ID: 1130099127

View in Genome Browser
Species Human (GRCh38)
Location 15:80878780-80878802
Sequence CAAGACCACCATGTGCATAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130099114_1130099127 23 Left 1130099114 15:80878734-80878756 CCCTGACCAGAGCCCTGAGTTGC 0: 1
1: 0
2: 4
3: 13
4: 173
Right 1130099127 15:80878780-80878802 CAAGACCACCATGTGCATATCGG 0: 1
1: 0
2: 1
3: 9
4: 151
1130099116_1130099127 17 Left 1130099116 15:80878740-80878762 CCAGAGCCCTGAGTTGCAACCCT 0: 1
1: 0
2: 2
3: 13
4: 240
Right 1130099127 15:80878780-80878802 CAAGACCACCATGTGCATATCGG 0: 1
1: 0
2: 1
3: 9
4: 151
1130099119_1130099127 10 Left 1130099119 15:80878747-80878769 CCTGAGTTGCAACCCTGGAACCC 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1130099127 15:80878780-80878802 CAAGACCACCATGTGCATATCGG 0: 1
1: 0
2: 1
3: 9
4: 151
1130099118_1130099127 11 Left 1130099118 15:80878746-80878768 CCCTGAGTTGCAACCCTGGAACC 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1130099127 15:80878780-80878802 CAAGACCACCATGTGCATATCGG 0: 1
1: 0
2: 1
3: 9
4: 151
1130099122_1130099127 -3 Left 1130099122 15:80878760-80878782 CCTGGAACCCTGGCCATGACCAA 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1130099127 15:80878780-80878802 CAAGACCACCATGTGCATATCGG 0: 1
1: 0
2: 1
3: 9
4: 151
1130099123_1130099127 -10 Left 1130099123 15:80878767-80878789 CCCTGGCCATGACCAAGACCACC 0: 1
1: 0
2: 0
3: 21
4: 231
Right 1130099127 15:80878780-80878802 CAAGACCACCATGTGCATATCGG 0: 1
1: 0
2: 1
3: 9
4: 151
1130099115_1130099127 22 Left 1130099115 15:80878735-80878757 CCTGACCAGAGCCCTGAGTTGCA 0: 1
1: 0
2: 2
3: 20
4: 238
Right 1130099127 15:80878780-80878802 CAAGACCACCATGTGCATATCGG 0: 1
1: 0
2: 1
3: 9
4: 151
1130099121_1130099127 -2 Left 1130099121 15:80878759-80878781 CCCTGGAACCCTGGCCATGACCA 0: 1
1: 0
2: 3
3: 11
4: 206
Right 1130099127 15:80878780-80878802 CAAGACCACCATGTGCATATCGG 0: 1
1: 0
2: 1
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130099127 Original CRISPR CAAGACCACCATGTGCATAT CGG Exonic
900009412 1:92184-92206 TAAGACCACCATCAGCACATAGG + Intergenic
900025522 1:268760-268782 TAAGACCACCATCAGCACATAGG + Intergenic
903365060 1:22801154-22801176 CACCACCACCCTGTGCCTATCGG - Intronic
904096470 1:27982196-27982218 CAAGACCACCCTGGGCATCACGG - Intronic
906580801 1:46934036-46934058 CTACACCACCATGTGCATTAAGG - Exonic
906602923 1:47144858-47144880 CTACACCACCATGTGCATTAAGG + Exonic
906691567 1:47796169-47796191 CAACAGCCCCATGTGCATATTGG - Intronic
907338054 1:53713473-53713495 CAAGACCACCCTGGGCAAAACGG + Intronic
912644658 1:111380808-111380830 CAACACCATCAAGTGCATTTAGG - Intergenic
912970479 1:114276921-114276943 CAAGACCAGCATGGGCAAAATGG - Intergenic
914843074 1:151264302-151264324 CAAGACCAGCCTGGGCACATAGG + Intronic
915635791 1:157185613-157185635 CAACCCCACCATGTCCTTATTGG + Intergenic
916646433 1:166790289-166790311 CTAGACCTCTTTGTGCATATTGG + Intergenic
918938563 1:190958277-190958299 CTAGACCACGATGTGCCTATGGG - Intergenic
919398652 1:197081696-197081718 GAAGGCCACCATGTTCCTATTGG + Intergenic
920748189 1:208648806-208648828 TAAGATTACCATGTGGATATTGG - Intergenic
921512016 1:216043618-216043640 CAAGAACGCCATGTGACTATAGG - Intronic
924555047 1:245111257-245111279 CGAGACCACCAAATGCATGTGGG + Intronic
1064825540 10:19395010-19395032 CAAGACTATCATGTGGATTTTGG + Intronic
1071719584 10:88130106-88130128 CAAGACCACTAGGTTCATGTCGG + Intergenic
1072668108 10:97409152-97409174 CAAGACCAGCCTGTGCATCATGG + Intronic
1073869182 10:107842577-107842599 CATGACTACAATTTGCATATTGG - Intergenic
1074329928 10:112496159-112496181 CAAGACCAGCATAGGCAAATGGG + Intronic
1074484504 10:113861219-113861241 TCAGACCAGCATGTGCATTTTGG + Intronic
1074867700 10:117554375-117554397 CAGGACCCCCAGGTGCATCTTGG - Intergenic
1082226228 11:49710884-49710906 AGGGACCACCATATGCATATAGG + Intergenic
1082691310 11:56308131-56308153 CTTGACTAGCATGTGCATATGGG - Intergenic
1083366961 11:62147201-62147223 CAGGGCCACCATGGGCATTTTGG + Intronic
1083784571 11:64936482-64936504 CAAGACCACCATGGGCAACATGG - Intergenic
1084824365 11:71718255-71718277 CAAGACCAGCCTGGGCATAGAGG + Intergenic
1086622865 11:88908867-88908889 AGGGACCACCATATGCATATAGG - Intronic
1087633259 11:100675618-100675640 CAAGCTCAGCATGTACATATTGG - Intergenic
1090952841 11:131488589-131488611 CAAGTGCAGCATGTGCATACAGG + Intronic
1092898640 12:13037860-13037882 CAAGACCACCATGGGCAACATGG + Intergenic
1093518913 12:20024987-20025009 TAATACCACCATCTGCAAATAGG - Intergenic
1097106265 12:56627622-56627644 CAAGACCAGCCTGTGCAAACTGG + Intronic
1109864851 13:68249693-68249715 CAAGACCAGCATGAGCAAAATGG - Intergenic
1110108197 13:71707428-71707450 AAAGCCCACCATCTGCATTTGGG - Intronic
1111489215 13:88948482-88948504 CCAGACCAGCTTGTGAATATAGG + Intergenic
1111678215 13:91413079-91413101 CAAGACCAGCCTGGGCAAATAGG + Intronic
1112528042 13:100171686-100171708 CAAGACCAGCCTGGGCACATAGG + Intronic
1113441730 13:110334339-110334361 CACCACCACCATCTGCATGTTGG + Intronic
1114370405 14:22080861-22080883 CAGGATAAGCATGTGCATATGGG - Intergenic
1117021333 14:51573788-51573810 CAAGACCATCATTTGCATAAAGG + Intronic
1117621194 14:57588637-57588659 CAAAGCCCCCATGTGCATCTAGG + Intronic
1123768325 15:23503871-23503893 GGAGCCCACCATGTACATATCGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124665779 15:31591169-31591191 CAAAACCACCATCTGCATAGAGG + Intronic
1124718362 15:32088624-32088646 CAATACCACCATATACCTATCGG - Intronic
1127586443 15:60382415-60382437 CTACACCCCCAAGTGCATATGGG - Exonic
1127941827 15:63705827-63705849 CAAGACCAGCCTGGGCAAATAGG + Intronic
1130099127 15:80878780-80878802 CAAGACCACCATGTGCATATCGG + Exonic
1132565587 16:621119-621141 CAGGACCAACATGTGCACCTGGG - Intronic
1133152255 16:3843618-3843640 CAAGACCAGCCTGTGAACATAGG - Intronic
1134052203 16:11145054-11145076 GAAAACCACCATGTGCACATGGG + Intronic
1134912265 16:18038328-18038350 CAAGACCACCATGCACACAGTGG + Intergenic
1140605242 16:76528463-76528485 CAAGACCAGCCTGGGCACATAGG - Intronic
1140635744 16:76911089-76911111 CTAAACCACCATGTGAAAATTGG - Intergenic
1142454918 16:90214716-90214738 TAAGACCACCATCAGCACATAGG - Intergenic
1142578556 17:925833-925855 CAAGCCCACCATGTACTTCTTGG - Intronic
1143385237 17:6525315-6525337 CATGACCAGGATGTGCACATAGG - Intronic
1144643519 17:16952794-16952816 GAAAACAACCATGTGCAGATGGG - Intronic
1144844664 17:18210412-18210434 CAAGACCAGCATGGGCAACTTGG + Intergenic
1146608622 17:34285339-34285361 CAAGACCACCATGTGAACACAGG + Intergenic
1148475237 17:47924334-47924356 CAAGACCAGCCTGGGCATATAGG - Intronic
1149815949 17:59724009-59724031 CAAGACCAGCATGGGCAAAATGG + Intronic
1152135692 17:78501912-78501934 CAAGACCCCCCAGTGCATGTGGG - Intronic
1153582018 18:6582800-6582822 CTAGACCACCATGTGGAGACAGG - Intronic
1154037682 18:10821166-10821188 CAAGACCACCATGCTCAGTTTGG + Intronic
1154286836 18:13065886-13065908 CAACACCATCAAGTGCATTTAGG + Intronic
1157829657 18:50845520-50845542 CAAGACCACCATGAGCAACATGG + Intergenic
1159995943 18:74964302-74964324 CAAGAGATGCATGTGCATATGGG - Intronic
1162202801 19:9033347-9033369 CAAGACCACCCTGGGCAAAATGG - Intergenic
1163320392 19:16571559-16571581 CAAGGCCACCATGCCCATCTGGG - Exonic
1163890679 19:20009818-20009840 CAAGACCACCCTGGGCATCATGG + Intronic
1164665371 19:30029362-30029384 CAATACCAACATATGCATAATGG - Intergenic
1167129967 19:47578561-47578583 CAAGACCACCCTGGGCAACTTGG + Intergenic
1168078616 19:53993482-53993504 CAAGACCAGAATGTGCCTACAGG + Intronic
925511573 2:4632363-4632385 GAAGATCAATATGTGCATATTGG + Intergenic
925562759 2:5215805-5215827 CAAGAGCACCCGGTGCAGATGGG - Intergenic
927815446 2:26212285-26212307 CAAGACCAGCATGTGCAACATGG - Intronic
932705535 2:74021471-74021493 CCAGGCCTGCATGTGCATATGGG + Intronic
933401213 2:81797924-81797946 ACAGACCACCATGTGCATTGTGG + Intergenic
934542572 2:95188263-95188285 CAAGAACACCAGGTCCACATGGG + Intergenic
938014044 2:127852444-127852466 CAAGACCAGCATGTGCAACATGG - Intronic
938109911 2:128557038-128557060 CAATACCATCATCTGCATTTTGG - Intergenic
938762145 2:134435643-134435665 CAAAAACACCATCTGCATGTTGG - Intronic
940019280 2:149140120-149140142 CCAGAGGACCATGTGCATGTGGG + Intronic
940309099 2:152258397-152258419 CAAGACCAGCCTGGACATATGGG - Intergenic
940356433 2:152747899-152747921 CCAGACCAGCCTGAGCATATAGG - Intronic
947613287 2:231537261-231537283 CAAGACCAGCATGGGCAACTTGG + Intergenic
949086383 2:242159383-242159405 TAAGACCACCATCAGCACATAGG - Intergenic
1170029611 20:11931351-11931373 CAAAACCACCATCTGCATCTGGG + Intergenic
1170485013 20:16807217-16807239 CAAGACCTCCATGGGGAGATGGG + Intergenic
1171442962 20:25180543-25180565 CAGGACCAACATGTACATACAGG - Intergenic
1171974730 20:31587442-31587464 CCACACCACCATGAGCATAGTGG - Intergenic
1172559992 20:35878974-35878996 CAACACCATCAAGTGCATTTAGG - Intronic
1177191488 21:17856753-17856775 CAAAACCACCATCTGTATTTGGG + Intergenic
1178808889 21:35862681-35862703 CAAGCCCACCATATTCATTTTGG - Intronic
1182666601 22:31964701-31964723 CCATACCACAATGTGCATTTGGG - Intergenic
1184312539 22:43657087-43657109 CAAGACCAGCCTGTGCAACTTGG + Intronic
949725603 3:7040880-7040902 CAAGACCACCCTGGGCAAAACGG + Intronic
951614825 3:24530786-24530808 CAAGACCACCATGTTCTGCTTGG + Intergenic
951826515 3:26874986-26875008 CAAGACCAGCCTGGTCATATGGG + Intergenic
953424716 3:42785013-42785035 CAACACCATCAAGTGCATTTAGG + Intronic
954297376 3:49681776-49681798 CATGACCACCATGGGCACTTGGG - Exonic
956036209 3:65095090-65095112 AAAGACCACCATGTGAGTAGGGG + Intergenic
957094482 3:75765906-75765928 CAAGACCAGCCTGTGCAAAATGG + Intronic
957913509 3:86654947-86654969 CAAGACATGTATGTGCATATAGG + Intergenic
958098920 3:88983709-88983731 CAAGAGCACTATGGGCATTTTGG - Intergenic
964024591 3:152057494-152057516 CACGACTTTCATGTGCATATGGG - Intergenic
964257339 3:154791136-154791158 CATGACCATCATGTCCATATGGG + Intergenic
968970434 4:3790926-3790948 CAAGACCTGCATGTGCAGACAGG - Intergenic
971783758 4:31074053-31074075 CAAAACAACCATGTGAATCTTGG - Intronic
978526689 4:109674354-109674376 CAACACCATCAAGTGCATTTAGG - Intronic
982421543 4:155204763-155204785 CATGACCATCATCAGCATATTGG - Intergenic
988827391 5:34951724-34951746 CAAGACCACCCTGTGCAACATGG - Intronic
990810988 5:59723281-59723303 CATGACCAGTATGTGAATATAGG + Intronic
991953986 5:71973857-71973879 CAAGTCCACCATTTCCATGTAGG + Intergenic
992677092 5:79116015-79116037 CAAGACCAGCCTGGGCACATAGG + Intronic
992792282 5:80224274-80224296 CAAGACCACCCTGGGCAAAGTGG + Intronic
994557418 5:101320878-101320900 CAAACCCACCATTTTCATATTGG + Intergenic
995540744 5:113183707-113183729 CAAGAGCACCAGGGGCAAATGGG + Intronic
995677631 5:114681078-114681100 CCAGACCACCATGTGAAAAGGGG - Intergenic
997692312 5:135835036-135835058 CAAGACCACCAGGGGGATCTCGG - Intronic
997846474 5:137291067-137291089 CAAGACTACCAGGTGAATCTAGG - Intronic
998316518 5:141187995-141188017 CAAGACCACAATGCGTATAGTGG - Exonic
999778031 5:154826325-154826347 CAAGACCAGCCTGGGCATCTTGG + Intronic
1000449512 5:161368022-161368044 ATAGACCAACCTGTGCATATTGG - Intronic
1004721797 6:18274207-18274229 CAAGACCAGCCTGGGCAAATAGG - Intergenic
1005023574 6:21441160-21441182 GAAGACCACCATCTGCAAACAGG + Intergenic
1008894838 6:56541047-56541069 CAAGGCCAGCAAGTGCAGATGGG - Intronic
1010288507 6:74108133-74108155 CAAGACCAGCATTTGATTATGGG + Intergenic
1014226287 6:118851225-118851247 CAGGACCACCATGTGCTCACTGG - Intronic
1018846007 6:167556521-167556543 CAAGACCACCATGTTCTGCTTGG + Intergenic
1021766543 7:23955648-23955670 CACCACCACCATGTACATAGTGG - Intergenic
1028551911 7:92077750-92077772 CAAGACCAACATGTGCTATTTGG + Exonic
1034661906 7:152778436-152778458 CAAGACCACCCTGGGCAAAATGG - Intronic
1037661621 8:20932754-20932776 CATAGCCACCTTGTGCATATAGG - Intergenic
1038143398 8:24870875-24870897 CAAGATGACCATGTGAAGATGGG - Intergenic
1038973980 8:32671093-32671115 CAAGACCACTATATTCATTTGGG + Intronic
1039425320 8:37480401-37480423 CAAGGCTACCATGTGCATGCAGG - Intergenic
1041341982 8:56855842-56855864 GAAGACCACCATGTGAAGAATGG + Intergenic
1043084518 8:75811866-75811888 CAAGACCAGCATGGGCAAAGTGG - Intergenic
1044094472 8:88045766-88045788 CAAGACAAACAAGTGCATCTAGG - Intronic
1045953788 8:107883211-107883233 AAAGACCACCATCTAAATATTGG - Intergenic
1047868360 8:129054630-129054652 GAAGACCACCATGTTCATATAGG - Intergenic
1049335377 8:142081771-142081793 AAACTCCACCATGTGCTTATAGG + Intergenic
1050424460 9:5499482-5499504 CAAGATCACCCTGTGAATGTAGG - Intergenic
1051217654 9:14815846-14815868 CAAGACCACCCTGTCCAAAATGG - Intronic
1052883850 9:33624326-33624348 CTACACCCCCAAGTGCATATGGG + Intergenic
1052892876 9:33720128-33720150 CAAGGCCACCTTGAGGATATAGG - Intergenic
1055614898 9:78061571-78061593 CAAGACCACCATGGGCAACATGG + Intergenic
1061337023 9:129945965-129945987 CAAGACCACCATGGGCAATGTGG + Intronic
1062521126 9:136958442-136958464 CATGACCACCATGTGCTGGTGGG + Intergenic
1185474951 X:409650-409672 CAAAACCAGCCTGGGCATATAGG - Intergenic
1190078559 X:47337128-47337150 CAAGGCCACCAAGGCCATATTGG - Intergenic
1190271292 X:48865807-48865829 AAAGACCACCAGGAGCATAGTGG - Intergenic
1193051652 X:77107299-77107321 CAAGACCACCATGGGCAACATGG + Intergenic
1196352863 X:114753503-114753525 CAATTACATCATGTGCATATGGG - Intronic
1199213261 X:145239046-145239068 AAAGCCTCCCATGTGCATATGGG - Intergenic
1200001190 X:153060598-153060620 CATGACCAACATGCGCAGATAGG - Intergenic