intronic
901443901 1:9295387-9295409 GAGCAAGGCGGGTGCCATGCCGG + Intronic
901686454 1:10946172-10946194 CTACCAGGCGGTTCCCCTGCGGG - Intergenic
903173663 1:21568601-21568623 GAGCCAGGCGTCCCCCATGCAGG - Intronic
904988801 1:34574513-34574535 GAGCCTGGTGGTTACCGAGCTGG - Intergenic
910724948 1:90328448-90328470 TAGCCAGGCAGTTCTCATGCAGG + Intergenic
911045138 1:93621655-93621677 GAGTGAAGGGGTTCCCGTGCTGG - Intronic
912381071 1:109248611-109248633 GAGCCAGGCAGGAGCCGTGCAGG - Intergenic
918045663 1:180939531-180939553 GAGGCAGGGGGTTCCGGAGCTGG - Intronic
920230510 1:204466868-204466890 GAGCCAGCCAGTTCCAGAGCTGG + Intronic
920256537 1:204659060-204659082 TTGCCAGGAGGTTCCCCTGCTGG - Intronic
920955963 1:210620307-210620329 GAGCCAGGAGGTTCCCAAGGTGG + Intronic
922224857 1:223637353-223637375 GAGCCAGGCGTTACCAGGGCTGG - Intronic
922322876 1:224503460-224503482 CAGCCAGGTGGCTCCCCTGCAGG + Intronic
1064513197 10:16117485-16117507 GAGCCAGATGGTTCCAGGGCTGG - Intergenic
1067221166 10:44345422-44345444 GAGCCAGGAGGGTGCTGTGCTGG + Intergenic
1076159620 10:128233620-128233642 CAGCCAGGCGGTTCTTCTGCTGG + Intergenic
1076494066 10:130885400-130885422 CCGCCAGGCGGATCCAGTGCTGG + Intergenic
1077096864 11:802712-802734 CACCCAGGGGGTTCCCCTGCAGG + Exonic
1077322143 11:1947287-1947309 GTGCCAGGCGGCGGCCGTGCGGG + Exonic
1081915780 11:46729322-46729344 GGGCCAGGCGGCTCCTGTGGGGG + Intronic
1082810420 11:57476203-57476225 GCCGCAGGCGGTTCCCGTGGAGG - Exonic
1084675004 11:70629167-70629189 GGGCCAGGCTCTTCCGGTGCTGG - Intronic
1090669591 11:128937089-128937111 GAGCCATGCGCTGCCTGTGCTGG + Intronic
1202805161 11_KI270721v1_random:2600-2622 GTGCCAGGCGGCGGCCGTGCGGG + Intergenic
1096459511 12:51814500-51814522 GAGCCAGGCGGTCCCAGGACAGG + Intergenic
1099222967 12:79935419-79935441 GAGCCTTGCGGTTCCACTGCTGG - Intronic
1104763615 12:131312956-131312978 GAGCCAGGAGTTTCCCCAGCCGG + Intergenic
1107400889 13:40068162-40068184 GAGGCAGGCGGGGCCAGTGCTGG - Intergenic
1111278191 13:85980507-85980529 GGTCCAGGGGGTTCCCATGCAGG - Intergenic
1117096645 14:52305289-52305311 CAGCTAGGAGGTTCTCGTGCTGG - Intergenic
1118163011 14:63309729-63309751 GGGCCAGGAGGTTCCTCTGCAGG + Intergenic
1119332104 14:73802589-73802611 GAGACAGGCAGTTCCGGTGCTGG + Intergenic
1119484943 14:74981062-74981084 GAGCCAGGCGTTTCCCTGGACGG - Intergenic
1122477381 14:102020157-102020179 GAGCCAGGTGGTGCCAGTGGTGG + Intronic
1124635254 15:31361006-31361028 GAGCCAGGCAGTTCCCTGGAAGG - Intronic
1129763688 15:78147772-78147794 GAGCCAGGAGGTTTCAGAGCCGG + Intronic
1130089215 15:80805402-80805424 GAGCCAGGCGGTTCCCGTGCTGG + Intronic
1132617885 16:851412-851434 GAGCCAGGGGGTTGCCGTGTGGG + Intergenic
1132631888 16:921805-921827 CATCCAGGCGGTCCCCGTGCGGG + Intronic
1133190731 16:4131825-4131847 GAGCCAGGCTGCCCCAGTGCCGG - Intergenic
1134271567 16:12737469-12737491 GAGCCTTGTGGTTCCCATGCAGG + Intronic
1138391992 16:56676763-56676785 TAGCCAGTGGGTTCCCGGGCTGG + Intronic
1139089273 16:63624571-63624593 GATTCAGGCTGTTCCCCTGCTGG + Intergenic
1140573471 16:76136205-76136227 GAGCCTGGCAGTGCCCCTGCAGG - Intergenic
1141464513 16:84197003-84197025 GAGCCAAGCTGTACCCCTGCTGG + Exonic
1142024160 16:87803563-87803585 CAGCCAGGTGGTTCTTGTGCAGG - Intergenic
1143202737 17:5123327-5123349 GGGCCAGGCCGTGCCCGGGCGGG - Intronic
1143884017 17:10052740-10052762 GAGCAAGGTGGTTCCCCTTCTGG - Intronic
1147968488 17:44206973-44206995 GGGCCAGGCTGGTCCGGTGCTGG + Exonic
1147969205 17:44210675-44210697 GAGCCACGCGGTGCCTGGGCTGG - Intronic
1152754488 17:82081556-82081578 GCGCCAGGTGTTTCCCCTGCTGG - Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1162532163 19:11242233-11242255 GAGCCAGGAGGCTCCCAGGCAGG - Intronic
1162577029 19:11505318-11505340 GAGCCAGGCGCGTCCCGGCCAGG + Intronic
1163074731 19:14879690-14879712 GAGGCAGGCGGATCCCCTGAGGG + Intergenic
925386384 2:3464745-3464767 GAGCAACGCGGTCTCCGTGCAGG - Intronic
927154098 2:20211972-20211994 CCGCCATGCGGCTCCCGTGCTGG + Intronic
935820304 2:106886975-106886997 GTGCCAGGCGGGTACTGTGCAGG - Intronic
936019089 2:108981208-108981230 GAGCCAGCCCCTTCCCGTGCTGG - Intronic
937338882 2:121078294-121078316 GAGCCAGGGGGTGCCTGAGCAGG - Intergenic
937663559 2:124459168-124459190 GAGCAAAGCTGTTCCCATGCAGG - Intronic
943588062 2:189763649-189763671 GAGTCAGGCTTTTCCCCTGCTGG + Intergenic
943947892 2:194090707-194090729 GCGCCAAGCGGAACCCGTGCTGG + Intergenic
944738466 2:202589495-202589517 TAGCCAGGCTGTTCCTGTGGGGG - Intergenic
946428793 2:219613779-219613801 GACCCTGGCTGTTCCCCTGCAGG + Exonic
948431822 2:237923609-237923631 TGCCCAGGCGGTTCCCTTGCTGG + Intergenic
948679378 2:239622422-239622444 GATTCAGGGGGTTCACGTGCAGG + Intergenic
1169945391 20:10982900-10982922 GAGGCAGACAGTGCCCGTGCTGG - Intergenic
1172889367 20:38253076-38253098 GAGCCAGGCTGTTCCCAGGCAGG + Intronic
1174179769 20:48667539-48667561 GAGCTAGGTGGTTCCAGGGCTGG - Intronic
1179971614 21:44838964-44838986 GAGCCAGGCAGTTCCTTTGCTGG + Intergenic
1180604670 22:17048450-17048472 GAGCAAGGCAGTACCAGTGCAGG + Intergenic
1182084318 22:27551008-27551030 GAGCCAGGCTGCACCTGTGCAGG + Intergenic
1184255463 22:43284293-43284315 GACTCAGGCTGTTCCCGTGAAGG + Intronic
949503510 3:4704520-4704542 GAATCAGGGGGTACCCGTGCAGG - Intronic
950505220 3:13390443-13390465 GAGCCACGCGGGTCCTCTGCCGG - Intronic
954635340 3:52068122-52068144 GAGCCAGCCGGTGCCGGTGGAGG - Intergenic
954886730 3:53881761-53881783 GAGCCAGGCGGAGCCCCCGCAGG - Intronic
955275452 3:57543107-57543129 GAGCCAGTCAGTTCCCCTTCAGG + Intronic
961465132 3:127076812-127076834 GAGCCAGGTGGTCCCTGTGGAGG - Intergenic
961672865 3:128547650-128547672 GAGCAAGGCGGCCCCCATGCCGG + Intergenic
962198778 3:133384614-133384636 GAGCCAGGTGGCTCCCAAGCTGG + Intronic
962605623 3:137030604-137030626 GAGCCAGGTGTTTCCCTTGATGG - Intergenic
969611237 4:8228791-8228813 GAGACAGGCAGTTCCCACGCAGG + Intronic
1001183603 5:169545198-169545220 GAGCCAGGAGGTTCCCATTAAGG + Intergenic
1002790282 6:432500-432522 GAGCCAGGGGGTGCATGTGCAGG + Intergenic
1005199551 6:23327653-23327675 GAGCCAGGTGGTTCCAGTAGAGG + Intergenic
1007335976 6:41155493-41155515 GAGCCAGGTGCCTCCTGTGCAGG - Intergenic
1014234033 6:118935209-118935231 GAGCCAGGAGGGTCCCGGGCGGG + Intergenic
1019626118 7:2016491-2016513 GAGCCAGGCGGGGCCTGGGCGGG - Intronic
1019856977 7:3619129-3619151 GAACAAGGCGGTTCCCTTCCAGG - Exonic
1022114977 7:27253192-27253214 GAGCCAGGCGGCTCCAGCGCAGG - Intergenic
1024007499 7:45237928-45237950 GACCCAGGAGGTCACCGTGCTGG + Intergenic
1024505227 7:50156963-50156985 GAGCCAGGAGGTTCAGGTTCAGG - Intronic
1024511137 7:50206068-50206090 GATTCAGGGGGTACCCGTGCAGG + Intergenic
1025994269 7:66518372-66518394 GAGCCAGGAGGGTCCATTGCAGG + Intergenic
1026033730 7:66816293-66816315 GAGCCAGGAGGGTCCATTGCAGG - Intergenic
1029706262 7:102277942-102277964 GGGCCAGGCGGTTCTCCTGGGGG - Intronic
1048446112 8:134494452-134494474 GAGCCAGGCGCTTCCCCAGCAGG - Intronic
1049375265 8:142286462-142286484 GAGGCAGGCGGTCCCTCTGCAGG + Intronic
1049420696 8:142515261-142515283 GAGCCAGGCCGGGCCCCTGCCGG - Intronic
1053422489 9:37988238-37988260 GAGCCAGGCTGGTCCCAGGCTGG - Intronic
1058486593 9:105448093-105448115 GGGCCGGGCGGTGCCGGTGCGGG + Exonic
1062544245 9:137054469-137054491 GAGCCACGCGGGGCCCGGGCTGG + Intergenic
1196463746 X:115952865-115952887 GATGCTGGCGGTTCCCGTACAGG - Intergenic