ID: 1130092678

View in Genome Browser
Species Human (GRCh38)
Location 15:80834105-80834127
Sequence TCCCAAAATGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 4, 2: 29, 3: 83, 4: 296}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130092668_1130092678 22 Left 1130092668 15:80834060-80834082 CCTTCATCCACTAGGTGCCAATA 0: 1
1: 0
2: 7
3: 53
4: 378
Right 1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG 0: 1
1: 4
2: 29
3: 83
4: 296
1130092667_1130092678 28 Left 1130092667 15:80834054-80834076 CCTTGGCCTTCATCCACTAGGTG 0: 1
1: 1
2: 25
3: 170
4: 734
Right 1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG 0: 1
1: 4
2: 29
3: 83
4: 296
1130092671_1130092678 -4 Left 1130092671 15:80834086-80834108 CCCCCACCTCCCAGTTGTCTCCC 0: 1
1: 0
2: 2
3: 204
4: 1834
Right 1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG 0: 1
1: 4
2: 29
3: 83
4: 296
1130092674_1130092678 -7 Left 1130092674 15:80834089-80834111 CCACCTCCCAGTTGTCTCCCAAA 0: 1
1: 0
2: 6
3: 40
4: 372
Right 1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG 0: 1
1: 4
2: 29
3: 83
4: 296
1130092666_1130092678 29 Left 1130092666 15:80834053-80834075 CCCTTGGCCTTCATCCACTAGGT 0: 1
1: 0
2: 1
3: 13
4: 106
Right 1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG 0: 1
1: 4
2: 29
3: 83
4: 296
1130092670_1130092678 5 Left 1130092670 15:80834077-80834099 CCAATAGCACCCCCACCTCCCAG 0: 1
1: 0
2: 4
3: 70
4: 455
Right 1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG 0: 1
1: 4
2: 29
3: 83
4: 296
1130092673_1130092678 -6 Left 1130092673 15:80834088-80834110 CCCACCTCCCAGTTGTCTCCCAA 0: 1
1: 0
2: 3
3: 28
4: 266
Right 1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG 0: 1
1: 4
2: 29
3: 83
4: 296
1130092675_1130092678 -10 Left 1130092675 15:80834092-80834114 CCTCCCAGTTGTCTCCCAAAATG 0: 1
1: 0
2: 2
3: 28
4: 282
Right 1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG 0: 1
1: 4
2: 29
3: 83
4: 296
1130092669_1130092678 15 Left 1130092669 15:80834067-80834089 CCACTAGGTGCCAATAGCACCCC 0: 2
1: 12
2: 113
3: 412
4: 1038
Right 1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG 0: 1
1: 4
2: 29
3: 83
4: 296
1130092672_1130092678 -5 Left 1130092672 15:80834087-80834109 CCCCACCTCCCAGTTGTCTCCCA 0: 1
1: 0
2: 3
3: 38
4: 408
Right 1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG 0: 1
1: 4
2: 29
3: 83
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130092678 Original CRISPR TCCCAAAATGTCTCCAGACA TGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
900934849 1:5758789-5758811 TCCTAAAATCTCTCCCCACATGG - Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
901784900 1:11618034-11618056 TCCCAAAATGTCTTAACAGAAGG - Intergenic
902110790 1:14076603-14076625 ACCCAAAATGCTTCCAGATATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
903530423 1:24026117-24026139 TACAAAAATGTAGCCAGACATGG - Intergenic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
905811942 1:40919470-40919492 CCCCAAACTGCCTCCAGCCATGG + Intergenic
907402893 1:54235921-54235943 TCAAAAAATGTCACCAGAAAAGG - Intronic
907842039 1:58167982-58168004 TGCCAAAATGTGTCCAGAATTGG - Intronic
909296057 1:73950345-73950367 GCCCAAAATGGCTACAGTCAGGG - Intergenic
909531234 1:76684083-76684105 TTCCAAAATGACTCCTGTCAAGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
910972702 1:92872608-92872630 TTACATAATGTCTCCAGAGAGGG + Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
914424618 1:147563713-147563735 TCCAAAAATGACTTCAGACGTGG - Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
919260783 1:195190932-195190954 TCCCTAATCATCTCCAGACAGGG + Intergenic
919467897 1:197944514-197944536 TCCCTAAATGTCCCCAGAGAAGG + Intergenic
920332462 1:205219960-205219982 TACCAAAATGTCTCAAGAATAGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
1063322023 10:5059835-5059857 CGCCAAAATGTGTCCAGAAATGG + Intronic
1063529452 10:6817301-6817323 CCCTAAAATGTTTCCATACATGG + Intergenic
1064267833 10:13839313-13839335 TCCCAAAATGCCTTTAGAAATGG - Intronic
1068578042 10:58707079-58707101 TGCCAAATTGTCTCCAAACCAGG - Intronic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069054863 10:63834171-63834193 TGCCAAAATGTTTGCAAACACGG - Intergenic
1069365377 10:67689962-67689984 TGCCAAAATGTGTCCAGAATTGG + Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1072332507 10:94367764-94367786 TCCCAAACTGTCTTGAGAAAAGG + Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1077019408 11:410884-410906 TCCCCGACTGTATCCAGACATGG - Intronic
1077019520 11:411296-411318 TCCCCGACTGTATCCAGACATGG - Intronic
1077019548 11:411412-411434 TCCCCGACTGTATCCAGACATGG - Intronic
1077019560 11:411454-411476 TCCCCGACTGTATCCAGACATGG - Intronic
1077019668 11:411861-411883 TCCCCGACTGTATCCAGACATGG - Intronic
1077019762 11:412188-412210 TCCCCGACTGTATCCAGACATGG - Intronic
1077555996 11:3226376-3226398 TCCCAAATTATCTCCAGCCCAGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079276384 11:19041075-19041097 TCACAACATGTCTCCAGGAAGGG + Intergenic
1079415011 11:20225887-20225909 TTCTAAAATGTCTACAGATAAGG + Intergenic
1081022488 11:37964475-37964497 TCCCAAATTGTCTTCCAACATGG - Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082235434 11:49817041-49817063 TCGCAAAATGTGTACATACATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084444060 11:69193273-69193295 TCCCAAATTATGTCCAGACAGGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085414242 11:76309805-76309827 TCCCCACATGTTGCCAGACAGGG + Intergenic
1085488966 11:76896076-76896098 TTCCAAAATGGTTCCAGATATGG - Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087472271 11:98591298-98591320 TCACAAAAAGTCTCCAGTTATGG + Intergenic
1087683623 11:101240198-101240220 TGCCAAAATGTGTCCAGAATTGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089182155 11:116590503-116590525 TCCCAAAATGTCTGCCACCAAGG + Intergenic
1089226795 11:116930931-116930953 TCCAAACATGTACCCAGACAGGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090905185 11:131068554-131068576 TCCCAAAATGCCAACAGCCATGG - Intergenic
1092398235 12:8147116-8147138 TCGCAACATGTCTCCAGCAAGGG + Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094090319 12:26642788-26642810 ACCCAAAATGTTTCCAATCAGGG + Intronic
1094095028 12:26694166-26694188 TCACAGAATGTCATCAGACAAGG + Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094223329 12:28018290-28018312 TCCCAAACTGTCTCCATTAAGGG - Intergenic
1096970285 12:55660003-55660025 TACCACAATGTCCCCAGATATGG + Intergenic
1098515076 12:71366226-71366248 TGCCAAAATGGCTTCACACAAGG - Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1104247104 12:127054488-127054510 TATTAAAATGTATCCAGACAGGG + Intergenic
1104304068 12:127593506-127593528 TCCCAAAGTGCCTCCACGCACGG - Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107509299 13:41066876-41066898 TACCACATTGTCTCCAGAAATGG + Intronic
1107550134 13:41466335-41466357 CCCCAAAATGATTCGAGACAGGG - Intronic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1111372272 13:87334124-87334146 TCCCAAGATGTGTCCAGAGTTGG - Intergenic
1111942959 13:94632622-94632644 TCCCAAAATGCCTCCACTCCAGG + Exonic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112468483 13:99666788-99666810 TCCCAAAAAGCCACCAGAGATGG + Intronic
1113103473 13:106746696-106746718 TTCCAAAATGTCTACAGCCCTGG + Intergenic
1114316353 14:21513083-21513105 TCCCGAAATGTTTCCATTCAGGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1118826815 14:69391047-69391069 TGCCAAACTGTCTTCAGACGTGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122388682 14:101365635-101365657 TCCCAACATGACTCCGGCCATGG + Intergenic
1122390518 14:101378649-101378671 ACCCAAAAGGTATCCAGAAATGG + Intergenic
1122501919 14:102206513-102206535 TCCTGAAATTTCTCCACACATGG + Intronic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1124630489 15:31334071-31334093 CCCCAACATCTCTCCAGTCAAGG - Intronic
1125276417 15:37996773-37996795 GTCCAAAATGTCTTCAGACCTGG + Intergenic
1129051638 15:72786047-72786069 ACCCAAATTGCTTCCAGACATGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131529319 15:93178660-93178682 AGCCTAAATGTCTCCAGCCACGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132815536 16:1824617-1824639 TCCCAAAAGGGATCCAGAAATGG + Intronic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133514092 16:6490737-6490759 TCCTAAACTGTCTCCAGGCTGGG - Intronic
1133700751 16:8306196-8306218 TACCAAAATGTCTCTTGACTAGG + Intergenic
1133718731 16:8474451-8474473 TCCCAAAATGTCTGCACCGACGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135060350 16:19266292-19266314 ACCCCAAATGTCTTCGGACATGG - Intronic
1135074005 16:19377678-19377700 TCCCAAAAGACCACCAGACAGGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135460967 16:22642576-22642598 TCCCCCAAGGTCTCCCGACATGG - Intergenic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1137030583 16:35520264-35520286 TCTCAAAATAGCTCCAGAAAAGG + Intergenic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1138285865 16:55809878-55809900 TCCCACAATAACTCCAGGCATGG + Intronic
1139544539 16:67644129-67644151 TCCCAAACTCTCTCCAGCCTGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141178823 16:81738677-81738699 TCAAAAACTGTCTCCAGATAGGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141644505 16:85360112-85360134 TCCCCAAAGGTCTCCAAAAAGGG - Intergenic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146309920 17:31759896-31759918 TTCCCAAATGTCTTCACACAAGG + Intergenic
1146310213 17:31762848-31762870 TGCCAAAATGTGTCCAGAATTGG - Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148094784 17:45044772-45044794 CCCTAAACTGTCTCAAGACAAGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1154196664 18:12271934-12271956 TCCCTAAATGTCTCCAGTCTTGG - Intronic
1155785544 18:29895266-29895288 TCCAAAAATTGCTCCAGATATGG - Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158701812 18:59755089-59755111 TCCTAAAATGTCTCCACTCTTGG + Intergenic
1160288778 18:77571530-77571552 TACCACAGTGTCTCCAGGCAAGG - Intergenic
1160536303 18:79596117-79596139 TCCCAAACTGTCTCCCGAAGTGG - Intergenic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162599444 19:11656646-11656668 TTACAACCTGTCTCCAGACATGG + Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164073442 19:21790770-21790792 TCTCAAAATTGCTCCAGAGAAGG - Intergenic
1164154911 19:22587578-22587600 ACCCAAAATGTGTACACACAAGG + Intergenic
1164267226 19:23631307-23631329 TCCCAAATATTTTCCAGACATGG - Intronic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1164536239 19:29088202-29088224 CCCCAAGATGGCTTCAGACAAGG - Intergenic
1164557231 19:29263073-29263095 TGCCAAAGTGTGTCCAGAGAGGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1167882783 19:52475798-52475820 TCTCAAAATAGCTCCAGAAAAGG - Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
925777686 2:7350665-7350687 TGCCAAAAAGTCTCCACCCAAGG + Intergenic
927262006 2:21101438-21101460 AATCAAAATGTCTCAAGACATGG - Intergenic
928258975 2:29749807-29749829 TCCCCAAATTTATCAAGACAGGG + Intronic
928629916 2:33180605-33180627 TCCCAAAAATTAGCCAGACATGG - Intronic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929164532 2:38868033-38868055 TCCCATCATGTCTTCAGAAAAGG + Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
931935968 2:67196596-67196618 TTCCAAAATGTATCAAGAAAGGG + Intergenic
934057117 2:88260642-88260664 TTCCAAACTTTCTCCAGTCATGG + Intergenic
935133206 2:100276901-100276923 GCACACAATGTCTGCAGACAGGG + Exonic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937343860 2:121110566-121110588 TCTCTAAAACTCTCCAGACAAGG + Intergenic
937415286 2:121709878-121709900 TCCCACAGTGTCTCCAAACTCGG - Intergenic
937502348 2:122493203-122493225 TAACATAATGTTTCCAGACAAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937787424 2:125918452-125918474 TTCCAAAATGTCACCATACTAGG - Intergenic
937954237 2:127410895-127410917 AACCAAAATGTCACCAGAAAAGG - Intergenic
939024462 2:136995466-136995488 TCCCAAAATGTCCCCTTAGATGG + Intronic
939588343 2:144032533-144032555 TCCCAAGATGTCTCCACCCTTGG - Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
943850330 2:192712633-192712655 TCACAAAACGTCACCAGACAAGG - Intergenic
945034378 2:205691679-205691701 TCCCCAAATGTCTCCTAAAATGG + Intronic
945209738 2:207369766-207369788 TCTCAAAATATCCCCAGACAAGG + Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948310655 2:236983352-236983374 TCCTACACTGTCTCCAGACTTGG - Intergenic
948563182 2:238867286-238867308 CCCCAAGATGTCTCCAGGCTAGG - Intronic
1169966588 20:11224574-11224596 TCTCAAAGTGTCTCCTTACATGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1171164794 20:22960210-22960232 TCCCAAAATGTGTCCTTACAAGG - Intergenic
1171220751 20:23394788-23394810 TGCCAGAAAGTCTCCAGGCAAGG + Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172904313 20:38357542-38357564 TCCCAAAATATTACCAGAAAGGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174075549 20:47933184-47933206 TACCCAAATGTCTACCGACAGGG + Intergenic
1174176480 20:48648613-48648635 TCTCAAAATGCCTCCCCACATGG + Intronic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1177854940 21:26390225-26390247 TCCCATAAGATCTCCAGTCAAGG + Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1180068899 21:45426398-45426420 TCCCAAAATAACTCCAGGCCAGG - Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182021060 22:27081862-27081884 TGCCAAAATGTCTCCTCACGGGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184848329 22:47102695-47102717 TCACAAGATGTCTCCAACCAGGG - Intronic
1185031003 22:48442903-48442925 TCCCAAGATGGCTCCAGGCCAGG + Intergenic
951239179 3:20270217-20270239 TGCCAAAATGTGTCCAGAATTGG - Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
954598627 3:51850605-51850627 TGCCAAAATGTGTCCAGAATTGG - Intergenic
955287477 3:57656800-57656822 TACAAAAATGTAGCCAGACATGG + Intronic
955607609 3:60722630-60722652 CAACAAAATGTCTTCAGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956723271 3:72136763-72136785 GCCCAACATTTCTCCAGATATGG + Intergenic
957139283 3:76332161-76332183 TCTCAAAATGTCTCCAATCATGG - Intronic
958489863 3:94758611-94758633 TGGCAATATGTCTCCAGCCAGGG + Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
966209548 3:177438844-177438866 TCCCAAGATGTCTCAACAGAAGG - Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967791470 3:193553577-193553599 TCCACAAATGTCACCAGAAATGG - Intronic
968954165 4:3709782-3709804 CCCCAAAATGCATCCAGACCTGG - Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970267650 4:14306748-14306770 TCACAAAAAGTGGCCAGACATGG - Intergenic
970871950 4:20826427-20826449 TTCCAAAATTTAGCCAGACATGG + Intronic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
974444979 4:61968228-61968250 TCAAAAAATGTCACCAGAAAAGG - Intronic
974965005 4:68749738-68749760 TCTCAAAATAGCTCCAGAAAAGG - Intergenic
975047698 4:69825385-69825407 TGCCAAAATGTGTCCAGAATTGG - Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
979350578 4:119640039-119640061 TCCCAAAATGTTTTCAGCAATGG - Intergenic
979928125 4:126593580-126593602 TGCCAAAATGTCTTCAAAAATGG - Intergenic
981002501 4:139841244-139841266 GCCCAAAAGGTCTGCAGAGAGGG - Intronic
982859709 4:160433990-160434012 TCACAACATGTCTCCAGCAAGGG - Intergenic
983426271 4:167587889-167587911 TCCCAAAATGTTTTCAAATATGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983790523 4:171792063-171792085 TCCAATGATGTCTCCAGAAAAGG - Intergenic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984294343 4:177834989-177835011 TCCAAAAATATCCCCAGAAAAGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984561957 4:181281364-181281386 TCCCTAAATGTCGCGTGACAAGG + Intergenic
984820589 4:183878218-183878240 TCTAAAAATGTCTCCAGCAAGGG - Intronic
985768217 5:1792779-1792801 TCCCCAAATCTCTGCACACACGG + Intergenic
985987936 5:3533171-3533193 GGCCAAAGTGTCTCCAGACCTGG - Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988745424 5:34130778-34130800 ACCCAAAATGTATACACACAAGG + Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990304657 5:54482386-54482408 GCCCAAGATGTCACCAGCCAAGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
992115797 5:73537635-73537657 TACCAAAATGCTTCCACACATGG - Intergenic
992561786 5:77959269-77959291 TGCTAAAATGTTTCCAGACTAGG - Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993056570 5:82988287-82988309 TCCCCAAATGTCTATAGACAAGG + Intergenic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994202032 5:96988092-96988114 TCCCAAAATGTATGCAGTCTTGG + Intronic
996193441 5:120573729-120573751 ACTCAAAATGTCTGCAGCCATGG + Intronic
996273928 5:121641289-121641311 TCCCACAATGTCTCAAGCAATGG + Intergenic
997072087 5:130634055-130634077 TGCCAAAATGTGTCCAGAATTGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
999087217 5:148903626-148903648 CCCCAACAGGTCTCCAGACAAGG - Intergenic
999818120 5:155198120-155198142 TCCCAAAATGCCACCACACCTGG - Intergenic
1000098011 5:157987807-157987829 TCATAAAATGGCTCCACACAGGG + Intergenic
1000141908 5:158413054-158413076 TACCAAAATGCTTTCAGACAGGG - Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001696545 5:173674536-173674558 TCCCAATAGGCCTACAGACATGG - Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003805463 6:9722674-9722696 TGCCAAAATGTGTCCAGAATTGG - Intronic
1003877489 6:10451373-10451395 ACCCAGAAGGTCTCCAAACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005941320 6:30562402-30562424 TGGCAAAATGTCGGCAGACAGGG - Exonic
1006228720 6:32563622-32563644 TCTCAAAATAGCTCCAGAAAAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008232217 6:48996708-48996730 CCCCAAACTGTCCCCAGATAGGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009317409 6:62238365-62238387 TCCCAAACTGTTTCCAGAAAAGG + Intronic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1011315704 6:86028437-86028459 TACCAAGATGTCTCCAGAAATGG + Intergenic
1011444589 6:87424057-87424079 GCCCAAGATGTCACCAGAAATGG - Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1013908172 6:115240711-115240733 TGCCAAAATGTGTCCAGAATTGG + Intergenic
1014691874 6:124572040-124572062 TCCGAAAATGTCTCTGGACTTGG - Intronic
1016183697 6:141176535-141176557 TGCCAAAATGTGTCCAGAATTGG - Intergenic
1016421364 6:143886818-143886840 ACCCAAAATGTCTACACACCTGG - Exonic
1016651796 6:146470149-146470171 TGCCAGAATGTATCCAGAAAAGG - Intergenic
1016720448 6:147290051-147290073 TTTAAAAATGTATCCAGACATGG + Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1023921585 7:44634211-44634233 TCCCAGAGTAGCTCCAGACAGGG + Intronic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028271148 7:88791229-88791251 TCCCAAAATGTTTTCAGCAATGG + Intronic
1028551257 7:92069066-92069088 TCCCTAAATGTCTCTAGTCTTGG - Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031515279 7:122691830-122691852 CCCCAGAATGTCTCCAGGCATGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033430768 7:141287690-141287712 TTTGAAAATGTCCCCAGACATGG + Intronic
1034197339 7:149258531-149258553 TCCCATAATGTCTCCTGACTTGG - Intergenic
1034461356 7:151199656-151199678 TGCCAAGATGTCACCAGACCTGG + Intronic
1034735702 7:153427461-153427483 TCCCAAAGTGTCTGCTGAGAAGG - Intergenic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1036047857 8:5164135-5164157 TACCAAACTGTCTCCCAACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037293051 8:17371468-17371490 TACCAAAATGTTTCCATACCTGG - Intronic
1037670690 8:21012884-21012906 TCCCAACAGGACTCCAGTCAAGG - Intergenic
1038447346 8:27613050-27613072 TCCCAAAACGTTTCCAAGCAGGG + Intronic
1041188973 8:55333731-55333753 TCTGAAGATGTCCCCAGACAAGG + Intronic
1042712178 8:71730442-71730464 TCCCAAAATCTCACCTGGCAGGG + Intergenic
1042716058 8:71773773-71773795 TGCCAAACTGTCTTCAGAAATGG - Intergenic
1044456963 8:92400472-92400494 TGCCAAAATGTGTCCAGAATTGG + Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047441548 8:124883391-124883413 TACCAGAGTGTCTCCAGGCATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050172544 9:2837067-2837089 TCCCAAAATGTTACCTGCCAAGG + Intronic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1052867113 9:33470711-33470733 TACCAAAATGTATTCAGAAATGG + Intronic
1052883608 9:33622304-33622326 TCCAAAAATGGCACCAGATAGGG - Intergenic
1053062951 9:35045593-35045615 TCCCCAAAGGTCTCAACACAGGG + Exonic
1054709261 9:68494729-68494751 TCTCAAGATGTCTTAAGACAAGG - Intronic
1054850194 9:69839714-69839736 AACCAAAATTTGTCCAGACATGG - Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1056967721 9:91178725-91178747 TCCTAAAATGTCCCCAGAGCGGG - Intergenic
1058221770 9:102312401-102312423 TCAAAAAATGTTTCCAGAAAGGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185819255 X:3185864-3185886 TCACAAAATGTGTCCAGAGTTGG + Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188860739 X:35252241-35252263 TCTCAACATGTCTCCAGCAAGGG + Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190464724 X:50714884-50714906 TCTCAAAATGTCTCTGAACATGG - Intronic
1190935265 X:54993992-54994014 TCCTAAGATGTCTCCAGAGATGG - Exonic
1192081122 X:68048887-68048909 CCCCAAGCTGTCCCCAGACATGG - Intronic
1194405827 X:93494567-93494589 TCGCAACATGTCTCCAGCAAGGG + Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196792363 X:119475690-119475712 TCCCCAAATTTCTCCATTCAAGG - Intergenic
1198545134 X:137683931-137683953 TCCCAAAATTTGTACAGATAAGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199566399 X:149220323-149220345 CCCCAAAAGCTCTCCAGCCAAGG + Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201272242 Y:12266308-12266330 TGCCAAAATGTGTCCAGAATTGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201649219 Y:16266439-16266461 TGCCAAAATGTGTCCAGAATTGG + Intergenic
1201653590 Y:16318861-16318883 TGCCAAAATGTGTCCAGAATTGG - Intergenic