ID: 1130094276

View in Genome Browser
Species Human (GRCh38)
Location 15:80844440-80844462
Sequence AGCAGTCACCTGGCTAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130094276_1130094280 2 Left 1130094276 15:80844440-80844462 CCAAATTTAGCCAGGTGACTGCT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1130094280 15:80844465-80844487 GCCCTGCTCCTCTTTCTCTGGGG 0: 1
1: 1
2: 3
3: 42
4: 415
1130094276_1130094279 1 Left 1130094276 15:80844440-80844462 CCAAATTTAGCCAGGTGACTGCT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1130094279 15:80844464-80844486 TGCCCTGCTCCTCTTTCTCTGGG 0: 1
1: 0
2: 6
3: 45
4: 498
1130094276_1130094285 10 Left 1130094276 15:80844440-80844462 CCAAATTTAGCCAGGTGACTGCT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1130094285 15:80844473-80844495 CCTCTTTCTCTGGGGTTTTTGGG 0: 1
1: 0
2: 1
3: 34
4: 314
1130094276_1130094283 9 Left 1130094276 15:80844440-80844462 CCAAATTTAGCCAGGTGACTGCT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1130094283 15:80844472-80844494 TCCTCTTTCTCTGGGGTTTTTGG 0: 1
1: 0
2: 2
3: 35
4: 417
1130094276_1130094278 0 Left 1130094276 15:80844440-80844462 CCAAATTTAGCCAGGTGACTGCT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1130094278 15:80844463-80844485 TTGCCCTGCTCCTCTTTCTCTGG 0: 1
1: 0
2: 5
3: 44
4: 383
1130094276_1130094287 28 Left 1130094276 15:80844440-80844462 CCAAATTTAGCCAGGTGACTGCT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1130094287 15:80844491-80844513 TTGGGTGGCCATTGCCTCCATGG 0: 1
1: 0
2: 0
3: 16
4: 150
1130094276_1130094286 13 Left 1130094276 15:80844440-80844462 CCAAATTTAGCCAGGTGACTGCT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1130094286 15:80844476-80844498 CTTTCTCTGGGGTTTTTGGGTGG 0: 1
1: 1
2: 1
3: 58
4: 602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130094276 Original CRISPR AGCAGTCACCTGGCTAAATT TGG (reversed) Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
907358117 1:53893064-53893086 AGCAGTCAGCTGGCTAAAGTGGG - Intronic
913298156 1:117342371-117342393 AGCTGTATCCTGGCTAAATGGGG + Intergenic
918798812 1:188943741-188943763 ACCAGTCATCTGGTTAAATTAGG + Intergenic
919499866 1:198324424-198324446 AGCAATCACTTGGCTACAGTTGG - Intergenic
924902453 1:248416015-248416037 AGCTGTCACCTGACCAATTTTGG - Intergenic
1064669837 10:17701444-17701466 AACAGGCAACAGGCTAAATTTGG - Intronic
1065126495 10:22579162-22579184 GGCAGTCACATGGTTAACTTGGG + Intronic
1065375187 10:25032473-25032495 AGCAGTCACCCTGCTACATGGGG + Intronic
1066298574 10:34077116-34077138 AGCAGTCATATGACTCAATTTGG - Intergenic
1068453890 10:57231028-57231050 AGCAGTCAGTAGGCTAGATTGGG + Intergenic
1068566798 10:58584737-58584759 AGGAAACACCTGGGTAAATTGGG + Intronic
1070767514 10:79065296-79065318 AGAAGTCACCTGGCTCCACTAGG - Intergenic
1073546080 10:104350264-104350286 AGCACTCATTTGTCTAAATTAGG + Intergenic
1080291879 11:30680147-30680169 CATAGTCACATGGCTAAATTGGG - Intergenic
1081714205 11:45237048-45237070 AGGAGGCACCTGGCTGGATTGGG - Intergenic
1083707856 11:64529148-64529170 AGCTGTCACCTGCCTAGATGAGG + Intergenic
1092992622 12:13917555-13917577 AGCAGTGACCAGGGTAAATGTGG + Intronic
1093495754 12:19755285-19755307 AGCAAATTCCTGGCTAAATTGGG - Intergenic
1094406974 12:30126581-30126603 AGCAGTTTCCTGGGTAATTTAGG + Intergenic
1099481414 12:83171043-83171065 TGTAATCACCTTGCTAAATTTGG - Intergenic
1102702977 12:114855838-114855860 AACAGTCAATTGGCCAAATTGGG - Intergenic
1103098865 12:118154963-118154985 ACCAGGCACCAGGCTAGATTTGG - Intronic
1105324197 13:19355323-19355345 AGCAGTCACACAGCTAAAGTGGG + Intergenic
1105869064 13:24488081-24488103 AGCAGTCACACAGCTAAAGTGGG - Intronic
1106250352 13:27977858-27977880 AGCAGTGAGCTGGATAAATCCGG + Exonic
1108114138 13:47109345-47109367 AGTAGCCACCTGGATAAACTGGG + Intergenic
1111634137 13:90881580-90881602 AGCAGTCACATGGCTAGAGCAGG - Intergenic
1119706227 14:76784287-76784309 AGCACGCACCTGCCTAATTTAGG + Intergenic
1125188197 15:36957365-36957387 TGCAATCATCTGGCTAATTTAGG + Intronic
1126804770 15:52336680-52336702 AGCCACCACCTGGCTAAAATTGG + Intronic
1130094276 15:80844440-80844462 AGCAGTCACCTGGCTAAATTTGG - Intronic
1131041400 15:89270740-89270762 AGGATCCAACTGGCTAAATTTGG - Intronic
1133707597 16:8369976-8369998 AGAAGTCAACTAGGTAAATTGGG + Intergenic
1134158994 16:11869226-11869248 AGCAGTCAGTTGGTTAGATTAGG - Exonic
1134436216 16:14260310-14260332 AGAATGCACATGGCTAAATTGGG + Intronic
1134660776 16:15982858-15982880 AGCAGGCAGCAGGCTGAATTTGG + Intronic
1145234266 17:21197738-21197760 AGCAGTCTCCTGGCTCACCTTGG - Exonic
1148782136 17:50128514-50128536 TGCAGTTACCTGGCTGAATGGGG - Intronic
1150810219 17:68350404-68350426 AGCAGTTACCTGGGTAATTGGGG + Intronic
1151218575 17:72594114-72594136 AGGAGGCACCTGGGTAAATGGGG + Intergenic
1152177254 17:78795885-78795907 AGCAGTCACTTGGTTGACTTAGG - Exonic
1154265708 18:12876964-12876986 GGTAGTCACATGGGTAAATTAGG + Intronic
1154405277 18:14084876-14084898 AGCAGTCATCTGGTTACTTTAGG - Intronic
1164397536 19:27879102-27879124 AGCTGTCCCTTGACTAAATTAGG - Intergenic
1164478355 19:28592317-28592339 AGCAAGCACCTGGCTATCTTTGG - Intergenic
930163439 2:48180795-48180817 AGCAGGCAGCAGGCTGAATTTGG - Intergenic
935034584 2:99356903-99356925 GGCAGTCACCTTGTCAAATTAGG - Intronic
935560988 2:104559904-104559926 ACAAGTCACCTGGGAAAATTTGG - Intergenic
938633776 2:133199405-133199427 AGCAGTCACCTCCCTCAAATAGG + Intronic
939457766 2:142460597-142460619 AACAGGCAGCTAGCTAAATTTGG + Intergenic
939592838 2:144086674-144086696 AGAAGTCAGCTGGATAAAATAGG + Intronic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
942336028 2:174886727-174886749 AGCAGACACAGGCCTAAATTTGG + Intronic
946988157 2:225297971-225297993 AGTTTTCACCTGTCTAAATTTGG + Intergenic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1178217695 21:30619815-30619837 AGCAGTCACCTGGGGGAATAAGG - Intergenic
1181866064 22:25856429-25856451 AGCAGGCACTTGGTTAAAGTTGG - Intronic
950877233 3:16287258-16287280 AGGAGTCACTTGACTAATTTTGG + Intronic
953984077 3:47427974-47427996 AGCAGGGACCGGGGTAAATTAGG + Intronic
962133970 3:132712844-132712866 AGCAAACTCCTGGCTAGATTTGG + Intronic
964517562 3:157529315-157529337 ATCAGGCAACTGGCTGAATTTGG + Intronic
966384087 3:179376689-179376711 AGCTGGCAGCTGGCTAGATTTGG + Intronic
971246911 4:24937747-24937769 AGGAGTCACATGGCTAACTCTGG - Intronic
971273710 4:25175346-25175368 AGCATCCACCTGGCTAGAGTAGG - Intronic
977327164 4:95589990-95590012 AGAAGTCACATGCCTAAGTTGGG - Intergenic
978005925 4:103616545-103616567 AGCATACACCTGGGAAAATTAGG - Intronic
982426247 4:155265022-155265044 AGCAGTTTCCTGGCAAACTTGGG - Intergenic
984905479 4:184622036-184622058 AGCAGGCTTCTGGCTAAAATCGG - Intergenic
985020568 4:185684599-185684621 AGCAGTCACTTGCCAAAAATAGG - Intronic
985858653 5:2451318-2451340 AGCAGGCAGCTGGCCAGATTTGG + Intergenic
993164746 5:84338231-84338253 AGCACACTCCTGACTAAATTTGG + Intronic
994146196 5:96398261-96398283 AGGACTCAACTGACTAAATTTGG - Intronic
998188122 5:139998504-139998526 TGCAGTCCCATGGCTAGATTGGG - Intronic
998563300 5:143192436-143192458 AGCAGGCACCTGGCTGGATGTGG - Intronic
998675135 5:144399249-144399271 AGCAGTGACCTAGATAACTTGGG - Intronic
998790494 5:145761738-145761760 AGCAGGCAGCCGGCTAAATTTGG + Intronic
999323075 5:150626564-150626586 AGCATTTACATGGCTAAATAAGG + Intronic
1000051146 5:157563862-157563884 AACAGTCTCCTGGCTACATCGGG - Intronic
1000770603 5:165348760-165348782 AGCAGTCAACTTGCTCAATGCGG - Intergenic
1001640877 5:173243371-173243393 AGCTGTTACCTGGCTTATTTAGG + Intergenic
1003644165 6:7900983-7901005 TGAAGTCACATGGCTAGATTAGG + Intronic
1004602249 6:17161609-17161631 AACAATCACCTGGATAATTTTGG - Intergenic
1005019304 6:21402333-21402355 AGCAGCCACCTGGCCACATATGG + Intergenic
1009276104 6:61682497-61682519 AACAATCAGCTGGCCAAATTTGG - Intronic
1010082550 6:71881202-71881224 AACAGTCATTTGGCTAAATTTGG + Intergenic
1013655057 6:112237895-112237917 AACAGTCTCCTGGCTAGATTGGG - Intronic
1014089783 6:117390468-117390490 AGAAATCACATGGCTAAATATGG + Intronic
1015728849 6:136327387-136327409 AGCAGTCATCTAGGGAAATTTGG + Intergenic
1017265932 6:152446275-152446297 AACAGGCAACTGGCTAAATGTGG + Intronic
1019391823 7:792290-792312 AACAGTCACCTGGCTAAGCATGG + Intergenic
1022340680 7:29464679-29464701 AGGAGTCACCTGGCCAACCTGGG - Intronic
1023452144 7:40298208-40298230 ATCAGTCACCATGCTAAAGTAGG + Intronic
1024562313 7:50654923-50654945 GTCAGACACTTGGCTAAATTTGG - Intronic
1025781120 7:64602692-64602714 AGTAATCATCTGGCTAAAGTTGG + Intergenic
1027683461 7:81250613-81250635 AGCTATCACCTGTCTTAATTTGG + Intergenic
1027717887 7:81696866-81696888 TGCAGTGACCTGGGTGAATTTGG + Intergenic
1030128350 7:106176565-106176587 TGCAATCACCTGGATAGATTTGG - Intergenic
1033204095 7:139401904-139401926 CCCACCCACCTGGCTAAATTTGG + Intronic
1033560793 7:142528622-142528644 AGCAGGCACCAAGCTAAGTTGGG - Intergenic
1035705256 8:1670084-1670106 GGAAGTCACCTGGCTAATTTGGG - Intronic
1042064448 8:64858614-64858636 AGCTGTCACCAGGCTAAAATGGG + Intergenic
1044272441 8:90262820-90262842 TGCAGCCACCTGTCTAATTTAGG + Intergenic
1045635773 8:104187111-104187133 AGCAGTCAACTGGTTGATTTTGG + Intronic
1049938208 9:519648-519670 ACCAGTCTCCTGGCAAAATAAGG - Intronic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1051745914 9:20294291-20294313 AGCAGTCACGTGGAGAAATGTGG - Intergenic
1052278169 9:26702306-26702328 GGCAGTCACTTGGTTAAATTTGG - Intergenic
1054753647 9:68934386-68934408 AGAAGTAACTTGGCTAAATTGGG + Intronic
1057234120 9:93345575-93345597 AGCAGGGACATGGCTAAATATGG + Intronic
1187019492 X:15365482-15365504 GGCAGGCAGCAGGCTAAATTAGG - Intronic
1191226340 X:58048557-58048579 AGCAGACACCTGGCGAGGTTTGG - Intergenic
1192089529 X:68139046-68139068 AACAGTCACCAGACTATATTTGG + Intronic
1194487652 X:94505453-94505475 AACAGACACCTGGCTCAAATTGG + Intergenic