ID: 1130092747

View in Genome Browser
Species Human (GRCh38)
Location 15:80834821-80834843
Sequence TGGGATTCTCCCTATCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130092744_1130092747 7 Left 1130092744 15:80834791-80834813 CCATTAAGGGAAACATAGTGGCG 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1130092747 15:80834821-80834843 TGGGATTCTCCCTATCAGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 109
1130092742_1130092747 19 Left 1130092742 15:80834779-80834801 CCTTGTCAGTTTCCATTAAGGGA 0: 1
1: 0
2: 2
3: 17
4: 169
Right 1130092747 15:80834821-80834843 TGGGATTCTCCCTATCAGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130092747 Original CRISPR TGGGATTCTCCCTATCAGTT TGG Intronic
904025747 1:27502497-27502519 TGGGATTCTCACTATGTGCTGGG - Intergenic
904916733 1:33975832-33975854 TGGGTTTCTCCCTATCAAGAGGG - Intronic
906101441 1:43266300-43266322 TGGGATTCTTCCTTGCAGTGAGG + Intronic
907826462 1:58021831-58021853 TTGGATGCTTCCTATCACTTGGG - Intronic
908923333 1:69222848-69222870 TGGAATTCTGCCTGTCACTTTGG - Intergenic
910091134 1:83465473-83465495 GGGGATTCTCCCTATTGGTCAGG + Intergenic
918430058 1:184450215-184450237 TGGGATTCTCCATGTCAGGGAGG + Intronic
921138908 1:212286373-212286395 TGGGTTTCTCCTGCTCAGTTGGG + Intronic
923005240 1:230044355-230044377 TGGGATTCTCCATGTCGGTCAGG - Intergenic
924442232 1:244096014-244096036 TGGTAGTCTCACTATCAGTGGGG + Intergenic
924665686 1:246069576-246069598 TGGGATTGTGTTTATCAGTTCGG - Intronic
1064672697 10:17732544-17732566 TCTGATTCTCCCCAACAGTTGGG - Intergenic
1068438391 10:57019692-57019714 TTGGATTTTCCCTATCTTTTCGG - Intergenic
1078207656 11:9244558-9244580 CGGGTTTCTCCCTGTCAGTCAGG + Intronic
1080771879 11:35349248-35349270 TGTGATTCTCCCTTTCGATTTGG - Intronic
1082195056 11:49293795-49293817 TGGCATACTCGTTATCAGTTTGG + Intergenic
1083332069 11:61903383-61903405 TGGGATTCTCCCCATTTCTTGGG - Intronic
1085819504 11:79777137-79777159 AGGGTTTCTCCCTATCGGTCAGG - Intergenic
1086660874 11:89415746-89415768 TGGCATACTCGTTATCAGTTTGG - Intronic
1087710378 11:101542493-101542515 TTGGTTTCTGCATATCAGTTGGG - Intronic
1088627967 11:111746028-111746050 TCGGATTTTCTCTTTCAGTTTGG - Intronic
1091865292 12:3829161-3829183 TGTGATTCTCCCTGTGTGTTGGG - Intronic
1096329057 12:50693236-50693258 GGGGATTCTCCCCATCAGAGAGG + Intronic
1107071330 13:36272835-36272857 TGGGATACTCTCCTTCAGTTAGG - Intronic
1108894388 13:55306186-55306208 TGGGATACACTGTATCAGTTTGG + Intergenic
1112179888 13:97068323-97068345 TGGGATTCCCCCTACCAGCGGGG + Intergenic
1114514532 14:23289507-23289529 TGGGTTTCTCCCTATAGCTTTGG + Intronic
1118997129 14:70846741-70846763 TGTGATTCTCCACACCAGTTAGG - Intergenic
1119860736 14:77934118-77934140 TGGGATTTTCCTTATAGGTTGGG + Intronic
1119981683 14:79088557-79088579 TTGGATTTTCCCTATGACTTGGG + Intronic
1129529873 15:76257125-76257147 TGGAAATGTCCCTAACAGTTAGG + Intronic
1130092747 15:80834821-80834843 TGGGATTCTCCCTATCAGTTTGG + Intronic
1131716611 15:95118137-95118159 TGGGTTTCTACCTAGCAGTGGGG - Intergenic
1132582713 16:692968-692990 TGGGACACTCCCTATCTGGTTGG - Exonic
1139604918 16:68011326-68011348 TGGGATTCACCATATCGGTCAGG - Intronic
1151266941 17:72963679-72963701 TGGGATTCCTCCTATGAGTTTGG - Intronic
1151830527 17:76546618-76546640 TGGGCTTCTTCCTAACAGTGAGG - Intronic
1153127182 18:1808553-1808575 TGGGATTCAACCTGTCAGATGGG + Intergenic
1156369710 18:36461767-36461789 TGGGGTTCTGCCTGTCTGTTGGG + Intronic
1159385539 18:67721018-67721040 TGGAATTCTCTCTTGCAGTTAGG + Intergenic
1159470876 18:68854289-68854311 AGGGATTCTCCATGTTAGTTAGG + Intronic
1159750738 18:72298985-72299007 TTGGCTTTTCCCAATCAGTTGGG - Intergenic
1162476640 19:10904457-10904479 TGGGGTTCTCACCATCAGATGGG - Intronic
1162885870 19:13696714-13696736 TGGAATTCTCCCCGTCACTTGGG - Intergenic
1163400530 19:17089520-17089542 TAGGGTTCTGCCTACCAGTTTGG - Intronic
1165220648 19:34313458-34313480 TGGGAGTGTCCCTGTCAGATGGG + Intronic
1168460629 19:56553800-56553822 TGGGATTCTGACTATGTGTTTGG + Exonic
1168627058 19:57927585-57927607 TGTGAGTCTCCCTTTCAGTGGGG - Exonic
925432476 2:3807182-3807204 CGGGATCTTCCCTATCAGATTGG + Intronic
931116409 2:59171454-59171476 TGTGATTCTCCCTGTCTGCTTGG + Intergenic
932582755 2:73003037-73003059 TGGGATACTCCTTAGCAGATGGG - Intronic
938677820 2:133656718-133656740 TGGGATTCTCTCCATTAGTTGGG + Intergenic
938705379 2:133920194-133920216 TGGCATTCTCCCTAAGAGGTTGG + Intergenic
938740920 2:134231544-134231566 TGGAATTCTTCCTTTCACTTTGG + Intronic
946525113 2:220509909-220509931 AGGGATTCTCACTAGAAGTTTGG + Intergenic
1173110250 20:40180691-40180713 TGGGTTTCTCCCTGTTGGTTAGG + Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1178141648 21:29690820-29690842 TGGGATTCATCCTATCATTTTGG + Intronic
1181005072 22:20009424-20009446 TGGCCTTCTCCCTACCACTTAGG + Intronic
1181460698 22:23084297-23084319 TCTGATTCTCCCTGTCAGTACGG + Intronic
1183887106 22:40893314-40893336 TGGGTTTCTCCGTATTAGTCAGG - Intronic
951709949 3:25577170-25577192 TGGGATTCACCCACACAGTTGGG - Intronic
953703399 3:45213636-45213658 TGGGACTCTCCATTTCAGTGGGG + Intergenic
960173567 3:114491256-114491278 TGGGATTTTCTCCAGCAGTTTGG - Intronic
967153610 3:186672602-186672624 TGGTATTCACCTTATCACTTAGG + Intronic
967157074 3:186703061-186703083 TGGTATTCACCTTATCACTTAGG + Intergenic
969875440 4:10132611-10132633 TGGGATGCCCTCTTTCAGTTTGG + Intergenic
969896873 4:10313558-10313580 TGTGAGTCTCCCTATCTGATAGG + Intergenic
970506773 4:16738948-16738970 TGGGAAACTCCCTATCATTCTGG + Intronic
972591586 4:40493168-40493190 TAGGATTCCCCCTATGAGCTGGG + Intronic
975663725 4:76712549-76712571 TGGGATTGTCCTCATCAGTGTGG + Intronic
982347811 4:154380315-154380337 TGTGATTCTTCTCATCAGTTGGG + Intronic
984058446 4:174960310-174960332 TGTGATTCTTCCTATCATTATGG + Intronic
987355592 5:17060913-17060935 AGGGAGTCTCACTATCAGTGAGG + Intergenic
991700456 5:69312161-69312183 TGGCCTTCTCCCTATGAGTCTGG - Intronic
993392597 5:87339022-87339044 TGGAATTCTCCCTTTCCTTTCGG + Intronic
996093827 5:119377503-119377525 TTGGATTCTCCATACCAGTTTGG - Intronic
997757112 5:136409630-136409652 TGGGATTCTCCCCAAGACTTTGG - Intergenic
1000272575 5:159700576-159700598 AGGGATTCTACCTATCAGCATGG - Intergenic
1000911845 5:167031754-167031776 GGGGTTTCTCCATATCAGTCGGG + Intergenic
1007560714 6:42806148-42806170 CGGGATTCTCCCCTTAAGTTTGG + Intronic
1008522836 6:52378903-52378925 GGGGTTTCACCATATCAGTTAGG - Intronic
1010448634 6:75977394-75977416 GGGGTTTCTCCATATCAGTCAGG - Intronic
1010873009 6:81064665-81064687 TGGGATTCAATCTATCAGGTGGG - Intergenic
1014041193 6:116827811-116827833 TGGCATTCTCCCTAAAAGTTGGG - Intronic
1017990821 6:159488499-159488521 TGGGATTCTCCCGAATAGATTGG + Intergenic
1018754225 6:166835349-166835371 TTGGATTCTCAAAATCAGTTTGG + Intronic
1019178259 6:170171826-170171848 TGGGATTCTTCCTCTCTGTTCGG + Intergenic
1019178266 6:170171866-170171888 TGGGATTGTTCCTCTCTGTTTGG + Intergenic
1019178300 6:170172067-170172089 TGGGGTTGTTCCTCTCAGTTCGG + Intergenic
1019178311 6:170172127-170172149 TGGGATTGTTCCTCTCTGTTCGG + Intergenic
1027256295 7:76432850-76432872 TGAGATACTCCCCATCAGTGGGG + Intronic
1031616466 7:123887760-123887782 TGGTATTCACTCTATGAGTTGGG + Intergenic
1034629509 7:152520224-152520246 GGGGTTTCACCATATCAGTTAGG + Intergenic
1034680512 7:152924772-152924794 TGGGATTCCCACTCTCAGATGGG + Intergenic
1036832386 8:12031256-12031278 CGGGTTTCTCCCTGTCAGTCAGG - Intergenic
1038021064 8:23552185-23552207 TGGTTTTCTCCCTACCAGGTAGG + Intronic
1038047670 8:23779913-23779935 TGGGCTGCTCACTCTCAGTTGGG - Intergenic
1039753750 8:40500405-40500427 TGGATTTCTCCCTATATGTTGGG + Intergenic
1040110909 8:43566832-43566854 TGGGATCCTCCCTCTGAGTCCGG - Intergenic
1042251874 8:66764314-66764336 AGGAATTCCCCTTATCAGTTAGG + Intronic
1043944062 8:86230119-86230141 TGGGAGTCTCCCTGTGCGTTTGG - Exonic
1044147843 8:88739935-88739957 TGGGATTCTCAGAAACAGTTGGG - Intergenic
1045388062 8:101690031-101690053 TGGGTTTCTGCCTCTCAGTTAGG + Intronic
1047061457 8:121231396-121231418 TGGGCTTCTTCCTCTTAGTTAGG + Intergenic
1047396138 8:124500772-124500794 TGGTTTTCTCCCTGTAAGTTTGG - Intronic
1051129176 9:13840619-13840641 TGGCATTCTACCTATCATTAAGG - Intergenic
1051343539 9:16132312-16132334 TGGCATTCTCCCTAGCCGTCCGG - Intergenic
1054720216 9:68596229-68596251 AGAGATTCTCCCCATCAGCTGGG - Intergenic
1059656382 9:116361350-116361372 TGTGATTCTCCATTTCTGTTCGG + Intronic
1187559197 X:20384782-20384804 TGGCATTCTCTCTATCTGTGGGG + Intergenic
1189147578 X:38671110-38671132 TGGCATTGTGCCTATCAGCTTGG - Intronic
1194016511 X:88627962-88627984 TGGTATTCCCCTTATCATTTCGG - Intergenic
1194455510 X:94098435-94098457 CTGGATTCTGCCTATCATTTTGG + Intergenic
1194698581 X:97086048-97086070 TAGAATTCTCCCTATCATATTGG - Intronic
1194997516 X:100607580-100607602 TGGAAGTCTCCCTAAAAGTTAGG - Intergenic
1198532591 X:137560757-137560779 AGGAATTCTCCCTCTCAGCTTGG + Intergenic