ID: 1130091640

View in Genome Browser
Species Human (GRCh38)
Location 15:80825995-80826017
Sequence CAATTTGTACAATTGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130091640 Original CRISPR CAATTTGTACAATTGTAGGT GGG (reversed) Intronic
909345171 1:74576668-74576690 CAATTACTAAAATTGAAGGTGGG + Intronic
917837881 1:178955095-178955117 CAAATTGTATAAATGTAGGCAGG + Intergenic
919456583 1:197827727-197827749 TTATTTGTTCAATTGTTGGTGGG - Intergenic
919551437 1:198994023-198994045 CAATTTGAAAAATTATATGTAGG - Intergenic
921383712 1:214550376-214550398 CAATTTCTGAAATTGTAGGTGGG + Intronic
921473095 1:215571590-215571612 CAAATTGTAAAGTTGTATGTGGG + Intronic
921782573 1:219183766-219183788 CAATTTTTAAAATTCTAAGTAGG + Intronic
1063622285 10:7660558-7660580 CAATTAGTGCAACTATAGGTGGG + Intronic
1068716320 10:60192941-60192963 CAATTTAAACCATTGTAGCTAGG + Intronic
1068836112 10:61555869-61555891 AAATCTTTAAAATTGTAGGTTGG - Intergenic
1071718235 10:88118234-88118256 TACTTGGTAGAATTGTAGGTAGG + Intergenic
1074877561 10:117626029-117626051 AAATTTGTACAATGGCGGGTAGG + Intergenic
1074939108 10:118217411-118217433 CAATTTGTACACTTGGAGATGGG - Intergenic
1078132404 11:8623758-8623780 CAATTTGGACCATTGGAGATTGG - Intronic
1080299473 11:30768216-30768238 CAACTTGTACAATTGAGGGATGG + Intergenic
1081368447 11:42266511-42266533 CAATTTGTACAACTGAAAGATGG + Intergenic
1085723735 11:78935557-78935579 CAGTTTGTGCAATTTTGGGTTGG + Intronic
1087334378 11:96824827-96824849 CAGTTTGTAAAGATGTAGGTGGG + Intergenic
1087445883 11:98252948-98252970 CAAACTGTACAATTGTATATAGG - Intergenic
1088978105 11:114833788-114833810 CTATTTGTACAATCTGAGGTGGG + Intergenic
1094699952 12:32859934-32859956 AAATTTGTACAATTTTTGGGAGG + Intronic
1096909816 12:54971898-54971920 CATTTTGTGGAATTATAGGTAGG + Intronic
1099153709 12:79147536-79147558 AAATTTGGACAATTTTAAGTAGG + Intronic
1099154147 12:79153340-79153362 CTATCTGGAAAATTGTAGGTCGG + Intronic
1104134782 12:125926869-125926891 CAATGTGTCCTTTTGTAGGTTGG - Intergenic
1105801985 13:23914018-23914040 CAAGTTGAACCATTGTAAGTTGG + Intergenic
1106912675 13:34479928-34479950 CTATTTGTACTATTATAAGTAGG + Intergenic
1108019394 13:46111378-46111400 CAATTTGTTCAATTATACTTTGG + Intergenic
1108575762 13:51789114-51789136 CAATTTGTTCAGTTCTTGGTTGG + Intronic
1108960369 13:56219908-56219930 CAATTAGGACAATTAAAGGTAGG - Intergenic
1110615613 13:77538456-77538478 CCATTTGTACAATGGTAAGCTGG - Intronic
1111492833 13:89006091-89006113 CAATTTGTATAAATGAAGCTTGG - Intergenic
1112381052 13:98890661-98890683 GAATCTGCAAAATTGTAGGTAGG - Intronic
1112968929 13:105234851-105234873 CAATTTGTCCTAGTGTAAGTGGG + Intergenic
1114029257 14:18561536-18561558 CAAGATGGACAAATGTAGGTTGG - Intergenic
1116598964 14:46893994-46894016 CAATTTTTAGAATTGCAGTTTGG + Intronic
1116659329 14:47688989-47689011 CAATTTTTAGCATTGTTGGTGGG + Intergenic
1117300610 14:54422461-54422483 CAAGTTGAACCATTGTAGATTGG - Intergenic
1118946371 14:70391397-70391419 CAATTTGTATCATAGAAGGTAGG + Intronic
1121971712 14:98363753-98363775 CAATTTCTACAATTCAATGTGGG - Intergenic
1126033200 15:44520970-44520992 CAATTAGTACAATGCTAGGTAGG - Intronic
1128487261 15:68106071-68106093 CAATATCTACAACTGTAGCTTGG - Intronic
1130091640 15:80825995-80826017 CAATTTGTACAATTGTAGGTGGG - Intronic
1131529922 15:93182289-93182311 CAATTAGCACAATTGTATGGGGG + Intergenic
1131949865 15:97670429-97670451 CAGTTTATAGAATTCTAGGTTGG + Intergenic
1144113527 17:12063167-12063189 CAATTTGTAAAACAGTAAGTTGG + Intronic
1144443276 17:15303461-15303483 CATTTGGAACAATAGTAGGTAGG - Intergenic
1149940361 17:60858212-60858234 CAATTGGAACAACTGGAGGTGGG - Intronic
1153591699 18:6680978-6681000 TAATTTGCCCAATTGTAAGTTGG + Intergenic
1153627216 18:7033091-7033113 CAATCTGTCTATTTGTAGGTTGG - Exonic
1153885624 18:9462618-9462640 TAAGTTGAACTATTGTAGGTTGG - Intergenic
1153920983 18:9789859-9789881 CATTTATTGCAATTGTAGGTTGG + Intronic
1154230254 18:12550049-12550071 CAGTTTGTACATTTGAAAGTGGG - Intronic
1155423635 18:25682754-25682776 CAATTTGTTAAAGTGTAAGTAGG + Intergenic
1155746061 18:29357517-29357539 CAATTAATAAAATTGTAGATTGG - Intergenic
1156835110 18:41543689-41543711 CAATTTTTACAATAATAAGTTGG + Intergenic
1157184386 18:45525801-45525823 GAATTTGTACAACTGTAAATGGG - Intronic
1158813572 18:61067137-61067159 CAAATAGTACAATAGTGGGTGGG + Intergenic
1159275092 18:66208529-66208551 CATTTTGGACAATTGTATCTTGG + Intergenic
1159389908 18:67777636-67777658 CAATTTGCACACTGGTAGGTAGG - Intergenic
1160210895 18:76878021-76878043 CATTCTGTACAGTTATAGGTAGG - Exonic
1163088338 19:14999686-14999708 CAAGTTGAACCATTGTAAGTTGG - Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
928707914 2:33971420-33971442 CAGTTTGGTCAATTCTAGGTAGG - Intergenic
931373946 2:61690985-61691007 CATTTTGTACTATTGTACTTTGG + Intergenic
931765246 2:65449872-65449894 CTATTTGTAGAAGTGTAGATGGG - Intergenic
934086296 2:88512798-88512820 CAATTTGTTCAATTCCAGTTGGG - Intergenic
934965976 2:98722977-98722999 AAATTGGGACAGTTGTAGGTGGG - Intronic
935488939 2:103693638-103693660 CTATTTATAGAATTCTAGGTTGG - Intergenic
938046302 2:128124290-128124312 CAGGTTATACAATTTTAGGTTGG + Intronic
938095778 2:128462194-128462216 CAATTTGTGTATTTCTAGGTAGG - Intergenic
938713569 2:133997694-133997716 CAATTTCCACAAGTGTATGTTGG + Intergenic
939067149 2:137497488-137497510 CAATTGGTACATTTGGAAGTGGG - Intronic
939508634 2:143079040-143079062 TAACTTGTATTATTGTAGGTGGG + Intergenic
939572547 2:143857529-143857551 CTATTTGGACAATGGAAGGTAGG - Intergenic
941753084 2:169154146-169154168 CAAGGTGTACAATGGTAGGAAGG + Intronic
942689131 2:178566643-178566665 CAATGTGTGCATTGGTAGGTGGG + Exonic
943244414 2:185427968-185427990 CAAGATGTACACTTGCAGGTGGG - Intergenic
943866622 2:192932081-192932103 CAATTTGTACCATGCCAGGTTGG + Intergenic
945557852 2:211301307-211301329 CAAGTTGAACAATTGTATGTGGG + Intergenic
945809488 2:214531149-214531171 AAATTTGTAAAAATGTTGGTTGG - Intronic
947100167 2:226612201-226612223 CAATTGGAAAAATTCTAGGTTGG + Intergenic
948447630 2:238045328-238045350 CAATATGTTTAATTTTAGGTGGG - Intronic
948498439 2:238371027-238371049 CAATTTGGACATTTGTCGTTTGG + Intronic
1169682163 20:8227609-8227631 CAATTTGTAAAAGTGTGGGTTGG - Intronic
1171024589 20:21617716-21617738 TAAGTTGAACAATTGTAAGTTGG + Intergenic
1172145467 20:32754757-32754779 CATTTAATACAATTGTAGGCCGG + Intergenic
1173347786 20:42216792-42216814 CAACTTGTAGAATAGTAAGTAGG - Intronic
1174698762 20:52586544-52586566 GAAGTTGAATAATTGTAGGTAGG - Intergenic
1179049504 21:37876753-37876775 CAACTTGTCCAATTGTTGCTGGG - Intronic
1180453373 22:15488599-15488621 CAAGATGGACAAATGTAGGTTGG - Intergenic
1181161819 22:20964237-20964259 CTATCTGTAAAATTGTAGGAGGG + Intergenic
1184912022 22:47541956-47541978 CAATTTGGAGACTTGTATGTTGG - Intergenic
949130961 3:499878-499900 CAATATATACAACTGTAGGATGG + Intergenic
949278481 3:2317732-2317754 CAGTTTGTAAAATGCTAGGTAGG + Intronic
950868637 3:16210249-16210271 CAATTTGTAAGATCTTAGGTGGG - Intronic
951151666 3:19297912-19297934 CAATTTCTAGATTTGTAGATAGG + Intronic
951686434 3:25349834-25349856 CAATTTGCACCATTCTTGGTAGG + Intronic
957125358 3:76152502-76152524 TATTTTTTTCAATTGTAGGTAGG + Intronic
957367096 3:79239877-79239899 GAATTTTTAAAAATGTAGGTGGG - Intronic
966771670 3:183509970-183509992 CAATTTGTAAAATTATTGATTGG + Intronic
970834132 4:20380349-20380371 CAATTTGTACAATGTTGGTTTGG - Intronic
971101917 4:23476272-23476294 CAATTTGTACAAAAGCAAGTTGG - Intergenic
978456074 4:108893362-108893384 CAATTTCTACATTTATTGGTGGG + Intronic
978481254 4:109193292-109193314 CAATTTGAAAAATTTTAAGTTGG + Intronic
980438639 4:132813663-132813685 CAATTAATAAAAATGTAGGTTGG - Intergenic
982635160 4:157886754-157886776 CAATTTGTATAATTGTGGACTGG - Intergenic
984137479 4:175958922-175958944 CATTTTTTACATTTGCAGGTAGG - Intronic
984569361 4:181373152-181373174 CAATTCCTACAATTGAATGTCGG + Intergenic
987538797 5:19225957-19225979 CAAATTGTACACTTGCAGGTGGG - Intergenic
988580684 5:32466177-32466199 CAATTTGTACAATCAAGGGTTGG + Intergenic
988635632 5:32980810-32980832 CCAGTTGTAGAATTCTAGGTTGG - Intergenic
989196303 5:38719918-38719940 CAATTTGCACAACTATATGTGGG - Intergenic
990037550 5:51340403-51340425 CATTTTGTACTATTGTAGAGGGG - Intergenic
990696311 5:58421531-58421553 CAATTTGTAATAGTGTGGGTAGG + Intergenic
993610529 5:90048301-90048323 CAATTTGTACTTTTGAAAGTTGG + Intergenic
993738244 5:91503857-91503879 CAATTTGTAAACTTGTATTTGGG - Intergenic
994865035 5:105257569-105257591 CATTTTGCACCAGTGTAGGTAGG - Intergenic
996508393 5:124292510-124292532 AAATTTGTACCATTGTAGATAGG + Intergenic
996895929 5:128482555-128482577 CAGTTTGTTCACTTGTGGGTAGG + Intronic
998422040 5:141996617-141996639 TAATTTTTAAAAGTGTAGGTTGG + Intronic
999340346 5:150764811-150764833 CTATTTGTGGAATTGTGGGTGGG + Intergenic
1002957682 6:1883711-1883733 TAATTTGTACATTTTTAAGTAGG - Intronic
1003884378 6:10508035-10508057 CAATTTTTAAAACTTTAGGTGGG + Intronic
1009426221 6:63516551-63516573 CAATTTTTCCATTTGTAAGTTGG + Intergenic
1009834342 6:68979774-68979796 CTATTTGTTCAAGTGTAGGCTGG - Intronic
1013024641 6:106259202-106259224 TAATTTGTAAAATTCTGGGTGGG - Intronic
1018286813 6:162249324-162249346 CAATTTGTTCAATTGTATCCTGG - Intronic
1020379652 7:7529335-7529357 CAATTTGTAACATTGAAAGTTGG + Intronic
1021125039 7:16842306-16842328 CAGTTTGTTCATTTGTAGGTAGG - Intergenic
1027591454 7:80124336-80124358 CAATTTGTAGAACTGAAGGTGGG - Intergenic
1027957085 7:84893993-84894015 CAATTTGTACAATAATACTTTGG - Intergenic
1028004525 7:85547044-85547066 CAATTTGGAATAGTGTAGGTTGG - Intergenic
1038683316 8:29691425-29691447 CCATGTATACAATTCTAGGTTGG - Intergenic
1046481415 8:114823238-114823260 CAATTTTTATATTTTTAGGTTGG - Intergenic
1050009906 9:1174718-1174740 CAATCTGAATAATTGTATGTGGG + Intergenic
1050256686 9:3799684-3799706 CAAGTTGAACTATTGTAAGTTGG - Intergenic
1053595915 9:39561466-39561488 CATTTTGAACCATTGTAAGTTGG - Intergenic
1053853882 9:42318107-42318129 CATTTTGAACCATTGTAAGTTGG - Intergenic
1060304738 9:122401142-122401164 CCATTTGTACAATTGCAGCTTGG + Intergenic
1060841493 9:126796807-126796829 GAATTTGAACAATTGTAAGATGG + Intergenic
1185690620 X:2152355-2152377 CAATTTACACAATTCTAGTTTGG + Intergenic
1186843484 X:13508443-13508465 CAATTTGTACAATCATAGAGTGG + Intergenic
1188826613 X:34842633-34842655 CAATTTGAAAAATAGTAGGGAGG + Intergenic
1189164267 X:38844777-38844799 CAATTGATACAATTTTAAGTTGG - Intergenic
1190249105 X:48708717-48708739 CCTTTTGTACATTTGTAGGCAGG - Exonic
1194365978 X:93014160-93014182 TCATTTGTACTATGGTAGGTGGG - Intergenic
1194572398 X:95569055-95569077 ACATTTGTACACTTGTTGGTGGG + Intergenic
1196704536 X:118705616-118705638 CAGGTTGTACAAAAGTAGGTGGG + Intergenic
1196865918 X:120070881-120070903 AAATTTGTAGAATTATAGTTAGG - Intergenic
1197713241 X:129687231-129687253 CATTTTGATCAAATGTAGGTGGG - Intergenic
1199875641 X:151925792-151925814 CAATTTGACCAATTGTAAGCAGG + Intergenic
1200674199 Y:6130415-6130437 TCATTTGTACTATGGTAGGTGGG - Intergenic