ID: 1130093616

View in Genome Browser
Species Human (GRCh38)
Location 15:80840447-80840469
Sequence CTGCCTCGCCACAGTTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130093616_1130093620 0 Left 1130093616 15:80840447-80840469 CCTCCAGAACTGTGGCGAGGCAG 0: 2
1: 0
2: 0
3: 16
4: 152
Right 1130093620 15:80840470-80840492 CCGTTTTTAAATGTTTGTTTGGG 0: 1
1: 1
2: 3
3: 37
4: 483
1130093616_1130093618 -1 Left 1130093616 15:80840447-80840469 CCTCCAGAACTGTGGCGAGGCAG 0: 2
1: 0
2: 0
3: 16
4: 152
Right 1130093618 15:80840469-80840491 GCCGTTTTTAAATGTTTGTTTGG 0: 1
1: 1
2: 2
3: 20
4: 229
1130093616_1130093622 25 Left 1130093616 15:80840447-80840469 CCTCCAGAACTGTGGCGAGGCAG 0: 2
1: 0
2: 0
3: 16
4: 152
Right 1130093622 15:80840495-80840517 TTCTGGAAGCTCCTTGAAGTTGG 0: 1
1: 1
2: 1
3: 36
4: 252
1130093616_1130093621 8 Left 1130093616 15:80840447-80840469 CCTCCAGAACTGTGGCGAGGCAG 0: 2
1: 0
2: 0
3: 16
4: 152
Right 1130093621 15:80840478-80840500 AAATGTTTGTTTGGGTTTTCTGG 0: 2
1: 0
2: 3
3: 35
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130093616 Original CRISPR CTGCCTCGCCACAGTTCTGG AGG (reversed) Intronic