ID: 1130092990

View in Genome Browser
Species Human (GRCh38)
Location 15:80836820-80836842
Sequence ACTTCCTACTGCTCTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130092990_1130092994 27 Left 1130092990 15:80836820-80836842 CCAGGACCAGAGCAGTAGGAAGT 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1130092994 15:80836870-80836892 AATAATGTGATAGGATTGTAAGG 0: 1
1: 0
2: 2
3: 19
4: 203
1130092990_1130092995 28 Left 1130092990 15:80836820-80836842 CCAGGACCAGAGCAGTAGGAAGT 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1130092995 15:80836871-80836893 ATAATGTGATAGGATTGTAAGGG 0: 1
1: 0
2: 1
3: 21
4: 212
1130092990_1130092992 1 Left 1130092990 15:80836820-80836842 CCAGGACCAGAGCAGTAGGAAGT 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1130092992 15:80836844-80836866 ATAAGTGATATTTTGCAGCAAGG 0: 1
1: 0
2: 2
3: 13
4: 196
1130092990_1130092993 18 Left 1130092990 15:80836820-80836842 CCAGGACCAGAGCAGTAGGAAGT 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1130092993 15:80836861-80836883 GCAAGGCAGAATAATGTGATAGG 0: 1
1: 1
2: 1
3: 28
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130092990 Original CRISPR ACTTCCTACTGCTCTGGTCC TGG (reversed) Intronic
901173324 1:7279970-7279992 ACTCCCTCCCGCTCTGGACCTGG - Intronic
901717098 1:11164530-11164552 ACTTCCTACTGGTTTAGTCTTGG - Intronic
902817870 1:18926402-18926424 ACTTCCCACAGCCCTGGGCCAGG + Intronic
905483095 1:38275157-38275179 ATTTCCTCCAGCTCTGATCCGGG + Intergenic
907845023 1:58197249-58197271 AATTCTCACTGTTCTGGTCCAGG - Intronic
909963535 1:81879414-81879436 ACTTGCTACTGTTCTAGTCAAGG - Intronic
911537222 1:99114877-99114899 ACTTCTTCCTGCTTTAGTCCTGG + Intergenic
914674905 1:149900665-149900687 ACTCACTACTGCTCTTGCCCTGG + Intronic
915445505 1:155972359-155972381 ACTGCCTAGTGCTATTGTCCCGG + Intronic
915922236 1:159985071-159985093 ACTTCCTTCTGTCCTGGTGCAGG - Intergenic
915944100 1:160137115-160137137 CCTCCTTACAGCTCTGGTCCAGG - Intronic
916558632 1:165913989-165914011 AATTCTGACTGTTCTGGTCCAGG + Intergenic
920354813 1:205363842-205363864 TTTTCTTACTGCTCTGTTCCTGG - Intergenic
922843642 1:228665423-228665445 GGCTCCTACTGCTCTGGTTCTGG + Intergenic
1064325166 10:14343650-14343672 ACTTCCTACTGCTCAGCATCAGG + Intronic
1064743415 10:18456173-18456195 ACTTCCTACTGATCTTGGCCAGG + Intronic
1065553624 10:26892818-26892840 TCTGCCAGCTGCTCTGGTCCTGG - Intergenic
1065615070 10:27512696-27512718 AGTTGCTACTGCTCTCCTCCTGG - Intronic
1067019031 10:42779354-42779376 ACTTCCTACTAGTCTGTGCCTGG - Intergenic
1067258517 10:44666206-44666228 ACTCCTTGCTGCTCTGCTCCTGG - Intergenic
1067348875 10:45457838-45457860 ACTCCCCAATGCTCTGCTCCAGG + Exonic
1067498889 10:46784948-46784970 ACTTCCTACTAGTCTGTGCCTGG - Intergenic
1067595754 10:47555425-47555447 ACTTCCTACTAGTCTGTGCCTGG + Intergenic
1069327024 10:67243627-67243649 ACTTCCTACTACTCCTGTCACGG + Intronic
1069786085 10:70988815-70988837 ACTGCCTCCTACTCTGGGCCTGG + Intergenic
1070664606 10:78334159-78334181 GCTGCCTACTGCTCAGGTCTGGG - Intergenic
1070709547 10:78669844-78669866 ACTTCTTATTGGTCTGGTCAGGG - Intergenic
1071841498 10:89476583-89476605 ACTTCCCAGTTCTCTGGTTCAGG + Intronic
1073004394 10:100311557-100311579 ACTTCTTACTGCTCTGAGCTGGG - Intronic
1073453163 10:103621470-103621492 GCTTCCTGCTGCTTTGGGCCTGG + Intronic
1076490706 10:130859421-130859443 ACTTCCCACTTCTCTGAGCCAGG - Intergenic
1076522724 10:131091001-131091023 ACTGCCTACTGCTGAGCTCCTGG - Intergenic
1079398248 11:20084532-20084554 ACTTCCTACTGCTATGGGTGAGG + Intronic
1083174542 11:60941284-60941306 ACTTCCTCCTGCCCAGATCCCGG - Exonic
1084547781 11:69822929-69822951 TCTCCCCACTGCTCGGGTCCTGG - Intergenic
1087190476 11:95249190-95249212 ACTTCCCACTGCTCTCTTCCTGG - Intergenic
1088810356 11:113387789-113387811 GCTTCCTGCTCCTCGGGTCCGGG - Exonic
1091152794 11:133344333-133344355 ATTACCTACTGCTATAGTCCTGG + Intronic
1091158228 11:133393948-133393970 ACTTCCTACTCCTCAGGCCTGGG - Intronic
1091289289 11:134428383-134428405 ACTTCCTGGTGCTCTGATTCAGG - Intergenic
1091801057 12:3324690-3324712 ACTTCCCAGTTCTCTGTTCCGGG + Intergenic
1092254077 12:6916781-6916803 CCTTCCTCCTGCCCTGCTCCGGG - Intronic
1095863896 12:46950348-46950370 ACTTCCTGCTGCACCAGTCCAGG - Intergenic
1096111657 12:49032391-49032413 ACTTGCTGCTGCTGTTGTCCTGG + Exonic
1096994593 12:55830722-55830744 GTTGCCTACTGCTCTAGTCCAGG - Exonic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1097544949 12:60986934-60986956 TCTTCCTACTACTCTAGTCATGG + Intergenic
1098821997 12:75243572-75243594 TCTTGCTCCTGCTCTGGTCATGG + Intergenic
1099301429 12:80899662-80899684 ACTTCCTATTGGTCTGTTCTGGG + Intronic
1103779208 12:123388494-123388516 ACTTCCTAGTTCTGTGGCCCGGG + Intronic
1103898748 12:124292280-124292302 CCTTCCTACAGCGCTGGGCCTGG + Intronic
1104599196 12:130141171-130141193 ACTTCAAACTGCTCTCGTCAAGG + Intergenic
1104753449 12:131254359-131254381 AGTTCCTTCTGCTCTTGTGCAGG - Intergenic
1106751234 13:32770460-32770482 TCTTCCTCCTCCTCTGGTGCTGG - Exonic
1107196480 13:37658786-37658808 ACTTCCTCCTGCTCCTTTCCAGG - Intronic
1107604812 13:42047710-42047732 ACTTCCTCCTGCTCTAGTCCGGG + Intronic
1109050228 13:57471073-57471095 CCTTCCTACTCCTCATGTCCTGG + Intergenic
1109884666 13:68526571-68526593 ACTTCCTCCTGATTTAGTCCTGG - Intergenic
1110358092 13:74591704-74591726 ACCTGCTCCTGTTCTGGTCCTGG - Intergenic
1112444659 13:99453331-99453353 TCCTCCTCCTGCCCTGGTCCAGG + Intergenic
1113155399 13:107314637-107314659 ACTTCCTCCTGCCCTAGTCTTGG + Intronic
1114642492 14:24232827-24232849 ACTTCCTGTTGCCTTGGTCCAGG - Intronic
1117833683 14:59779739-59779761 ACTTACTGCTTCCCTGGTCCTGG + Intronic
1120873697 14:89360189-89360211 ACTGCCTCCTCCTCTGGACCTGG + Intronic
1122056580 14:99102475-99102497 TCTTCCTCCTGCTCTGGTCATGG + Intergenic
1125486353 15:40113806-40113828 CCCTCCGACTGCTCTGCTCCAGG + Intergenic
1126086740 15:45017712-45017734 ACTTCTTCCTGCTTTAGTCCTGG + Intergenic
1128246145 15:66134174-66134196 GGTTTCTACTGCTCTGCTCCAGG - Intronic
1129707002 15:77800042-77800064 CCTTCCCACAGCTCTGGACCTGG - Intronic
1130092990 15:80836820-80836842 ACTTCCTACTGCTCTGGTCCTGG - Intronic
1131020283 15:89091883-89091905 ACTTCTCATTGCTCTGTTCCTGG - Intronic
1131067955 15:89446092-89446114 CCTTCCTCCAGCCCTGGTCCAGG - Intergenic
1131903032 15:97109797-97109819 ACTTCCTCCTGCTTTAGTCTTGG - Intergenic
1133864576 16:9630616-9630638 ACAGCCCACTGCTATGGTCCTGG + Intergenic
1134037121 16:11039732-11039754 ACATCCTTCTCCTCTGTTCCAGG + Exonic
1134670709 16:16052888-16052910 AGTTCCTTCTGCTCTGTCCCTGG + Intronic
1138328354 16:56193050-56193072 ACTTCCCCCTGCTCTTTTCCTGG + Intronic
1139710276 16:68770696-68770718 TCTTCCTACTGCTCTCTTCATGG - Intronic
1139805365 16:69560870-69560892 CCTTCATACTGCTCTGGCACTGG + Intergenic
1144407921 17:14970584-14970606 ATTTCATTCTGCTCTGGTCTTGG + Intergenic
1147567648 17:41547527-41547549 GCTTCCCACTGCTCTGCTCTGGG + Intergenic
1148272012 17:46268550-46268572 GCTTCCTACAGCTCTGCTCCAGG + Intergenic
1149111002 17:53030474-53030496 ACTTCCTAGTGGTCTGTTCAGGG + Intergenic
1149413598 17:56434862-56434884 ATTTCATAATGCTCTGGTGCTGG + Intronic
1149517608 17:57292388-57292410 TCTGCCCCCTGCTCTGGTCCAGG - Intronic
1150218910 17:63484908-63484930 TCTTCCTGCTGCTCTGCTACGGG + Exonic
1150675779 17:67245115-67245137 ACTTCCCCCTTCTCTGCTCCTGG - Intronic
1150764366 17:67992035-67992057 GCTCCCTACAGCTCTGCTCCAGG - Exonic
1155657064 18:28204773-28204795 ACTTCCTAGTGCTTTGGTGAAGG + Intergenic
1157601799 18:48897435-48897457 ACTTCCTGCTGCCCAGCTCCTGG + Intergenic
1158994373 18:62902361-62902383 ACTCCCAACTGCTCAGGACCAGG - Intronic
1158998706 18:62950901-62950923 ACTTCCTGCTAGTCTGTTCCTGG - Intronic
1159890905 18:73952327-73952349 ACTTTCTACTCCTCTGTTGCAGG - Intergenic
1161226093 19:3146699-3146721 AGTCCCCACTGCCCTGGTCCGGG + Intronic
1163020262 19:14477831-14477853 CCTCCCTCCTGCTCTGGGCCAGG + Exonic
925033037 2:666193-666215 ACTGCCTTCTGCTCCAGTCCTGG - Intergenic
928234349 2:29527015-29527037 ACTTCCTGCTGCCCTAGTCCTGG + Intronic
930516571 2:52414873-52414895 ACTTCCTGCTGCTTTGCTTCAGG + Intergenic
931797859 2:65728961-65728983 ACTTCCTTATGCTGTGGCCCAGG + Intergenic
933839683 2:86276360-86276382 TTTTCCTACTGCTCTGCTTCTGG + Intronic
937382355 2:121391280-121391302 GCTTCAACCTGCTCTGGTCCTGG - Intronic
938730641 2:134144331-134144353 TCTTCCTCCTGCTCTGGCCATGG - Intronic
939520505 2:143224112-143224134 ACTGGCTTCTGCTCTGTTCCAGG - Intronic
941342416 2:164323915-164323937 ACTTAGTACTGCTCTCTTCCAGG + Intergenic
942034257 2:171995417-171995439 ACATCCTCCTTCTCTTGTCCTGG + Intronic
942449137 2:176098420-176098442 TCTTCCTCCTGCTCTGGTGGGGG - Intergenic
943033693 2:182715615-182715637 ATCTCCTACTGCTATGGTACAGG - Intergenic
944606140 2:201353103-201353125 ACTCCCAAATGCTCTGGTTCTGG - Intronic
945589778 2:211715688-211715710 TCTTCCTCCTGCTCTGGCCATGG + Intronic
948803678 2:240443948-240443970 ACTCACTCCTGCTCTGGGCCTGG + Intronic
1171998498 20:31752421-31752443 ACTTGCTACTGTTTTGGTCATGG + Intronic
1172959533 20:38788744-38788766 ATTTCCTTCTTCTGTGGTCCTGG + Intergenic
1176387171 21:6144040-6144062 TCTTCCTCCTGCTCTGGCCATGG + Intergenic
1177294968 21:19162204-19162226 TCTTCCTCCTGCTCTGGCCATGG - Intergenic
1179736302 21:43394212-43394234 TCTTCCTCCTGCTCTGGCCATGG - Intergenic
1180559119 22:16601616-16601638 ACTTCCTCCTCCCCTGCTCCGGG + Intergenic
1181090895 22:20471824-20471846 AGTTGCTACTGCTCCGATCCAGG - Intronic
1182575652 22:31271204-31271226 ATGTCCCACTGCTCTGGGCCTGG + Intronic
1183212985 22:36462385-36462407 ACCTCCTCCTGCTCTGGAGCTGG - Intergenic
1183495874 22:38143519-38143541 ACTTCCTGCTGGTGTGGCCCTGG - Intronic
950655272 3:14432574-14432596 ACTGCCTGCAGCTCTGCTCCAGG - Intronic
951936901 3:28032211-28032233 ACTTCCTCCTGCTTTGGCCATGG + Intergenic
952751420 3:36827877-36827899 AGTTGCTGCTGCTCTGGGCCAGG - Exonic
953195717 3:40731401-40731423 ACTTCCACCTGCTCAGGTGCTGG - Intergenic
954743623 3:52774253-52774275 TCCTCCTTCTGCTCTGCTCCAGG - Intergenic
957566633 3:81892575-81892597 CCTTCCTACTGTGCTTGTCCTGG + Intergenic
957721712 3:84011035-84011057 ACTTCTTCCTGCTATGGTCTTGG - Intergenic
958015860 3:87939578-87939600 ACTTCTTCCTGCTTTGGTCTTGG + Intergenic
961433070 3:126896958-126896980 ACCTCCTACTGCTGTAGTCCAGG + Intronic
961502597 3:127347882-127347904 ACCTCCTACTGCTGTGCTCAAGG - Intergenic
962743588 3:138381430-138381452 ACTACCTCCTGCTTTGGCCCAGG + Intronic
965802798 3:172511928-172511950 TCTTCCTCCTGCACTGCTCCAGG - Intronic
966669210 3:182507902-182507924 ACTGCATACTGCTCTCCTCCTGG - Intergenic
966917067 3:184590897-184590919 ACTTCCTCCAGCTCTGGCCTTGG - Intronic
971563481 4:28112583-28112605 ACTTCTCACTGCTCTGCTCAGGG - Intergenic
971568928 4:28184900-28184922 CCTTGCTACTGCTCTGGCCATGG + Intergenic
973879673 4:55256762-55256784 ATTTCCTGCTGCTCTGTTTCTGG + Intergenic
975281684 4:72569159-72569181 ACTTCCCCCTGCTGTGCTCCGGG - Intergenic
977780457 4:100975617-100975639 ATTTCCTGCTGCTCTGTCCCAGG + Intergenic
982054113 4:151530321-151530343 CCTACCTACTGCCCTGGTCTCGG - Intronic
984474442 4:180217719-180217741 ATTGCCTCCTGCTCTGGTCATGG - Intergenic
985148746 4:186923056-186923078 ACTTCCTACTGCTGTGAGACTGG + Intergenic
989362815 5:40623081-40623103 TCTTCCTTCTACTCTGGGCCTGG + Intergenic
996297843 5:121944197-121944219 ACTTATTACTGCTGTGGCCCTGG - Intergenic
996449341 5:123601495-123601517 GCTTCCTTCTGGTCTGGTTCTGG + Intronic
996932059 5:128901515-128901537 ATTTCTTACTGCCCTGGCCCAGG + Intronic
997699286 5:135885210-135885232 ACCTCCCATTGCTCTGGTCCAGG + Intronic
1001706396 5:173744210-173744232 ACCTACTCCTGCTCTGGCCCTGG + Intergenic
1004267367 6:14160457-14160479 ACTTGCTTATGCTCTGCTCCAGG - Intergenic
1006951732 6:37827854-37827876 ACTTGCTACCGCTCTGGCCTTGG + Intronic
1007935236 6:45726892-45726914 ACTGCCTTCTGCGCTGTTCCTGG + Intergenic
1019047530 6:169160346-169160368 AATTCCTGCTCCTCTGGGCCAGG - Intergenic
1019882173 7:3871641-3871663 ACTTGCTTCTGCTCTTGCCCTGG - Intronic
1020047139 7:5048836-5048858 TCTTCCTCCTGCTCTGGTGATGG - Intronic
1020292500 7:6732694-6732716 TCTTCCTCCTGCTCTGGTGATGG - Intergenic
1022615942 7:31930198-31930220 ACTTCCTCCTGTTTTAGTCCTGG - Intronic
1022708672 7:32831433-32831455 ACTTGATACTGCTCTGGTGATGG + Intergenic
1026727675 7:72882292-72882314 TCTTCCTTCTGCTCTGGTGATGG - Intronic
1027116164 7:75483435-75483457 TCTTCCTCCTGCTCTGGTGATGG + Intronic
1027275663 7:76552263-76552285 TCTTCCTCCTGCTCTGGTGATGG - Intergenic
1029721370 7:102366817-102366839 TCTTCCTCCTGCTCTGGTGATGG - Intronic
1033141703 7:138833068-138833090 ACTTCCTCCTGCTCCTGTCCAGG + Intronic
1034618202 7:152436391-152436413 ACTTCCTCCTCCCCTGCTCCGGG - Intergenic
1034933838 7:155185464-155185486 ACTTCCACCTGCTTGGGTCCAGG + Intergenic
1035104615 7:156431823-156431845 TCTTCCTCCTGCTCTGGCCATGG + Intergenic
1036120021 8:6006204-6006226 TCTTCCTCCTGCTCTGGCCATGG - Intergenic
1037150372 8:15627819-15627841 ACTTCTTGTTGCTCTGTTCCTGG + Intronic
1039031642 8:33316212-33316234 ACTTCCTGCTTCTATGGTGCTGG + Intergenic
1044087445 8:87957846-87957868 ACTAACTACTGCTTGGGTCCTGG - Intergenic
1045015428 8:97997320-97997342 ACTTTCTACTTCTCAGGACCTGG + Intronic
1046663363 8:116973185-116973207 ATTTCCTACTGTTCTGGAGCTGG - Intronic
1046727872 8:117694267-117694289 ACTTCCTGCTTCTCTGGTCATGG + Intergenic
1051371628 9:16364142-16364164 ACATCCCACTGCTGGGGTCCAGG + Intergenic
1051942306 9:22522593-22522615 TCTTGCTAATGCTGTGGTCCTGG - Intergenic
1052202811 9:25803178-25803200 ACCCTCTACTGCTCTGGTTCTGG + Intergenic
1060187962 9:121575352-121575374 CCTTCCTTCTTCTGTGGTCCTGG + Intronic
1060727249 9:126014833-126014855 ACGTCCAGCTGCTGTGGTCCCGG + Intergenic
1060941100 9:127543303-127543325 ACTTCCTGCAGCTGTTGTCCGGG - Intronic
1185848161 X:3459582-3459604 ACTTCCTGCTGCTTTGTTGCTGG + Intergenic
1188215742 X:27474859-27474881 CCTACCTACTTCTCTGGCCCAGG + Intergenic
1188647995 X:32593024-32593046 ACCTCTTACTGCTCTGTGCCTGG + Intronic
1192332426 X:70187113-70187135 CATTGCTACTGCTATGGTCCAGG - Intronic
1200158608 X:153992398-153992420 ACTTCCTACTGCTGTGAACTTGG - Intergenic
1200219528 X:154384251-154384273 CCTTCCTAATCCTCTGGTTCCGG - Intergenic