ID: 1130096870

View in Genome Browser
Species Human (GRCh38)
Location 15:80862582-80862604
Sequence CCCTCTCCATGCAGATAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130096866_1130096870 20 Left 1130096866 15:80862539-80862561 CCAGGTCACCTGGCTGTGGAACA 0: 1
1: 1
2: 0
3: 15
4: 195
Right 1130096870 15:80862582-80862604 CCCTCTCCATGCAGATAAGATGG 0: 1
1: 0
2: 0
3: 12
4: 140
1130096864_1130096870 29 Left 1130096864 15:80862530-80862552 CCATGGGAGCCAGGTCACCTGGC 0: 1
1: 0
2: 3
3: 22
4: 287
Right 1130096870 15:80862582-80862604 CCCTCTCCATGCAGATAAGATGG 0: 1
1: 0
2: 0
3: 12
4: 140
1130096867_1130096870 12 Left 1130096867 15:80862547-80862569 CCTGGCTGTGGAACATGTAACTG 0: 1
1: 1
2: 2
3: 17
4: 117
Right 1130096870 15:80862582-80862604 CCCTCTCCATGCAGATAAGATGG 0: 1
1: 0
2: 0
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130096870 Original CRISPR CCCTCTCCATGCAGATAAGA TGG Intronic
904534213 1:31188460-31188482 CCTTCTCCATGTGGAGAAGATGG + Intronic
906508236 1:46395568-46395590 CCCTCTCTCAGCACATAAGAAGG - Intronic
906821996 1:48939701-48939723 CCCTCTCCATGTAGGCAAGTGGG + Intronic
908959767 1:69682342-69682364 CCCTCTCCTTGGATATAAGCTGG - Intronic
913323676 1:117607585-117607607 CCCTCTGCGTGCAGGAAAGAGGG + Intronic
913406867 1:118504146-118504168 CCCTTTCCATCCAGAGGAGAAGG + Intergenic
917684290 1:177400226-177400248 CCCTCTCCAAGCCAATAAGGAGG - Intergenic
921218590 1:212957444-212957466 TCCTCTCCATTAAGGTAAGAAGG + Intronic
1063492392 10:6476882-6476904 CCCTCTCCATGCTGTTGGGAGGG - Intronic
1066002632 10:31118644-31118666 CCCTCACCATCCATATCAGAAGG - Intergenic
1066267591 10:33791431-33791453 CCCCCTCCATCCCGTTAAGAAGG + Intergenic
1067452622 10:46391638-46391660 CCCTCTGCATGCAGCACAGAAGG + Exonic
1067584610 10:47468117-47468139 CCCTCTGCATGCAGCACAGAAGG - Exonic
1067693212 10:48517719-48517741 TCCTCTCCAAGCAGGTAGGAGGG + Intronic
1070313498 10:75290581-75290603 CTCTCTCCATGAAGAGAAGGAGG - Intergenic
1072280067 10:93857802-93857824 ACCTATCCATGAAGATAGGAAGG + Intergenic
1072738612 10:97896198-97896220 CCCTCTCCATGCAAAGACCAGGG - Intronic
1074550951 10:114441930-114441952 CCCACTCCTTGCAAATATGATGG - Intronic
1075318166 10:121468583-121468605 CCCCATCCTTGCAGGTAAGAAGG - Intergenic
1076713319 10:132350952-132350974 CCCTCTCCCTGCCCATGAGAGGG - Intronic
1077846805 11:6034079-6034101 CCTTCTGCCTTCAGATAAGAGGG - Intergenic
1078143353 11:8707278-8707300 CCCCCTCCTGGCAGAGAAGAGGG + Intronic
1080725985 11:34900036-34900058 CCATCTCCAAGATGATAAGAAGG - Intronic
1083834644 11:65258035-65258057 CCCCCTCCATTCTGATAGGAAGG - Intergenic
1085640408 11:78189374-78189396 CCCTCCCCTTTCAGGTAAGAGGG + Intronic
1088138144 11:106582043-106582065 CCCTCTCCTTGCAGAAAAGGTGG - Intergenic
1091076745 11:132625528-132625550 CCCTCAGAATGCAGATTAGAGGG + Intronic
1091792941 12:3281804-3281826 TCCTCATCATGCAGGTAAGAGGG + Exonic
1093396582 12:18690612-18690634 CCCTCTGCATGCATATATTATGG - Intronic
1093742674 12:22706337-22706359 CCTTCTTCATGGAGAAAAGAAGG - Intergenic
1094526393 12:31234014-31234036 CCCTCTCCAGGCTGAGAAGATGG + Intergenic
1100667643 12:96771828-96771850 CCTTCTCCATGCAGGACAGAAGG + Intronic
1101611134 12:106293080-106293102 CCATCTCCATGAAGAAAAGTAGG - Intronic
1102552642 12:113702834-113702856 ACCTCCCCTCGCAGATAAGATGG - Intergenic
1104673221 12:130694633-130694655 CACCATCCATGCAGAGAAGAAGG - Intronic
1104756471 12:131272729-131272751 CCCTCTCCAGGCAGATGGGATGG - Intergenic
1104776859 12:131394650-131394672 CCCTCTCCAGGCAGACAGGATGG + Intergenic
1111761454 13:92471050-92471072 CCCTCTCCATGCAGCTGGGAGGG + Intronic
1112303388 13:98250935-98250957 CCCTCTCCTTACAGCTAAGTGGG - Intronic
1112633619 13:101189408-101189430 CCCTTTAAATGTAGATAAGACGG - Intronic
1113532108 13:111035392-111035414 CCCTATCTACACAGATAAGATGG - Intergenic
1119554286 14:75541500-75541522 CCCTCTCCATGCAGCCCAGGAGG + Intronic
1120051393 14:79870963-79870985 CCCTCTACATGCACACAAAAAGG + Intergenic
1120539343 14:85735052-85735074 GCCGCTGCATGCAGATATGAGGG + Intergenic
1121789332 14:96687189-96687211 TTCTCTCCAAGCAGAGAAGAAGG + Intergenic
1122017139 14:98805734-98805756 ACCTGTCCCTGCAGATAGGATGG + Intergenic
1130096870 15:80862582-80862604 CCCTCTCCATGCAGATAAGATGG + Intronic
1130705391 15:86228483-86228505 CCCTCTCCCTGCAGAGTAGTGGG - Intronic
1133398269 16:5465599-5465621 TCCTCTTCATGCAGCTGAGATGG + Intergenic
1133609115 16:7416586-7416608 CACTATCCATGAAGACAAGAAGG - Intronic
1133939019 16:10292939-10292961 GCCACTGCATGCAGATAGGAAGG - Intergenic
1136084598 16:27875856-27875878 CCCTCTCCATGCGGAGAGGATGG - Intronic
1138810144 16:60139819-60139841 CACTCTCCATGCAGAGAACTTGG - Intergenic
1139777212 16:69324030-69324052 CCCTCTCGAGGCAGCTCAGATGG - Intronic
1142850912 17:2704353-2704375 CCTTCTCCCTGCAGGTAAGATGG - Exonic
1143082735 17:4393850-4393872 TCCCCACCTTGCAGATAAGATGG + Intergenic
1145784772 17:27586699-27586721 GTGTCTCCATGCAGATCAGATGG + Intronic
1146528104 17:33584242-33584264 CCCTCTCCATGAACTAAAGATGG - Intronic
1146748197 17:35351202-35351224 CCCTGTGCATGCAAACAAGAGGG - Exonic
1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG + Intronic
1147551744 17:41448020-41448042 TCCTCTCATTGCAGATGAGACGG - Intergenic
1149083328 17:52684372-52684394 CCCTCTCCCTGACGTTAAGAAGG + Intergenic
1149562525 17:57619029-57619051 CCCTCTGCATGCTGGGAAGAAGG + Intronic
1151153481 17:72107992-72108014 CCCTCTCCAGGGAGCTAGGAAGG - Intergenic
1151702619 17:75751371-75751393 CCCTCCCCATGCAGGTAACCAGG + Intronic
1153805893 18:8707501-8707523 CCCCCTCCGTGGAGAAAAGATGG - Intronic
1156056172 18:33006716-33006738 CTCTGTCTTTGCAGATAAGAAGG + Intronic
1156841205 18:41611750-41611772 TTCTCTCCATGCAGGTAAAATGG + Intergenic
1158841465 18:61392577-61392599 CCCTCTCCATGCTGAGCACAAGG + Intronic
1159365782 18:67464332-67464354 CCCTCCCCATGCAGAGAACTTGG - Intergenic
1159775736 18:72601483-72601505 GCGTCTCCATGCAGAGGAGAAGG + Intronic
1160313011 18:77814308-77814330 CCCACACTATTCAGATAAGAAGG + Intergenic
1164827999 19:31298334-31298356 CCCTCCCCATACAGAGCAGAGGG + Intronic
1164950973 19:32336630-32336652 CCCTCTCCGTGCAGGAAAGTTGG + Intergenic
1167698227 19:51027206-51027228 CCCTCTCCTTGCAAAGGAGAAGG - Intronic
1167784629 19:51627241-51627263 CGATCTCCCTGCAGAAAAGAGGG + Exonic
1167962192 19:53114994-53115016 CGCTCTCCATATAGATCAGAGGG - Intronic
925012808 2:498341-498363 CCCTCTGCAAGCAGATCTGATGG - Intergenic
927087423 2:19686001-19686023 CCCACACCCTGCAGATCAGAAGG - Intergenic
928322791 2:30296497-30296519 CCCTCTCCAGGAACATCAGAGGG - Intronic
928368783 2:30723571-30723593 CCATCTCCAGGCAGGTTAGAAGG + Intronic
928799341 2:35067995-35068017 TCATCTCCATGCAGATAATTTGG + Intergenic
929886554 2:45883840-45883862 CCCTCCCCAGGCAGAGAAAAGGG - Intronic
940274410 2:151923949-151923971 CCCTCTGAATGGAGATGAGATGG - Intronic
940871108 2:158860885-158860907 CCCTTGCCATACAGATAAGTAGG - Intronic
941021850 2:160415675-160415697 CCCTCTCCCTACAGATAATTAGG - Intronic
946341723 2:219073869-219073891 CACTCTACATGCACATAAAAGGG - Intergenic
946746782 2:222854269-222854291 CTCTCTTCATGGTGATAAGATGG - Intergenic
948043195 2:234920817-234920839 CCCTCTCCAAGCTGAAAAAAGGG + Intergenic
948485120 2:238275809-238275831 CCACCTCCCTGCAGACAAGAAGG - Exonic
1171181129 20:23091476-23091498 CCCTCTCAATGCAGGACAGATGG - Intergenic
1173639655 20:44591952-44591974 CCCTCTCCCTGCAGCCAAGAAGG + Intronic
1174859359 20:54076143-54076165 CCCTGTCCCTGGAGATAGGATGG + Intergenic
1181389629 22:22570947-22570969 CTCTGTCCAAGCAGATGAGAGGG - Intergenic
1182044114 22:27260941-27260963 CCCTCTCCATGCACACACCAGGG - Intergenic
950781982 3:15400018-15400040 CCATCTCTAGGCAGATAAGGGGG - Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953452956 3:43019354-43019376 CCCTCTCCAGTCAGATATGCTGG - Intronic
953739789 3:45527705-45527727 CCTTCTCTAGGCAGATATGAGGG - Intronic
954686229 3:52371760-52371782 CCCTCCCCATGCAGAAAGCAGGG + Intronic
955078813 3:55638898-55638920 CCATCTCCACTAAGATAAGATGG - Intronic
956685764 3:71825860-71825882 CCATGGCCATGCAGATAAGTTGG - Intergenic
956714461 3:72066261-72066283 CCCTCTCCATGCATCTAGGCTGG - Intergenic
958823943 3:99007576-99007598 CCCTCCCCATGCAGATAACTTGG - Intergenic
962185843 3:133258567-133258589 CCCTGTCCCTGCAGCTCAGAGGG + Intronic
962408510 3:135120996-135121018 CCTGCTGCATGCAGATAGGATGG - Intronic
964599672 3:158484179-158484201 ACCTCTGCAGGCAGATAATACGG + Intronic
965980250 3:174681437-174681459 CCCTCTGCCTGCAGAGGAGAGGG + Intronic
968485971 4:862084-862106 GACTCTCCATGCAGACGAGACGG + Intronic
968981386 4:3851686-3851708 CCCTCTCCACACAGGAAAGAGGG - Intergenic
969663237 4:8542655-8542677 CCCTCTCCATTCAGAACACAGGG - Intergenic
971808391 4:31391018-31391040 CCAGCTCCCTGCAGATAAGATGG - Intergenic
975047428 4:69823264-69823286 CCCTCACCATGCAGCCCAGATGG + Intronic
982853648 4:160352838-160352860 CCCTCTCTGTGCAGATGACATGG - Intergenic
985588483 5:752887-752909 CCCTCTTCATCCAGGAAAGAAGG + Intronic
985603154 5:845342-845364 CCCTCTTCATCCAGGAAAGAAGG + Intronic
990262762 5:54042850-54042872 CCTTCTCCAAGCAGGAAAGAAGG - Intronic
990863815 5:60358231-60358253 CCTTCTGCCTGCAGAGAAGACGG + Intronic
999261359 5:150240873-150240895 CCCTCTCCCTGCTGGAAAGAAGG + Intronic
999654443 5:153798544-153798566 CTTTCTCCAAGAAGATAAGAAGG + Intronic
1002833350 6:844269-844291 ACCTCTCAGTGCAGACAAGAGGG - Intergenic
1003654085 6:7989334-7989356 CCGTCTTCATGCAGAGAAGTTGG + Intronic
1006480057 6:34285131-34285153 CCCTCTCCATGCAGGGCAGATGG + Exonic
1007973777 6:46079655-46079677 CCCTGTTCATGCAGATATTATGG - Intronic
1008548470 6:52604699-52604721 CTCTGTCCATTCAGGTAAGAAGG - Intergenic
1011864390 6:91805295-91805317 CCCTCTCAAGGCAGTTAAGCTGG + Intergenic
1013323513 6:109020625-109020647 CCTTCTCCTTGGAGAGAAGAAGG + Intronic
1014485513 6:121994297-121994319 CCCTATCCATGGTGGTAAGATGG - Intergenic
1014811014 6:125885778-125885800 CCCTCTCCATGCAGGACTGAGGG - Intronic
1015822889 6:137281992-137282014 CCCTCTCCATGCTAAATAGAGGG - Intergenic
1026222826 7:68415305-68415327 CCCTTTTCATGCATTTAAGAGGG - Intergenic
1026223166 7:68417971-68417993 GCCTCTTCATGCATTTAAGAGGG - Intergenic
1026683632 7:72489688-72489710 CCCTTTGCATGAAGATAAGAAGG + Intergenic
1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG + Intronic
1032197074 7:129795488-129795510 CCATCTCCATGCAGCTGGGAAGG - Intergenic
1040614943 8:49025723-49025745 CCCACTGCATGCAGAAAGGAAGG + Intergenic
1045932214 8:107640463-107640485 CCCTCTCAATACAGAAATGAGGG + Intergenic
1050894322 9:10867832-10867854 CTCTCTCCACGCAAATAAAATGG + Intergenic
1051231926 9:14963855-14963877 CCCTCTCCACCCCGATAAGGGGG + Intergenic
1053105794 9:35406640-35406662 CCCTCTCCATGGAGAAACGGTGG + Intergenic
1057207382 9:93181815-93181837 CCATCTCCCTGCTGCTAAGACGG - Intergenic
1058898062 9:109417009-109417031 CACTCTCCACCCAGATAAAAGGG - Intronic
1059938670 9:119336744-119336766 CCCTCTGCATACAGAGTAGATGG - Intronic
1060482337 9:124023951-124023973 CCCCCACCATCCAGATGAGAAGG + Intronic
1062334472 9:136058992-136059014 GCCTCTCCCTGCAGACAGGAGGG - Intronic
1185846530 X:3442666-3442688 CACTCTCCATGTATATTAGATGG - Intergenic
1189416972 X:40824014-40824036 CCCTCTCCAGAAAGAGAAGATGG + Intergenic
1190598046 X:52066134-52066156 CCTTCTCCAGGCAAATAAGTTGG - Exonic
1190610778 X:52187939-52187961 CCTTCTCCAGGCAAATAAGTTGG + Exonic
1192230145 X:69258974-69258996 CTCTCTCAAAGCAGGTAAGAGGG - Intergenic
1194478323 X:94388539-94388561 CTATCTCCATGCTGATAAGTGGG + Intergenic
1199967433 X:152831620-152831642 CCCACACAATGCAGATAAGGAGG + Intronic
1201470810 Y:14333147-14333169 CCATCTCCACACAGATGAGATGG - Intergenic