ID: 1130094458

View in Genome Browser
Species Human (GRCh38)
Location 15:80845701-80845723
Sequence TAACCTTCCCACAGTGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130094458 Original CRISPR TAACCTTCCCACAGTGACTT TGG Intronic
901274577 1:7981178-7981200 GAAACTTCCCACAGTGAGTGGGG - Intronic
902150147 1:14436275-14436297 TGACCTACCCACAGTCACTCAGG + Intergenic
902357872 1:15919966-15919988 TTACCTTCACACACTGAATTGGG - Intronic
908000043 1:59670913-59670935 TAAGTTTCCCCCACTGACTTGGG + Intronic
908325684 1:63021259-63021281 TAACATTCCCACATGGACTAAGG - Intergenic
909608859 1:77532524-77532546 TAACCTTCCCAAGGTCACTAGGG - Intronic
910545277 1:88408722-88408744 TTACCCTCCCACACTGAATTAGG + Intergenic
912245745 1:107960157-107960179 TACCTTTCCTACAGTTACTTTGG - Intronic
916864938 1:168846369-168846391 TAACCTTGCCTCTGTGCCTTTGG - Intergenic
917503205 1:175604484-175604506 CAGCCTTCCCACTGTGACCTTGG - Intronic
919662182 1:200258127-200258149 GAGGCTTCCCACAGTGATTTAGG - Intergenic
920549166 1:206844027-206844049 TAACTTTTCCAAAGTGACCTTGG + Intergenic
920927678 1:210358053-210358075 TAAGCCTCCCACAATGACATGGG + Intronic
921696060 1:218212236-218212258 TAACTTTCCCACAGTCACACAGG + Intergenic
924209271 1:241748130-241748152 TGCCCTTCCCTCAGTGGCTTAGG - Intronic
924462509 1:244271991-244272013 TAACATTCACACAGTGCTTTTGG + Intergenic
1062841547 10:677266-677288 TTTCCTGCCCACAGTGACTGTGG - Intronic
1064954804 10:20895965-20895987 TAACCTTCCCAAGGTTACTGGGG + Intronic
1065132552 10:22636781-22636803 GCCCCTTCCCACAGTGACTCTGG + Intronic
1065150661 10:22819795-22819817 TAACCTTTCCTCAGTGTCTTAGG + Intergenic
1065281215 10:24140523-24140545 TTACCCACCCACAGTCACTTAGG - Intronic
1066748455 10:38627485-38627507 AAAAGTTCCCACAGTGAGTTTGG + Intergenic
1068540546 10:58289582-58289604 TAACCTAACCACACTCACTTTGG - Exonic
1068981810 10:63070567-63070589 TACCCTTCTCACATTGACATGGG + Intergenic
1069487563 10:68834003-68834025 TCTCCATCCCACAGTGACTCTGG + Intronic
1071934908 10:90518357-90518379 TAACCTTCTCCCAATGAGTTTGG - Intergenic
1074847173 10:117408593-117408615 TAATCTTCCCACAGAGGCTTAGG + Intergenic
1076643161 10:131932388-131932410 TCAGCTTCCCAAAGTGAGTTAGG - Intronic
1078979154 11:16512685-16512707 TAATTTTTTCACAGTGACTTTGG - Intronic
1080451134 11:32379858-32379880 CAACCTCCCCACAGTGAGTCAGG - Intergenic
1080821516 11:35811184-35811206 TGACTTTTCCACAGTGCCTTAGG + Exonic
1081062991 11:38503665-38503687 TCACCTTCCCACCGAGGCTTAGG - Intergenic
1082193028 11:49269942-49269964 TTACATTTCCACAGTGACTAAGG - Intergenic
1084735439 11:71102575-71102597 TAGCCTCTCCACAGTGAGTTTGG - Intronic
1086673103 11:89571127-89571149 TTACATTTCCACAGTGACTAAGG + Intergenic
1089375264 11:117989496-117989518 TGACCTTACCGCAGTGACCTTGG + Exonic
1090149451 11:124366969-124366991 TAACTTTTTCACTGTGACTTGGG - Intergenic
1091820121 12:3470033-3470055 TAACCTTTCCATCATGACTTGGG - Intronic
1097157060 12:57020009-57020031 TAAAATTCCCACCGTGGCTTAGG + Intronic
1097809325 12:64001390-64001412 TTTCTTGCCCACAGTGACTTTGG + Intronic
1104713729 12:131003505-131003527 TAAGCTTTTCCCAGTGACTTGGG + Intronic
1107767883 13:43756801-43756823 TAACTGTCCCACTGTGATTTAGG + Intronic
1107860404 13:44655148-44655170 GATCTTTCCCACAGTGCCTTGGG - Intergenic
1108204380 13:48073019-48073041 AAAACTTCCCACATTGCCTTTGG + Intronic
1108395349 13:49986064-49986086 TAACCTGCCCACAGTCACATAGG - Intergenic
1111585772 13:90282475-90282497 TCACCTTCCCAGAGTTACTTAGG - Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1113725066 13:112592468-112592490 TAACCTTCACCCAGTGCCGTGGG - Intergenic
1118360509 14:65052907-65052929 TTACCTTCCCAGACTGACCTCGG - Intronic
1121413340 14:93762605-93762627 CAAGCCTGCCACAGTGACTTGGG - Intronic
1122472020 14:101975156-101975178 TAACTTGCCCACAGATACTTGGG - Intronic
1127465405 15:59239539-59239561 TAATCCTCCCACTGTGTCTTTGG + Intronic
1128356208 15:66928707-66928729 TAACCTTCTCACAGGCTCTTTGG + Intergenic
1130094458 15:80845701-80845723 TAACCTTCCCACAGTGACTTTGG + Intronic
1131646579 15:94351533-94351555 TTACTTTCCCATAATGACTTAGG + Intronic
1132708994 16:1258320-1258342 TGACCTTCCCAGGGTGACTCTGG + Exonic
1136647765 16:31636885-31636907 TATCTTTCCCAAAGTTACTTGGG + Intergenic
1137383699 16:48022218-48022240 AAACCTTCCCATGGTGACCTTGG + Intergenic
1138048015 16:53746259-53746281 TTTCCCTGCCACAGTGACTTTGG + Intronic
1141500485 16:84440930-84440952 TAACTTTCCCACTGAGACATTGG - Exonic
1146612084 17:34315428-34315450 TAACCTGCCCAAAGTGGCCTTGG - Intergenic
1151887958 17:76934235-76934257 TAACCTTCACACAATGAGGTAGG + Intronic
1152380651 17:79940905-79940927 TTGCCTTCCCTCAGGGACTTGGG + Exonic
1153242469 18:3043283-3043305 TAACTTTCCCACAGTGAGAAAGG + Intergenic
1154384507 18:13880841-13880863 TAACATGCCCTCAGGGACTTTGG + Intergenic
1157426717 18:47590619-47590641 TAACTTTCCCACGGTCACCTAGG - Intergenic
1158315144 18:56203911-56203933 TAGCCTTACCACATTGAATTTGG + Intergenic
1165858555 19:38894618-38894640 AATCATTCCCAGAGTGACTTGGG - Intronic
1167535357 19:50047304-50047326 TGACCTTCCCAAGGTCACTTAGG - Exonic
1167846241 19:52167105-52167127 TATCCGTCCCACAGAGACTGCGG - Intronic
928279357 2:29930454-29930476 TTGCCTTCCCACAGTGACTAGGG + Intergenic
928307122 2:30179344-30179366 TAACCTTACAGCAGGGACTTGGG + Intergenic
931181728 2:59908425-59908447 TATCCCTCCCACACTGAGTTGGG - Intergenic
932776564 2:74531407-74531429 TACCCTTCCCACACTGACCTGGG - Intronic
934524533 2:95043485-95043507 GCAGCGTCCCACAGTGACTTCGG + Intronic
940008701 2:149033397-149033419 TAACCTCCCCAAAGTGAGTTGGG - Intergenic
942522986 2:176823833-176823855 TAAAATTACCACAGTGACCTTGG + Intergenic
946759814 2:222982569-222982591 TCACCTTCCCACGGTGTCCTCGG + Intergenic
1171439285 20:25147919-25147941 TTAGCCTCCCACGGTGACTTGGG - Intergenic
1174435008 20:50500000-50500022 TCCCCTTCCCACAGTGAGTCTGG + Intergenic
1177853177 21:26373058-26373080 TTTTCTTCCCAAAGTGACTTGGG + Intergenic
1178460124 21:32795474-32795496 TAACATTCCCCCAATGACTGAGG + Intronic
1181002170 22:19992929-19992951 TCACCTTCCCACTGTGGCCTTGG - Intronic
1181406584 22:22689314-22689336 TAACCAAGCCACAGTGTCTTTGG + Intergenic
1181422933 22:22814298-22814320 TAACCAAGCCACAGTGTCTTAGG + Intronic
1181431163 22:22882663-22882685 AAACCAGCCCACAGTGACCTAGG + Intronic
1182974071 22:34606073-34606095 TGAACTTCCCAGAGTAACTTAGG + Intergenic
949767315 3:7541543-7541565 TAACCCACTCACAGTCACTTTGG - Intronic
950497320 3:13341510-13341532 TGACCTTTCCTCTGTGACTTGGG - Intronic
951211104 3:19975939-19975961 TTTCTTTCCCACAGTCACTTGGG + Intronic
952142649 3:30497286-30497308 TAAACTCTCCACAGAGACTTGGG - Intergenic
952189625 3:31008965-31008987 TCACATTCCCACAGTGAGTGAGG - Intergenic
954867081 3:53738896-53738918 TAATATTCCCACTGTGACCTAGG + Intronic
955191826 3:56768874-56768896 AAAGCCTCCCACAGTGACTGTGG - Intronic
956882878 3:73529007-73529029 TAACCTTGTCAGAGTGATTTTGG - Intronic
958909711 3:99980262-99980284 TAATCTTACCTCTGTGACTTTGG + Intronic
959065180 3:101648783-101648805 TAACATTCCCACTGGGGCTTTGG - Intergenic
961793520 3:129393366-129393388 TTACATCCCCACGGTGACTTTGG - Intergenic
962378950 3:134881230-134881252 TACACTTCCCACAGAGCCTTTGG - Intronic
962385237 3:134927469-134927491 AAACCTTCCCACTTTTACTTGGG + Intronic
962924813 3:139982098-139982120 AAACCTGCCCACAGTAAATTTGG - Intronic
963429846 3:145186054-145186076 GAACCTTCTCACAGTGATTTAGG - Intergenic
968160472 3:196422657-196422679 TATACTTTCCAAAGTGACTTTGG + Intronic
969651797 4:8472398-8472420 ACTCCTTCCCACTGTGACTTCGG - Intronic
971603505 4:28626492-28626514 GAATCTTCCCACAGGGACTCTGG + Intergenic
975284589 4:72602600-72602622 TATCCTTGACACAGTGCCTTTGG - Intergenic
977249757 4:94676739-94676761 CAAACTCCCCACAATGACTTTGG + Intergenic
977347504 4:95835917-95835939 TAAACATCCGTCAGTGACTTAGG + Intergenic
978679461 4:111361532-111361554 TAACCTTCCCACAGTTACATAGG + Intergenic
980409401 4:132396769-132396791 AAACCTTCCCACAGGCATTTAGG - Intergenic
982983556 4:162173776-162173798 CAACTTTCTAACAGTGACTTAGG + Intergenic
986501559 5:8406159-8406181 CAACCTTCCCACCATGATTTTGG - Intergenic
987572651 5:19685391-19685413 TAACCTGTACAGAGTGACTTTGG - Intronic
988792431 5:34620839-34620861 AAATCTTCCCACAGTGTCTCTGG - Intergenic
990130233 5:52573173-52573195 TGATCTTCCCACACTGAATTAGG - Intergenic
991644964 5:68792474-68792496 TAACATTCCCACTGGGGCTTCGG - Intergenic
997354825 5:133255473-133255495 CAACCAACCCACACTGACTTGGG - Intronic
999634682 5:153609510-153609532 TCACCTTAGCCCAGTGACTTTGG + Intronic
1000395941 5:160774861-160774883 TAACAATCTCACAGTGTCTTAGG + Intronic
1001233797 5:170012793-170012815 TAATCCTCCCACATTCACTTGGG + Intronic
1002793979 6:456116-456138 CAACCTCCACACAGTGACTGTGG + Intergenic
1004982884 6:21046240-21046262 TTTCCTTCCCTCCGTGACTTTGG + Intronic
1009561723 6:65254564-65254586 TAATCTTTCCACAATAACTTTGG - Intronic
1013604264 6:111733317-111733339 TAACTTTCCCAGAGTTACTCAGG + Intronic
1022748387 7:33196897-33196919 TAACCTTCCCCCAGGAACTAAGG - Intronic
1023168070 7:37362928-37362950 TTCCCTTGCCACAGTGAATTTGG + Intronic
1024173099 7:46810497-46810519 TAACATGCCCACTGTGGCTTCGG - Intergenic
1028489606 7:91396502-91396524 TTGCCTTACTACAGTGACTTAGG + Intergenic
1029104250 7:98162559-98162581 TGACCGTCCCCGAGTGACTTAGG - Intronic
1030551538 7:110967480-110967502 AAAACTTCCCTCTGTGACTTGGG + Intronic
1031691766 7:124797269-124797291 TATCCTTCCCCCAGTGTCCTAGG - Intergenic
1033245877 7:139715844-139715866 TTATCTCCCCACAGTGACTAAGG + Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1038522613 8:28246278-28246300 TAACCATCTCACAGTGAATGTGG - Intergenic
1046261961 8:111780401-111780423 TTCCCATCCCACAGTCACTTGGG + Intergenic
1048267566 8:133000960-133000982 GATCCTTCCCACAGGGACCTTGG - Intronic
1048366565 8:133743666-133743688 TAACCTTCCCACAGTTGCCCAGG + Intergenic
1048767710 8:137862815-137862837 CAACCACCCCACAGTGACTAGGG + Intergenic
1050111949 9:2226427-2226449 TCTCCTTCCCACAATGAGTTTGG + Intergenic
1051518691 9:17959884-17959906 TGACCTTCCAACAATGATTTGGG + Intergenic
1053396768 9:37782262-37782284 TAGGATTCCCACAGTCACTTTGG + Intronic
1055149014 9:72972691-72972713 TATTCTACCCACAGTGGCTTAGG + Intronic
1055435603 9:76289056-76289078 TCACCTTCCCACTGTGTCTTTGG - Intronic
1056078555 9:83065561-83065583 GTCCCTTCCCACACTGACTTAGG - Intergenic
1058637303 9:107049127-107049149 TCTCTTTCCCACAGTGAATTCGG - Intergenic
1062510861 9:136905112-136905134 TAACCTTTCCTGAGTCACTTGGG + Intronic
1188757677 X:33984254-33984276 TAACCTCCCCAGACTGAATTAGG - Intergenic
1190446554 X:50531296-50531318 ACACCTTCCCACATTGACTTTGG - Intergenic
1194505410 X:94728326-94728348 TAAACTGCCCACAGTGAAATAGG + Intergenic
1197914292 X:131518342-131518364 TACTCTCCACACAGTGACTTAGG - Intergenic
1199258281 X:145742814-145742836 TCCCCTTGCCACAGTGACCTGGG + Intergenic
1199373953 X:147085010-147085032 TAACTTGCCCACAGTGACACAGG - Intergenic
1199735928 X:150686651-150686673 TCACCTTCACACAGAGACTGCGG - Intergenic
1199991842 X:152991837-152991859 TACCCTCCCCAAAATGACTTGGG - Intronic
1200462636 Y:3476435-3476457 TAGCCTTCCCAAACTGGCTTTGG - Intergenic
1200960381 Y:8991085-8991107 TAAGCTTGTGACAGTGACTTTGG - Intergenic