ID: 1130098215

View in Genome Browser
Species Human (GRCh38)
Location 15:80871900-80871922
Sequence CTGGCTGAAGTGACTAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130098211_1130098215 7 Left 1130098211 15:80871870-80871892 CCAGATGCCGTGATGCGTGACTT 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1130098215 15:80871900-80871922 CTGGCTGAAGTGACTAGAATGGG 0: 1
1: 0
2: 3
3: 14
4: 152
1130098209_1130098215 13 Left 1130098209 15:80871864-80871886 CCATTCCCAGATGCCGTGATGCG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1130098215 15:80871900-80871922 CTGGCTGAAGTGACTAGAATGGG 0: 1
1: 0
2: 3
3: 14
4: 152
1130098212_1130098215 0 Left 1130098212 15:80871877-80871899 CCGTGATGCGTGACTTCAGCAAT 0: 1
1: 1
2: 0
3: 5
4: 74
Right 1130098215 15:80871900-80871922 CTGGCTGAAGTGACTAGAATGGG 0: 1
1: 0
2: 3
3: 14
4: 152
1130098210_1130098215 8 Left 1130098210 15:80871869-80871891 CCCAGATGCCGTGATGCGTGACT 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1130098215 15:80871900-80871922 CTGGCTGAAGTGACTAGAATGGG 0: 1
1: 0
2: 3
3: 14
4: 152
1130098208_1130098215 27 Left 1130098208 15:80871850-80871872 CCATGGGAAAGGAGCCATTCCCA 0: 1
1: 0
2: 2
3: 28
4: 262
Right 1130098215 15:80871900-80871922 CTGGCTGAAGTGACTAGAATGGG 0: 1
1: 0
2: 3
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130098215 Original CRISPR CTGGCTGAAGTGACTAGAAT GGG Intronic
900383419 1:2397228-2397250 TGGGCTGAAGTGACGAGACTTGG + Intronic
900591937 1:3464025-3464047 CTGGCTGCAGTGACTGGCCTGGG + Intronic
903279848 1:22244212-22244234 TTGGCTGATGTGAATAGAACGGG + Intergenic
905839087 1:41158708-41158730 CTGGCTGTAGTGTAAAGAATGGG + Intronic
906399176 1:45492266-45492288 ATGACTGAAGAGACTAGAACAGG + Intergenic
906779008 1:48555855-48555877 CTGGCAGAGGTGACTGGACTAGG + Intronic
907599776 1:55756575-55756597 CTGGCTGAAGTGACTTCCAGGGG - Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
908261758 1:62344485-62344507 CTGACTGAAGTGTGAAGAATGGG + Intergenic
909120101 1:71592509-71592531 TTGGCTGAAGTCAGTAGATTTGG - Intronic
916051783 1:161041607-161041629 CTGGCTGAAAGGGCTAGAATAGG - Intronic
917644081 1:177012789-177012811 CTCGCTGTAGTGACTGGATTTGG - Intronic
918739911 1:188116058-188116080 CTGACTGAGGTGAAAAGAATGGG + Intergenic
919684860 1:200474253-200474275 CTGGCTGCAGTGACAAGCCTGGG + Intergenic
1063052641 10:2469386-2469408 ATGGCTGAAATGAATGGAATAGG + Intergenic
1064377681 10:14811446-14811468 CTGGCAGAAGTTTCGAGAATTGG - Intergenic
1067509164 10:46881180-46881202 GGGGCTGAAGGGACTAGAGTGGG + Intergenic
1067653088 10:48170670-48170692 GGGGCTGAAGGGACTAGAGTGGG - Intronic
1068469039 10:57436778-57436800 CTGGCTGAAGCGACTACCAGGGG + Intergenic
1068632983 10:59317268-59317290 GTGCCTGAGGCGACTAGAATGGG - Intronic
1068812977 10:61277408-61277430 TTGTTTGGAGTGACTAGAATGGG + Intergenic
1070012442 10:72489533-72489555 CAGGCTGAATTAACTAGAAAGGG + Intronic
1071416039 10:85442173-85442195 CTTGCTGAAGTGAGAAGACTTGG - Intergenic
1074048636 10:109862388-109862410 CTGGCTGAAGTGACTTCCAGAGG + Intergenic
1075253434 10:120904037-120904059 CTAGCTGAAATTTCTAGAATTGG - Exonic
1078685525 11:13527125-13527147 CTGGCCGATGTGCGTAGAATGGG - Intergenic
1080909720 11:36583411-36583433 TAGGCTGAAGTAACTAGAAAGGG - Intronic
1080986150 11:37468646-37468668 ATGGCTGAATTGACAGGAATTGG - Intergenic
1090044166 11:123316521-123316543 TTGTATGAAGTGTCTAGAATAGG + Intergenic
1092532849 12:9359944-9359966 CAGGCTGATGTGGATAGAATGGG + Intergenic
1093028634 12:14267702-14267724 CTGGTTGAAATGACTAGAGTGGG - Intergenic
1096102527 12:48978413-48978435 CTGGCTGAAGTGACGGGAGGAGG - Intergenic
1096118653 12:49071534-49071556 CTGGCTGTAGTGAATAGATTGGG + Intergenic
1096904332 12:54919972-54919994 CTGGCTGAAGTGACAGCAGTCGG + Intergenic
1097519234 12:60647018-60647040 CTGGCTCTAGTGTCTAGAAGGGG + Intergenic
1098720354 12:73889649-73889671 CTGGCTGATATGTGTAGAATGGG - Intergenic
1102462404 12:113108043-113108065 CTGGCTAAAGTACCTAGGATGGG + Intronic
1108110294 13:47064373-47064395 CTGGCTGAAGTGACTTCCAGGGG - Intergenic
1108681599 13:52785330-52785352 CTGGCTCAAGTTACCAGAGTTGG + Intergenic
1111469640 13:88661721-88661743 ATGGCTGAAATGACAAAAATAGG - Intergenic
1111500478 13:89113882-89113904 TTGGCTGAAGTGATCACAATGGG - Intergenic
1112559790 13:100502775-100502797 CTGGCTGCAGTGACTCCACTAGG - Intronic
1116196405 14:41732338-41732360 CTGGCTGAGGTGACTTCAAGGGG + Intronic
1117514069 14:56482809-56482831 CTGGCTCATGTAACTAGAAAGGG - Intergenic
1122513438 14:102288768-102288790 TGGGGTGAAGTGACCAGAATGGG + Intronic
1122788448 14:104174505-104174527 CTGGCTGCAGTGGGCAGAATCGG + Intronic
1124238485 15:28010346-28010368 CTTACTGCAGTGGCTAGAATGGG - Intronic
1124692310 15:31834509-31834531 CTGGCTTATGTGGCTAGAATAGG - Intronic
1125835806 15:42749672-42749694 CTGGCTGAAGTGACTGCTAGGGG + Intronic
1126257975 15:46650499-46650521 CTGGCTGAAGTGACTTTAGCTGG + Intergenic
1126627403 15:50698274-50698296 CTGCCCCAAGTGACTAGATTTGG + Intergenic
1126936222 15:53711429-53711451 CTGACTGAAGTTAGTAGAAATGG - Exonic
1128606218 15:69038511-69038533 CTGGCTGAAGTTCCAAGAAAGGG + Intronic
1129795791 15:78374998-78375020 CTGGCTGAAGTGTGGAGGATGGG + Intergenic
1130028224 15:80288371-80288393 TTAGCTGCAGTGGCTAGAATAGG - Intergenic
1130098215 15:80871900-80871922 CTGGCTGAAGTGACTAGAATGGG + Intronic
1130159697 15:81386306-81386328 CTGGCTGCTGTGAGGAGAATGGG - Intergenic
1131310689 15:91287523-91287545 CGGGCTGAACTTACTGGAATTGG + Intronic
1134850923 16:17478276-17478298 CTTGCTAGAGTGACTAAAATAGG + Intergenic
1135514740 16:23121479-23121501 AGGCCTGAACTGACTAGAATTGG - Intronic
1138939302 16:61770851-61770873 GTGTCTGAAGTGCCTAGGATAGG + Intronic
1140671828 16:77287091-77287113 CTAGTTTAAGTGACTACAATGGG + Intronic
1142477416 17:197603-197625 CACACTGAAATGACTAGAATTGG + Intergenic
1151225440 17:72644615-72644637 CTGGCTGCAGTGACTAGTCCTGG + Intergenic
1151471577 17:74321678-74321700 CTGGCTGAAATGACTAAAATCGG - Intergenic
1153056540 18:951123-951145 CTGGCAGAAGGGCCCAGAATCGG + Intergenic
1153819024 18:8816864-8816886 CTGGCTGAAATGACTCCTATAGG + Intronic
1156197395 18:34790747-34790769 CTGGCTGCAGTGAGTAGAAAGGG + Intronic
1161734914 19:5985847-5985869 CTGGCTGATGTGCCTAGTTTGGG - Intergenic
1162356495 19:10188688-10188710 AGGGCTGAAGTGATTAGATTGGG - Intronic
1163507141 19:17714564-17714586 CTGCCTGAAATGCCTAGAGTGGG + Intergenic
1165121821 19:33564756-33564778 TTGTCTGAAGTGAGAAGAATGGG + Intergenic
925670132 2:6302499-6302521 CCAGCTGAAGTGGCTACAATTGG + Intergenic
927526948 2:23752773-23752795 CTGGTTGGAGTGAATAGAAGTGG - Intronic
927927013 2:27020757-27020779 CTGGCTGAAAGGACTTGAAGTGG + Intronic
928498968 2:31867212-31867234 TTGGCGAAAGTGACTAGAATTGG + Exonic
928968711 2:37004082-37004104 GTTGCTGAAGTGAATAGAAGAGG - Intronic
929758563 2:44787799-44787821 CTGGCTGCTGTGAGGAGAATGGG + Intergenic
930902738 2:56527501-56527523 CTCCCTGAATTCACTAGAATAGG - Intergenic
932085665 2:68756409-68756431 CTGGCTGAAGTGACTTCCAGGGG + Intronic
939810822 2:146830087-146830109 ATGGCTCATGTGATTAGAATGGG - Intergenic
939859049 2:147395984-147396006 CTGTCTGAAGTTAGTGGAATTGG - Intergenic
939936952 2:148304743-148304765 CTGGCTGAACTGACTTGACAGGG + Intronic
940368975 2:152879056-152879078 CTGGATGAAGTGACCAGAATAGG - Intergenic
941044995 2:160664796-160664818 CTGGCTGCAGTGAGCAGGATGGG + Intergenic
942796138 2:179821856-179821878 CTGACTGCAGTGACAAAAATAGG + Intronic
942900965 2:181117840-181117862 CTGTCAGAAATGACTAGAAGTGG + Intergenic
946021379 2:216642697-216642719 CTGTCTGCAGTGTCTAGAATGGG + Intronic
946061230 2:216943273-216943295 CTGGCTGAAGACACCAGAACTGG + Intergenic
946465005 2:219904154-219904176 CTGGCGGAAGTGACAAGAATTGG + Intergenic
947270988 2:228335250-228335272 ATGGCTGAAATGACTATAAGAGG - Intergenic
1169134890 20:3191189-3191211 CTGGCTGAGGGGACTATAACAGG - Exonic
1169385074 20:5141770-5141792 GTGGCTGAAGTGAATTGAATTGG + Intronic
1170127134 20:12976277-12976299 GTGGCTGGAGTGAGTATAATGGG - Intergenic
1175092525 20:56516815-56516837 CTGTCTCATGTGACTAGCATCGG + Intronic
1180075998 21:45463130-45463152 CCAGCTGAAGTGACTTGAAGGGG - Intronic
1182844347 22:33418265-33418287 CAGGCTCATGTGATTAGAATGGG + Intronic
1184699312 22:46159648-46159670 CTTGCTGAATAGACTAGACTAGG - Intronic
951045916 3:18038210-18038232 CTAGATGAAGTGACTTGGATAGG - Intronic
952245953 3:31592888-31592910 CTGGCTGAAGTGACTGACAGGGG - Intronic
952462767 3:33546741-33546763 CTGTCTGATGTGACAAAAATGGG - Intronic
959952645 3:112197291-112197313 CTGGCTGAAGTGACTTCCAAAGG - Intronic
960945018 3:122960207-122960229 CTGGGGGAAGTGAGTAGAAATGG - Intronic
960948396 3:122982643-122982665 ATGGCTGCAGGGACTAGAAAGGG - Intronic
961251044 3:125505704-125505726 CTGGCTGAAGTGACTTCCAGGGG + Intronic
963598465 3:147357211-147357233 CTGGCGGAAAAGACTGGAATTGG - Intergenic
964058040 3:152485636-152485658 ATGACTAAAATGACTAGAATTGG - Intergenic
966287208 3:178311988-178312010 CAGGCAGAAGTAAGTAGAATGGG + Intergenic
972149047 4:36065473-36065495 CTGGCTGCAGTCCCTAGAAATGG + Intronic
972487018 4:39551519-39551541 CTGGCTTATGTGGCTAGAATAGG - Exonic
972882075 4:43437166-43437188 CTGGCTGATGTGACTTGTATGGG + Intergenic
973094260 4:46177132-46177154 ATGGCTGAACTGACTGAAATAGG + Intergenic
973189075 4:47366419-47366441 CTGGCTGCAGTGCTTAGAATAGG - Intronic
973600372 4:52536800-52536822 CCGGCAGTAGTGACTAGAAAAGG + Intergenic
977379953 4:96260088-96260110 CTGGGTGAAGTGAGGAGGATGGG + Intergenic
982755349 4:159211654-159211676 GTAGCTGACGTGAGTAGAATGGG + Intronic
984271012 4:177548669-177548691 GTGGCTGAATTGAATTGAATTGG + Intergenic
984723000 4:182993728-182993750 CTGGCTGAAGTGACTTCCAGTGG + Intergenic
985292712 4:188403340-188403362 CTGTTTGAAGTGACTAAATTTGG - Intergenic
985599861 5:821965-821987 CTGTCAGAACTGACTAGAAATGG - Intronic
986939745 5:12936092-12936114 CTGGCTGAAGTGCCTGGCACAGG + Intergenic
988306200 5:29497959-29497981 ATGGCTGAAGTGACAGAAATAGG - Intergenic
989126750 5:38061181-38061203 CTGGGTCAAGTGACTACAAATGG - Intergenic
989298472 5:39859857-39859879 CTAGATGAATTGACTAGGATGGG - Intergenic
989349992 5:40475120-40475142 CTGCCTGAAATGTCCAGAATAGG + Intergenic
991228068 5:64295958-64295980 CGGACAGAAGTGACTAGAAATGG - Intronic
991625669 5:68598301-68598323 CTGGCTGAAGAGAATAAAAGAGG + Intergenic
991984091 5:72265307-72265329 CTGGCTGAAGTGATCTGAAATGG + Intronic
992505291 5:77381223-77381245 CTGGCTGATGAGAATAGACTGGG + Intronic
994764292 5:103897915-103897937 CTGGCTGCAGAGGCTAGAAGTGG + Intergenic
996489286 5:124073750-124073772 TTGGCTGATGTCACTATAATGGG + Intergenic
996569818 5:124920728-124920750 TGGACTGAAGTGACTAGAACTGG - Intergenic
997555456 5:134794024-134794046 CAAGCTGAAGTGACTAGCAGGGG - Intronic
997841390 5:137243775-137243797 GTGGCTGCAGTGATTAGAACTGG - Intronic
998186314 5:139982421-139982443 TGGGCTGAAGTGATTAGAACAGG - Intronic
1001115052 5:168932524-168932546 CTGGCTGAGGTGAGTACACTAGG - Intronic
1002530563 5:179842016-179842038 CTGGCTGAAGTATCTAGAAAAGG - Exonic
1003006601 6:2388699-2388721 CTGGCTGAAGGGACTTGATGTGG - Intergenic
1004739378 6:18443030-18443052 TTGGGTAAAGTAACTAGAATTGG + Intronic
1012780628 6:103552472-103552494 TGGGCTTAAGTGACTAGATTGGG - Intergenic
1012849384 6:104428695-104428717 CTAGGAGAAGTGACTAGAAAAGG - Intergenic
1015593009 6:134840282-134840304 CTGGCTGAAGTGGCTGAAGTGGG + Intergenic
1016094249 6:140016627-140016649 CTTGCTGAATTGAATTGAATGGG + Intergenic
1017089099 6:150742776-150742798 TTGGGTGAAGTCACTAGATTTGG - Intronic
1019115996 6:169763206-169763228 ATGGCTGCAGTGACTGAAATAGG + Intronic
1019204478 6:170348338-170348360 CAGGCTGCAGTGACTAGAACGGG - Intronic
1021314294 7:19127304-19127326 GTGGCTGTAGTAATTAGAATAGG + Intergenic
1023263637 7:38382298-38382320 CTGGGTGATGTGCCTAGGATGGG + Intergenic
1026059618 7:67014539-67014561 CTTGTTGAAGTGGCTAGCATAGG - Exonic
1026718475 7:72810471-72810493 CTTGTTGAAGTGGCTAGCATAGG + Exonic
1027924268 7:84440482-84440504 CTGGCTGAAGTGACTTTTATGGG + Intronic
1028772264 7:94639878-94639900 CTGGCAGCAATGACTAGCATAGG + Intronic
1029269528 7:99368759-99368781 CTGGCTGCGGTGACTGGAGTGGG - Intronic
1033023098 7:137746928-137746950 CAAGATGAAGGGACTAGAATGGG + Intronic
1034233458 7:149550630-149550652 CTGGCTGAAATGGCCAGAAGAGG - Intergenic
1034367150 7:150560890-150560912 CTGGCTGATGTGCACAGAATTGG + Intergenic
1037924039 8:22830729-22830751 GAGGCTGAATTGACAAGAATTGG - Intronic
1038855867 8:31332857-31332879 CTGGCTGAAGTGACTTCCAGAGG - Intergenic
1045595424 8:103649911-103649933 ATGGCTGAAGTGACAAAAGTAGG - Intronic
1049733504 8:144191412-144191434 CTGGCAGAAGTCACAAGTATGGG - Intronic
1054973595 9:71117212-71117234 TTGGCTGTAGTGTCTAAAATGGG - Intronic
1059124800 9:111674266-111674288 CTGCCTGCAGTGACTAGCTTTGG + Intergenic
1059556266 9:115283753-115283775 CTGTTTGTAGTGATTAGAATTGG + Intronic
1062036031 9:134382967-134382989 CTGGCTGAAGGGCCCAGAAGGGG + Intronic
1062231212 9:135482429-135482451 CTGGCTGAAGTGATGGGGATGGG - Intronic
1186435331 X:9538268-9538290 CAGGCTGAAATTACTAAAATGGG - Intronic
1186539234 X:10383248-10383270 CAGGCTGAAGGGACTGGAACAGG - Intergenic
1188363069 X:29280803-29280825 CTGGATCAAGTGACCAGGATGGG + Intronic
1190713198 X:53083818-53083840 CTGGCTGGAGTGCCTTGCATTGG + Intronic
1198091806 X:133338569-133338591 CTGGCATAGGTGATTAGAATGGG + Intronic