ID: 1130099142

View in Genome Browser
Species Human (GRCh38)
Location 15:80878892-80878914
Sequence CTGGGGCAGTGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1155
Summary {0: 1, 1: 0, 2: 12, 3: 143, 4: 999}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130099142_1130099151 -1 Left 1130099142 15:80878892-80878914 CCCTCTTCCCTCCACTGCCCCAG 0: 1
1: 0
2: 12
3: 143
4: 999
Right 1130099151 15:80878914-80878936 GAGCTTAGCAGATAGGATGCAGG 0: 1
1: 0
2: 1
3: 16
4: 129
1130099142_1130099152 18 Left 1130099142 15:80878892-80878914 CCCTCTTCCCTCCACTGCCCCAG 0: 1
1: 0
2: 12
3: 143
4: 999
Right 1130099152 15:80878933-80878955 CAGGTTGCCATGAGCTCAGATGG 0: 1
1: 0
2: 13
3: 364
4: 5940
1130099142_1130099147 -8 Left 1130099142 15:80878892-80878914 CCCTCTTCCCTCCACTGCCCCAG 0: 1
1: 0
2: 12
3: 143
4: 999
Right 1130099147 15:80878907-80878929 TGCCCCAGAGCTTAGCAGATAGG 0: 1
1: 0
2: 0
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130099142 Original CRISPR CTGGGGCAGTGGAGGGAAGA GGG (reversed) Intronic
900081223 1:859022-859044 CTCACGCAGTGGATGGAAGATGG - Intergenic
900145781 1:1158167-1158189 CTGGGACGGTGCTGGGAAGAAGG - Intergenic
900235631 1:1588721-1588743 CGGGGGAAGGGAAGGGAAGAAGG - Intergenic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900566582 1:3335164-3335186 CTGGGGCTGTGCAGGGCAGCTGG - Intronic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901167145 1:7229130-7229152 CTGGGGCAGAGGAGGGAGAGTGG + Intronic
901313167 1:8285310-8285332 GTGGGGCAGTGGAAGGAAGATGG + Intergenic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901456528 1:9366223-9366245 CTGGGGCAGTTGCGGGGAGAAGG + Intronic
901511418 1:9719849-9719871 CTGGGGGAGGGCAGGGAAGCTGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901727959 1:11257076-11257098 CTGGGTCATTGGAGGGGAGGAGG + Exonic
901737326 1:11320614-11320636 CATGGGCAGAGGAGGGAAGGTGG - Intergenic
901802915 1:11719561-11719583 CTGGGCGAGTGGAGGCAAGGGGG - Intronic
902095935 1:13945895-13945917 CTTGGGCAGAGAAGGGAAGCAGG - Intergenic
902553027 1:17230474-17230496 CTGGGGCAGGGCAGGGCAGCGGG - Intronic
902735768 1:18399615-18399637 CTGGGTCAGTGGGTGGCAGAGGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902790673 1:18765754-18765776 CAGGGGAAGAGCAGGGAAGAAGG + Intergenic
902832943 1:19029469-19029491 GTGGGGCAGGGGTGGGAAGCTGG - Intergenic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
903344373 1:22675075-22675097 CTGTGGCAGCGGTGAGAAGATGG - Intergenic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903359456 1:22767673-22767695 CTGGGCCAGTGGTGGGAAGGAGG - Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903862538 1:26373488-26373510 CCAGGGCAGTGAAGGAAAGAAGG + Intronic
904026819 1:27509280-27509302 TTGGGGCAGTGGGGGAAAGATGG - Intergenic
904304083 1:29575797-29575819 CTGGAGGAGGGCAGGGAAGAGGG - Intergenic
904452273 1:30621460-30621482 CTGGGGGAGTCAAGGGAACAAGG - Intergenic
904564999 1:31423646-31423668 CTTGGGCGGTGAAGGGGAGAGGG + Intronic
904922535 1:34020272-34020294 CTTGGGAAGTGGAGGGGACAGGG - Intronic
905025127 1:34844582-34844604 CTTGGACAGTGGAGGGTGGAGGG - Intronic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905508127 1:38496327-38496349 CCTGGGCTGCGGAGGGAAGAAGG + Intergenic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906212039 1:44017412-44017434 CTGGGGCAGAGCAGGCGAGAGGG + Intronic
906215095 1:44033940-44033962 CTGGGGCAGGGGAGGGGATGGGG + Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
906640086 1:47436686-47436708 CTGGGGCACGGAAGGGGAGATGG - Exonic
907467862 1:54651441-54651463 CTGGGGAAGGGGAGTGGAGATGG + Intronic
907495475 1:54841382-54841404 TTGGAGCAGTGGAGGGAAAGTGG + Intronic
907663450 1:56414496-56414518 ATGGGGCAGTGGAGGGGGGATGG - Intergenic
909890063 1:80994238-80994260 CTGGGGCAGTGGGGCTAAGGGGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
911359511 1:96859344-96859366 CTTGGGCAGAGGAGCCAAGATGG - Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912145948 1:106794619-106794641 CTGGGGCAGTGGGGGGAGGTGGG + Intergenic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913124451 1:115772259-115772281 CTGGTGCAGAGGAGGCAGGAAGG - Intergenic
913259952 1:116988812-116988834 CCGGGCCTGTGGTGGGAAGACGG + Exonic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
913562137 1:120032122-120032144 CTGGTGCAGTGGAGGGACTCAGG + Intronic
913569964 1:120110197-120110219 CTAGGGCCGCGCAGGGAAGACGG + Intergenic
913635987 1:120761472-120761494 CTGGTGCAGTGGAGGGACTCAGG - Intergenic
914214360 1:145611335-145611357 TGGGGGCAGGGGAGGGGAGAAGG - Intronic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914282722 1:146191510-146191532 CTGGTGCAGTGGAGGGACTCAGG + Intronic
914290772 1:146271162-146271184 CTAGGGCCGCGCAGGGAAGACGG + Intergenic
914466298 1:147931728-147931750 TGGGGGCAGGGGAGGGGAGAAGG - Intronic
914543752 1:148642226-148642248 CTGGTGCAGTGGAGGGACTCAGG + Intronic
914551816 1:148721945-148721967 CTAGGGCCGCGCAGGGAAGACGG + Intergenic
914622869 1:149428783-149428805 CTGGTGCAGTGGAGGGACTCAGG - Intergenic
914675353 1:149903929-149903951 CTGGGGCAGAGGCAGGAAGCAGG - Exonic
914815220 1:151058147-151058169 AAGGGGCAGTGGAGAGAACAAGG + Exonic
914826751 1:151142794-151142816 CTGGGGCAGTGCTGGAGAGAGGG - Intronic
914899304 1:151703393-151703415 CGGGGCCAGTCGTGGGAAGAGGG + Exonic
915200135 1:154221086-154221108 CGGGGGCAGGGGAGAAAAGAGGG - Intronic
915229171 1:154433028-154433050 CTGGGGCAGTGGGAGGAAGCGGG + Intronic
915249779 1:154579754-154579776 CAAGGGCAGTGTGGGGAAGATGG - Exonic
915254816 1:154619203-154619225 CTGGGGCTGGGGAGGGAACCTGG - Intronic
915255434 1:154625249-154625271 CTGGTGCAGTGGGGGAAAGGAGG - Intronic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
915564879 1:156707678-156707700 AGGGGGCAGTGAAGGGAAGGAGG - Intergenic
915583658 1:156831401-156831423 CTGGGGCAGTGGTGACAGGAGGG + Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915626894 1:157119355-157119377 CTGGTGAAGTGGGGGAAAGAAGG + Intergenic
915731644 1:158058406-158058428 CTGGGGCAGGGCAGGGAGGGAGG - Intronic
916082400 1:161242865-161242887 CTAGGTCAGGGGAGGGAAGTGGG - Intergenic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916958515 1:169865451-169865473 CTGGGGCAGTGGCTGGATGGGGG - Intronic
917136579 1:171793980-171794002 CTGGGGTAGTAGGGGGCAGATGG - Intronic
918460461 1:184771342-184771364 CTGGCACAGAGAAGGGAAGATGG - Intergenic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
919793282 1:201305972-201305994 CTGGGGCCATGGAAGGGAGATGG + Intronic
919798993 1:201339578-201339600 CTGGGGCAGTGGAGTGCAGTGGG - Intergenic
919883008 1:201913095-201913117 CTGGGCCAGAGGTGGGAAGCTGG + Intronic
920224481 1:204428182-204428204 CCGGGGCAGTGGGTGGAAGAAGG + Exonic
920385538 1:205568599-205568621 CTGTGGCAGTGGAGGAAACCCGG - Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920899043 1:210087865-210087887 GTGGGGCAGAGGAAGGCAGAGGG - Intronic
920925280 1:210335659-210335681 GCAGGGCAGTGGAGAGAAGATGG + Intronic
921584746 1:216933891-216933913 AGGGGTCAGTGGAGGGAAGATGG - Intronic
922466525 1:225848696-225848718 GTGGGGGAGTGCAGGGATGAGGG + Intronic
922559493 1:226558864-226558886 CTGGGGCAGGGTAGGGTAGCAGG + Intronic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923494708 1:234513979-234514001 CGGGGGCAGAGGAGGGGCGATGG + Intergenic
923697749 1:236270850-236270872 CTGGGGTAGGGGATGGATGATGG + Intronic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
924231955 1:241969843-241969865 ATGGGGCAGTGAGGGGCAGAGGG - Intergenic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924822143 1:247503607-247503629 CTGGGGCAGAGAAGAGGAGAGGG + Intergenic
924944701 1:248838451-248838473 CTGGGGCGGGGGAGCGAGGAAGG - Exonic
1062822871 10:548124-548146 CTGGGGCAGAGGTGGGGACAGGG - Intronic
1062900020 10:1137075-1137097 GAGGGGCAGTGCAGGGAACACGG - Intergenic
1063078816 10:2745086-2745108 CTGGAGCAGTGGCGAGAAAACGG + Intergenic
1063297839 10:4825404-4825426 CAGGGCCAGTGGAGGGAAAGAGG - Intronic
1063528204 10:6804288-6804310 GTGGGGTAGGGGAGGGAGGAGGG - Intergenic
1063529761 10:6819692-6819714 CTGGGGCTGAGGAGAGGAGAAGG + Intergenic
1063664458 10:8053237-8053259 ATGGGGTAGAGGAGCGAAGAGGG + Intergenic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1063938949 10:11107822-11107844 AGGGGGCAGAGGAGGGAGGAGGG - Intronic
1064453695 10:15467215-15467237 GTGTGGCAGGGGAGAGAAGAGGG + Intergenic
1064852059 10:19719341-19719363 CTTGTGAAGTGGAGTGAAGACGG + Intronic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1065972684 10:30817906-30817928 CTGGGGTATTGGAGGGAAGCTGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066074383 10:31858473-31858495 CTGGGGAAGTTGAGGCAAAAGGG + Intronic
1066088394 10:31993760-31993782 CATGGGCAGAGAAGGGAAGATGG - Intergenic
1066746456 10:38606480-38606502 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1067442617 10:46318092-46318114 CTGGGGCAGAGGAGGGGAGGTGG + Intronic
1067574513 10:47400761-47400783 GTGGAACAGTGGAGGGGAGAAGG + Intergenic
1068356508 10:55916734-55916756 CTGGGTCAGGGGAGAGAAGGAGG + Intergenic
1068656594 10:59582290-59582312 ACAGGGCAGTGCAGGGAAGACGG + Intergenic
1069345264 10:67462124-67462146 CTGGGGCAGTGGAAGCCAGAAGG - Intronic
1069535226 10:69248231-69248253 CTGGGGCAGTGGAAGGCACTTGG - Intronic
1069541311 10:69296181-69296203 TTGGGGAATGGGAGGGAAGAGGG - Intronic
1069735073 10:70648584-70648606 ATGGGGCAGTGTAGGGGAAATGG + Intergenic
1069960277 10:72075276-72075298 CTGGGGCAGGGGTGGGGACAAGG + Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071404575 10:85317811-85317833 CTGGGGAAGTCAAGGGAAGAGGG + Intergenic
1071680829 10:87703743-87703765 CTGGGCCAGTAGTGGGAAGAAGG + Intronic
1071779906 10:88832807-88832829 CTGGAGCAGAGGAGGGAAAGAGG - Intronic
1071974381 10:90940215-90940237 CTGGGTCAGGGTAGGGAAGAGGG - Intergenic
1072038935 10:91589767-91589789 CTGGGGGAGTGTGGGGGAGAAGG + Intergenic
1072553192 10:96494423-96494445 CTGGGGCAGGGCAGGGCATATGG - Intronic
1072669582 10:97419548-97419570 AAGGGGCAGTGGAGGGTAAAAGG + Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072737507 10:97889106-97889128 CAGGGGCAGTGGAGGCGGGAGGG + Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073632412 10:105161991-105162013 CAGGGGCAGGGGCGGGAGGAGGG - Intronic
1073986674 10:109217502-109217524 ATGGGGTAGTGGAAGGAAGGGGG - Intergenic
1074001539 10:109378698-109378720 CAGGGCCAGTGCAGGGAGGAGGG + Intergenic
1074015473 10:109529902-109529924 CTGGGGAAGTGCAGGGAACAGGG + Intergenic
1074153988 10:110782643-110782665 CTGGGGAGGTGGCGGGGAGAAGG - Intronic
1074432872 10:113408648-113408670 TGGGGGCAGTGGTGGGAAGGAGG - Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1074882735 10:117671350-117671372 CTGGGGCTGTGGAGTGAACTGGG - Intergenic
1074988548 10:118680335-118680357 GTGGGGCAGGGGAGTGAAAATGG + Exonic
1074988662 10:118681801-118681823 CTTGGCCAGTGGAGGAAGGAAGG + Exonic
1075199715 10:120392356-120392378 GTGGGGAAGTGGAGGCAACAGGG + Intergenic
1075474031 10:122717816-122717838 CTGGGGTAATGGAGGTAAGGCGG - Intergenic
1075576359 10:123580557-123580579 CTGGGGCAATGGGAGGAAGTTGG - Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075891577 10:125955886-125955908 CTAAGGCAGTGGAAGGAAGCAGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076884830 10:133257556-133257578 CTGGGGCAGAGGAGGGGCGGGGG - Intergenic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078441563 11:11372633-11372655 CAGGGGCAGGGGAGAGCAGAAGG + Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1078744938 11:14103514-14103536 CTGGCCCAGTGGTGGGAGGATGG - Intronic
1078868953 11:15326312-15326334 TTGGGGAAGTGGAGAGGAGAAGG + Intergenic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1079105780 11:17571490-17571512 AAGGGGCAGTGAAGGGAGGAAGG - Intronic
1079279798 11:19076899-19076921 CTGGGGCAGGGGAGAGGAGATGG - Intergenic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080569148 11:33540733-33540755 GTGGGCCAGTGGAGGCCAGAGGG + Intergenic
1080578615 11:33623123-33623145 CTGGGGCAGGTGTGGGAAGTGGG - Intronic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1081006072 11:37741955-37741977 CTGGGGGAGGGGAGGGAACCTGG + Intergenic
1081775965 11:45676109-45676131 CTTGGGCAGTGGAGGAGGGAGGG - Intergenic
1081812052 11:45919631-45919653 GTGGGGCAGAGGAAGGGAGAAGG - Intergenic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082794597 11:57370064-57370086 AAGGGGCATGGGAGGGAAGAGGG + Exonic
1082824574 11:57568179-57568201 CTGGGCCCATGGAGGGAAGGCGG - Intronic
1083042734 11:59703312-59703334 ATGGAGCAGTGGAGGAAAGTGGG - Intergenic
1083269528 11:61564816-61564838 CTGGGCCAGTGGATGGGGGAAGG - Intronic
1083611004 11:64004259-64004281 CTGGGGCAGTGGAGGGCACCAGG + Intronic
1083620522 11:64047185-64047207 CTGGGGCAGGGGAGGGGAGGGGG - Intronic
1083660347 11:64249172-64249194 ATGGCGCGGTGGGGGGAAGAGGG - Intergenic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083840512 11:65301704-65301726 TGGGGGCAGGGGAGGGAAGAGGG + Intronic
1083897771 11:65628750-65628772 CTGGGGCAGTGGGGGGTGGTGGG + Intronic
1083942350 11:65903190-65903212 CTGGGGCAGCTGAGGGAGCAGGG + Intergenic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084557229 11:69882308-69882330 TTGGGTCAGTGGATGGAAGCAGG - Intergenic
1084671805 11:70611442-70611464 ATGGGGCATTGCAGGGAAGATGG - Intronic
1084737157 11:71112969-71112991 CTGGCGTGGTGGAGGGAAGCGGG - Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085534033 11:77207486-77207508 CTGGGGGAGAGAGGGGAAGAGGG + Intronic
1085732522 11:79011695-79011717 GTGGGGCAGTGGGGAAAAGATGG - Intronic
1085741642 11:79082467-79082489 CTGAGGCCGTGGAAGGAAGCAGG - Intronic
1086497330 11:87418111-87418133 ATGGGGCAGGGGAGGCAAGAAGG + Intergenic
1086950735 11:92887810-92887832 CCAGGGCAGGGGAGGGAAGCAGG + Intronic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088613929 11:111603604-111603626 TTGAGGCAGTGGAAGGAAGGGGG - Intronic
1088740752 11:112765071-112765093 CTGGGCTAGTGCAGGGAAGAGGG + Intergenic
1088822078 11:113464976-113464998 GAGGGGCAGTGGAGGTAGGAAGG - Intronic
1088835080 11:113570931-113570953 CCAGGGCAGTTGAAGGAAGAGGG + Intergenic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1089383440 11:118052368-118052390 CTGGGGCCCTGCAGGGAAGCAGG + Intergenic
1089396666 11:118140641-118140663 AAGGGGAAGGGGAGGGAAGATGG - Intronic
1090172776 11:124619274-124619296 CCTGGGCAGTGGAAGGAAGGAGG - Exonic
1090234008 11:125133112-125133134 TTGGGGCAGTGGAGCGGAGATGG + Intergenic
1091161569 11:133426566-133426588 CTGGGGCAGAGGAGGAGAGAGGG - Intronic
1091337443 11:134783029-134783051 CTTGGGGAGTGATGGGAAGAAGG - Intergenic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1091388755 12:112286-112308 GTGGGGAAGTGGGGGGAAGGGGG + Intronic
1091394018 12:142698-142720 CTGGGGAAGGGAAGGGAAGCCGG - Intronic
1091706307 12:2695644-2695666 CTGGGGCTGGGGAGGGCAGTGGG - Intronic
1091711535 12:2743873-2743895 CTGGGGCTGGGGAGGGCAGTGGG - Intergenic
1091785273 12:3239523-3239545 CTCGGGCAGTGGAGCGGGGAAGG - Intronic
1091916587 12:4274705-4274727 CCGGGGAGGTGGAGGGAGGAGGG + Intronic
1092083419 12:5736540-5736562 CTTGGGCACTGGAGGGAGGGAGG - Intronic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1092927010 12:13280446-13280468 GAGGGGCAGAGGTGGGAAGAGGG - Intergenic
1092970362 12:13688140-13688162 GTGGGGCATTGGAAGGAAAATGG - Intronic
1093628494 12:21380870-21380892 CTGGGGCAGTGGGGGCATGGGGG - Intronic
1094040310 12:26114615-26114637 CTGGAGCAGGGAAGGGAGGAAGG + Intergenic
1095217809 12:39569756-39569778 CTGGGGGAGTGGAGCCAAGAGGG - Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1095818867 12:46455101-46455123 TGGAGGCAGTGGAGGGAAGATGG - Intergenic
1095854445 12:46844625-46844647 GTAGGGCAGAGGAGGGAAGATGG + Intergenic
1095865039 12:46962257-46962279 TGGGGGCAGTGGAAAGAAGAGGG + Intergenic
1095955394 12:47802921-47802943 ATGGGGCAGTGGGAGGAAAAGGG - Intronic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096573588 12:52539157-52539179 CTGGGACAAGGGAGGGTAGAGGG - Intergenic
1096745657 12:53725309-53725331 CTGGAGCTGTGGGGGGAAGGAGG - Intronic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1097279273 12:57834529-57834551 ATGGGGCAGAGGAGGAAGGAGGG + Intronic
1098382234 12:69881401-69881423 CTGGGGAAGTGGTGGGATGGGGG - Intronic
1098533109 12:71563319-71563341 CTGGTGCAGTGGAGGTCAGGAGG - Intronic
1098555747 12:71816987-71817009 TTGGGGAAGGGGAGGGAAAAGGG + Intergenic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1100011125 12:89954454-89954476 CTGGGGCAGTGGAAAGACCAAGG + Intergenic
1100346531 12:93737074-93737096 CTGGGATAGTTGAGGGAAGGTGG + Intronic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1101575568 12:105993736-105993758 CGGGGGCAGTCGGGGGAAGAGGG + Intergenic
1101736203 12:107465198-107465220 TCGGGGCACTGGAGGGCAGACGG - Intronic
1101959135 12:109235082-109235104 CTAGGGCTGTGGTGGGGAGAGGG - Intronic
1102038637 12:109786681-109786703 CTGGGGCAGTGGGGCCAGGATGG - Intronic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102637785 12:114339440-114339462 CTGGAGCAGTGGAGGGCGGGAGG + Intergenic
1103157211 12:118696185-118696207 CTAGGGTAGAGAAGGGAAGATGG - Intergenic
1103198982 12:119070909-119070931 CAGAGGCAGTGGAGTAAAGACGG - Intronic
1103202251 12:119097252-119097274 GTGGGGCTGTGGAGGGCTGAGGG + Intronic
1103615555 12:122149422-122149444 GTGGGGCAGGGGAGGAAAGGGGG + Intergenic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103682032 12:122701840-122701862 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103683780 12:122715301-122715323 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103705163 12:122867391-122867413 CTGGGGCAGGGTAGGGAAGGGGG + Exonic
1103939790 12:124495493-124495515 GTGTGGCAGTGGATGGAGGAGGG - Intronic
1103960421 12:124605942-124605964 GTAGGGAAGAGGAGGGAAGAGGG - Intergenic
1104041383 12:125133608-125133630 CAGGGGCAGTGGAGGGCACAGGG - Intronic
1104328828 12:127825498-127825520 CTGGGGCAGAGCAGTGAGGACGG - Intergenic
1104468603 12:129009951-129009973 CTGGGGCAGAGGAGGGGGTAAGG + Intergenic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104623333 12:130334513-130334535 CCAGGGTAGTGGGGGGAAGAGGG + Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104770222 12:131356867-131356889 GAGGGACAGTGGAGGAAAGAGGG + Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104910338 12:132237216-132237238 CTGGGGCAGCTGAGGGTACACGG - Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105774040 13:23639752-23639774 CTGAGGCAGTGGTGGGAGGGAGG + Intronic
1106117464 13:26829858-26829880 GTGGGGCTGGGGAGGGGAGATGG + Intergenic
1106351707 13:28936990-28937012 CTGGGGTTGTGGAGGAAATAGGG + Intronic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1107715134 13:43192409-43192431 CCGGGGCGGTGGGGGGAAAACGG - Intergenic
1107903814 13:45044065-45044087 ATGGGACCGTGAAGGGAAGATGG - Intergenic
1108099297 13:46936765-46936787 CTGGGGCAGTGGTGGTAAAGGGG + Intergenic
1108315034 13:49228505-49228527 CTGGGGCAGGAGCCGGAAGATGG + Intergenic
1111076861 13:83248562-83248584 CTGGAGCAGTGGTGGCAAAAAGG - Intergenic
1111244306 13:85515349-85515371 CAGGGTCAGTGGAGGAAAGCGGG + Intergenic
1111702972 13:91713946-91713968 ATAGGGCAGTGGAGGAGAGAGGG - Intronic
1112761034 13:102693428-102693450 GTGGGGCAGGGCAGGGAAGCCGG - Intronic
1112821251 13:103338805-103338827 CTGGCGTGGTGGAGGGATGAAGG - Intergenic
1113447703 13:110382385-110382407 CTGGGGAAGTGGGCGGAAGACGG - Intronic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1114626321 14:24132396-24132418 CTGGGGCAGTGGCTCGAAGCAGG - Exonic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115399412 14:32939792-32939814 CTGGGGAGGGGGAGGGAAGGCGG + Intronic
1115779750 14:36756206-36756228 CGGGGGCAGCTGAGGGAAGGTGG + Intronic
1116250978 14:42482399-42482421 CTTGGGCAGTGGATGGGCGATGG + Intergenic
1116427334 14:44807018-44807040 GAGGGGAAGGGGAGGGAAGAAGG + Intergenic
1116560249 14:46369565-46369587 CTGAGGCAGTGAAGGGATCAGGG + Intergenic
1116864894 14:50024071-50024093 CTGGGGCAGTGTGGGGTAGGAGG - Intergenic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118572493 14:67207571-67207593 CAGGGGCAGTGGAAAGAAGAAGG + Intronic
1119709258 14:76809505-76809527 CTGCAGCAGTGGCGAGAAGAAGG - Exonic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1120439624 14:84520189-84520211 CTGGGACAGTGGTGGCAACAGGG - Intergenic
1120522033 14:85534730-85534752 CGGCGGCAGCGGAGAGAAGACGG + Intronic
1120682933 14:87502521-87502543 CTGGGGCATTGGTGGTCAGAAGG - Intergenic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121036983 14:90714349-90714371 CTGGGGCAGGGGGTGGCAGAAGG + Intronic
1121435212 14:93914783-93914805 CTGAGGCAGTGGAGAAGAGATGG - Intergenic
1121596241 14:95165381-95165403 ATTGGACAATGGAGGGAAGATGG - Intergenic
1121641067 14:95485248-95485270 CTGATGCAGTTGAGGCAAGAAGG - Intergenic
1121649274 14:95545179-95545201 CGGTGGCAGAGGTGGGAAGAAGG + Intergenic
1122914981 14:104854567-104854589 AGGGGGCAGTGGAGGGATGGAGG + Intergenic
1122917278 14:104865059-104865081 CTGGGGCAGGGGCGGGATGGCGG + Intergenic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1202844711 14_GL000009v2_random:158059-158081 CTGGGGCAGTGGTGGGGAAGTGG - Intergenic
1202914108 14_GL000194v1_random:148304-148326 CTGGGGCAGTGGTGGGGAAGCGG - Intergenic
1123726905 15:23112277-23112299 CTGGAGCAGTGGTGGGAACGTGG + Intergenic
1123805768 15:23871024-23871046 CTTGTGCAGTGGATGTAAGAAGG - Intergenic
1124022833 15:25939617-25939639 CAGGGGCAGTGGGGGTTAGATGG + Intergenic
1124029055 15:25992603-25992625 CATGGGCTGTGGAGGGTAGAGGG - Intergenic
1124369775 15:29097805-29097827 CTGGGGCAAAGGAGTGAAGGGGG - Intronic
1124789829 15:32717660-32717682 CTGGGGCAGAGAAGGAATGAGGG + Intergenic
1124937327 15:34185657-34185679 CTGAGACAATGCAGGGAAGAAGG + Intronic
1125102135 15:35926463-35926485 GGGAGGCAGTGGTGGGAAGATGG + Intergenic
1125281231 15:38044351-38044373 GTAGGGGAGGGGAGGGAAGAAGG + Intergenic
1125340559 15:38671543-38671565 CTGGTTCAACGGAGGGAAGATGG - Intergenic
1125689300 15:41583769-41583791 CTGGGGCAGTGGAAAGATGGAGG - Intergenic
1126107398 15:45155705-45155727 CTTGGGCAGTGGAGTGGAGAGGG + Intronic
1126113621 15:45189337-45189359 CTGAGGCAGTGGGGGAAAGGGGG - Intronic
1126125524 15:45292137-45292159 CTTGGCCAGTGGAGGCAGGATGG - Intergenic
1126518888 15:49566193-49566215 CTTGGGAAGTGAAGGGAAAAGGG + Intronic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1126593255 15:50360572-50360594 TTGGGGAGGTGGAGGGAATAAGG + Intergenic
1126900000 15:53305090-53305112 CTGGGGCATGGTAGGGAATAAGG + Intergenic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127599258 15:60518784-60518806 CAGGGTCAGTGAAGGGGAGAGGG - Intronic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128237435 15:66077840-66077862 ATGGGTCAGTGGATGAAAGAGGG + Intronic
1128569908 15:68726459-68726481 CCGGGGCTGCTGAGGGAAGAGGG - Exonic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1128649306 15:69398824-69398846 CTGAGTCAGAGGAGGGCAGAGGG + Intronic
1128668531 15:69556859-69556881 CGGGGGCAGCGGAAGGCAGAAGG - Intergenic
1128865852 15:71115083-71115105 CTGGGGCAGGGGACGGACGCGGG - Intronic
1129186363 15:73909530-73909552 CCTGGGAAGTGGAGGGAAGGTGG + Intergenic
1129414361 15:75367005-75367027 CTGAGCCAGTGAAGGGAGGAAGG + Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1130080972 15:80733180-80733202 CGGGGACAGGGGAGGGAAGGTGG - Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130843967 15:87726930-87726952 GTGAGTCAGAGGAGGGAAGATGG + Intergenic
1130857734 15:87856092-87856114 AAGAGGCAGTGGAAGGAAGAAGG - Intergenic
1131039104 15:89245570-89245592 GGGGGGCAGTGGATGGAAGCAGG + Intronic
1131090893 15:89624375-89624397 CAGGGGGAGTTGAGGGAACAGGG - Exonic
1131184415 15:90262853-90262875 CTGGGTCAGGGAAGGGATGAGGG + Intronic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132313917 15:100877479-100877501 GTGGTGCAGTGCAGGGAGGAGGG - Intergenic
1132481674 16:169393-169415 CTGGGGCAGGGAGGGGAGGAGGG - Intergenic
1132657128 16:1046022-1046044 CTCGGGCAGGGGCCGGAAGAGGG + Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133026000 16:2989242-2989264 CTAGGGCAGTGGAGGCTAGAGGG - Intergenic
1133068715 16:3230849-3230871 CCGGGGCAGAGTAGTGAAGAAGG - Intronic
1133148228 16:3806755-3806777 AGGGGGCCTTGGAGGGAAGATGG - Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1134084785 16:11348904-11348926 CTGGGGCAGTGGTGGAAGGTAGG + Intronic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1135147468 16:19975016-19975038 CTGGGGAAGTGCAGGGTTGAGGG - Intergenic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136171625 16:28493404-28493426 GTGGGGCTGGGGAGGGGAGAAGG + Intronic
1136316186 16:29455758-29455780 CTGGGGCGGTGGAGGCCCGAAGG - Exonic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136395518 16:29990717-29990739 CTGGGGCAGGGGAGGATAGTGGG + Intronic
1136430763 16:30195100-30195122 CTGGGGCGGTGGAGGCCCGAAGG - Exonic
1136504685 16:30695413-30695435 GTGGGAGAGAGGAGGGAAGATGG - Intergenic
1136736605 16:32473162-32473184 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
1137366790 16:47866540-47866562 CTCGGGCAGAGAAAGGAAGAAGG - Intergenic
1137584499 16:49656116-49656138 TTGGGGCAGTGTAGGTGAGACGG + Intronic
1137672197 16:50285524-50285546 CTGGTCCAGCGGAGGGAAGATGG - Intronic
1137699937 16:50490214-50490236 CATGGGCACTGGAGGGAGGATGG + Intergenic
1137799241 16:51247424-51247446 CTTGGGCACTGGAGAGAAGCCGG + Intergenic
1138205329 16:55120324-55120346 CTGGGGCAGGGTAGGACAGATGG - Intergenic
1138232901 16:55352289-55352311 CTGGGGCAGTGGCGCCAACAGGG + Intergenic
1138232952 16:55353056-55353078 CTGGACCAGTGGCGAGAAGAAGG - Intergenic
1138245334 16:55463020-55463042 CTGATGCAGTGGAGGAATGAAGG - Intronic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138574270 16:57897544-57897566 CTGGGGCAGAGAAGGGAGGAAGG + Intronic
1138806786 16:60099867-60099889 CTGGGGCAGTGGTGGCCACAGGG - Intergenic
1139011919 16:62645054-62645076 CTGGGGCAGTTGAGGGTATCTGG + Intergenic
1139298329 16:65922334-65922356 GTGGAGCAGTGGAGAGGAGAGGG - Intergenic
1139428148 16:66895796-66895818 CTGGGACAGGGGAGGACAGATGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139657757 16:68399339-68399361 ATGGGGCAGTGGGGGTAAGAAGG - Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140027257 16:71301829-71301851 CTGGAGCAGTGAAAGGATGAAGG + Intergenic
1140050919 16:71480286-71480308 CTGAGGCAGTGCTGGGATGAGGG - Intronic
1140354896 16:74297157-74297179 CTGGGGCAGGGGCGGGAGGCTGG - Intronic
1140648239 16:77057523-77057545 CTTGGACAGTGGTGGGAGGAGGG + Intergenic
1141480716 16:84304863-84304885 CTGGGCCACAGGAGGGCAGAGGG + Intronic
1141486289 16:84342389-84342411 CTAGGTCAGGAGAGGGAAGAGGG + Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141589063 16:85055740-85055762 CTGGGGGAGAGGTGAGAAGAAGG - Intronic
1141621313 16:85238042-85238064 TAGGGGCAGTGGAGAGAGGAGGG + Intergenic
1141743949 16:85913509-85913531 CTGGGAAAGTCCAGGGAAGAGGG + Intronic
1141772180 16:86096187-86096209 CTGGGGCAGTGGAGCAGGGATGG - Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142007636 16:87697277-87697299 CGGGGGCAGTGCCGAGAAGAGGG - Exonic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1203016463 16_KI270728v1_random:356415-356437 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203034798 16_KI270728v1_random:629573-629595 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1142480474 17:215613-215635 CGGGGGCAGGAGAGGGGAGAAGG + Intronic
1142521454 17:507667-507689 TTGGGGCTGTGGAGGGAGGGAGG + Intergenic
1142698095 17:1644495-1644517 CATGGGCAGTGGATGGAAGGGGG - Intronic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1142990754 17:3729210-3729232 ATGACGCTGTGGAGGGAAGAAGG - Intronic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143272110 17:5683474-5683496 CTGGGGCCGTGGAGGGCAGGGGG + Intergenic
1143628086 17:8122307-8122329 GTGGGGCAGCGGAGGGAGGGAGG - Intronic
1143688774 17:8542311-8542333 ATGGGGAGGTGGAGGGAAAATGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144190183 17:12838556-12838578 CGGTGGCAGTGGAGGGAATCAGG + Intronic
1144397916 17:14863169-14863191 CTGGGCAAGTGAAGGTAAGAAGG + Intergenic
1144702364 17:17347956-17347978 CTGGGGCAGGTGCGGGAAGGAGG - Intergenic
1144847280 17:18226472-18226494 CTGGAGCAGTGGGGGAAGGAAGG - Intronic
1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG + Intergenic
1146724839 17:35148434-35148456 CTGGGGCAGGGCAGGGCACAGGG + Intronic
1146739579 17:35270771-35270793 CTGGGGTAGGGGAGGGAGGGTGG - Exonic
1146910668 17:36646485-36646507 CTGGGGAAGAGGGTGGAAGAGGG + Intergenic
1147311821 17:39600022-39600044 CTAGGGCAGGGAAGGGAAGCTGG - Intergenic
1147581074 17:41627476-41627498 GTGGGGCAGGGGAAGGAAGGTGG - Intergenic
1147689103 17:42304666-42304688 CTGGAGCAGTGGGGGCAGGAGGG - Intronic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148785837 17:50145835-50145857 TTGGAGCAGGGGAGGGAAGCAGG + Intronic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1148874950 17:50681558-50681580 ATGGGGCAGTGGAGTGCAGGGGG - Intronic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149232148 17:54546951-54546973 CTGGGGCAGGGGTGGGAAAATGG - Intergenic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1149685671 17:58533153-58533175 CTCAGCCAGGGGAGGGAAGAGGG + Intronic
1149862471 17:60130411-60130433 GTGGGGCGGGGGTGGGAAGAGGG - Intergenic
1150122434 17:62615432-62615454 ATGGGGTGGGGGAGGGAAGAAGG + Intronic
1150529947 17:65966958-65966980 CTGGGGCAGTGTCTAGAAGATGG + Intronic
1150530605 17:65977552-65977574 ATGTGGCAGAGAAGGGAAGATGG + Intronic
1150824367 17:68461731-68461753 CTGGGACAATGGAGCCAAGAGGG + Intergenic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151413827 17:73948464-73948486 CTGGGGCAGTGGTGGGGTGTCGG + Intergenic
1151820628 17:76494888-76494910 TTGGGGCAATGAAGGGAAGGGGG + Intronic
1152022182 17:77785862-77785884 CTGGGCCAGGGGAGAGAAGCTGG + Intergenic
1152163694 17:78686713-78686735 CAAAGGCAGGGGAGGGAAGATGG + Intronic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152213937 17:79021311-79021333 CTTGGGAAGAGGAGGGAAGGAGG - Intergenic
1152329005 17:79659823-79659845 GGGGGGAAGGGGAGGGAAGAGGG - Intergenic
1152574704 17:81134865-81134887 CTGGGGCTGGGAAGGGAACATGG + Intronic
1152596522 17:81240320-81240342 CTGGGGCCGGGTAGGGATGAAGG - Intronic
1152800778 17:82329791-82329813 GGGGGGCAGTGGTGGGGAGATGG - Intronic
1152817200 17:82415023-82415045 CTGGGGCACAGGACGGCAGAAGG + Intronic
1203159869 17_GL000205v2_random:39285-39307 GTGGGGAAGCGGAGGGACGAGGG - Intergenic
1153147582 18:2051246-2051268 CTGGGGCAGAGGAGTCAAGCGGG - Intergenic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1155010025 18:21767914-21767936 CGGGGGCAGTGGGGGGAGCAGGG - Intronic
1155173037 18:23281112-23281134 CTAGGTCAGTGGAGGGGAGGAGG + Intronic
1155241780 18:23870820-23870842 CAGGGGCTGGGGAGGGAAAAAGG + Intronic
1155957038 18:31962931-31962953 CAGGGACAGTGCAGGGCAGAAGG + Intergenic
1156114105 18:33766486-33766508 ATGGGGCTTTGGAAGGAAGAAGG + Intergenic
1156232900 18:35172236-35172258 CTGGGGCAGTGGCAGGAGCATGG - Intergenic
1156536447 18:37869194-37869216 CTAGGTCATTGGAGGGAGGAGGG + Intergenic
1157192051 18:45589828-45589850 CTGGGGCAGGGAGGGGAGGAGGG + Intronic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1159347195 18:67221465-67221487 GTGGGGCGGTGAAGGGAAGGAGG - Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159691967 18:71499767-71499789 CTGGGGCAGGCGAGGGGAAATGG + Intergenic
1160267615 18:77353823-77353845 TTGGGGAAGTGGAGGAAAGCCGG + Intergenic
1160779648 19:872144-872166 CTGGGGCGGCGGGGGGCAGATGG + Intronic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1160945978 19:1644286-1644308 CTGGGGGAGTGGAGGCAATGAGG + Intronic
1160975533 19:1790549-1790571 GAGGGGCAGTGGAGGGAGAAGGG - Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161236950 19:3202928-3202950 CCGGGGCAGATGTGGGAAGATGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161926154 19:7301679-7301701 CTGGGGCTGGGGAGGGGAGGTGG - Intergenic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1161983648 19:7642960-7642982 CTGGGGAAGTAGGGGGAAGAGGG - Intronic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162778918 19:12996511-12996533 GAGGGGCAGGGGAGGGGAGAGGG + Intronic
1162793311 19:13074050-13074072 TGGGGGGAGTGGAGAGAAGATGG - Intronic
1163077521 19:14907880-14907902 CTGGGGCAGTTGAGGGAGAAGGG + Intergenic
1163202689 19:15779974-15779996 CAGGGACAGTGGAGAGAAGCAGG + Intergenic
1163237539 19:16038243-16038265 CTGGGGCAGTTGATAGTAGAGGG - Intergenic
1163251239 19:16127590-16127612 CTGGGGCAGAGGAGGGACAGGGG - Intronic
1163709120 19:18835100-18835122 CAGGGGCTGTGGAGGTAGGACGG - Intronic
1163817445 19:19475483-19475505 CTGGGGCAGTGGAGGGGGGGGGG - Intronic
1163828326 19:19535913-19535935 CTGGGCCAGGGGTGGGCAGAGGG - Exonic
1164404110 19:27927162-27927184 GTGAGGCAGTGGAGAGAGGAAGG + Intergenic
1164686216 19:30168392-30168414 CAGGGGGCGTGTAGGGAAGAGGG - Intergenic
1164721269 19:30433319-30433341 TTGGGGAAGTGGGGGGAAGATGG - Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164907240 19:31977437-31977459 ATGGGGCAGTGGTGGTCAGAGGG - Intergenic
1164972891 19:32547702-32547724 CTAGGGCAGAGTAGGGGAGATGG - Intergenic
1165282615 19:34810038-34810060 CGGGGGTGGTGGAGGGGAGAAGG - Intergenic
1165442652 19:35839237-35839259 CTGGGGTAGTGATGGGAAGCTGG + Exonic
1165868342 19:38952863-38952885 GTGGGGCACTGGAGGGAATGAGG - Intronic
1166132056 19:40751531-40751553 CGGGTGCAGGGGACGGAAGAGGG - Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166529429 19:43533800-43533822 ATGGGGCCGTGGAGGATAGAGGG - Exonic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1166698499 19:44867965-44867987 ATGAGGCAGTGGGGGGCAGAGGG + Intronic
1166756035 19:45192186-45192208 CTGGGGCAGTGGTGGCCACAGGG - Intronic
1166853042 19:45769415-45769437 CAGGCGCAGTGGAAGGAGGATGG + Intergenic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167148133 19:47694674-47694696 CTGGGGCAGCGCTGGGAAGGGGG - Exonic
1167266615 19:48485931-48485953 CTGGAGCAGAGGGGAGAAGAGGG - Intronic
1167293272 19:48635875-48635897 CTGGGGCAGTGGTGGGCGGAGGG - Exonic
1167603455 19:50467511-50467533 GTGGGGCAGCAGAGGGCAGAGGG - Intronic
1167633476 19:50639751-50639773 CTGGGGCTGTGGCAGGAGGAGGG + Intronic
1167729688 19:51244665-51244687 CTGGGGAAGAGGAGTCAAGATGG - Intergenic
1167764277 19:51469796-51469818 CTGGGACAGTGAAAAGAAGAAGG + Intergenic
1167772959 19:51532090-51532112 CTGGGACAGTGAAAGGAAGAAGG + Intergenic
1167898158 19:52598414-52598436 CTGGGGCAGGGTGGGGGAGAGGG + Intronic
1167922515 19:52793514-52793536 CTGGAGCAGTGGAAGAGAGAAGG + Intronic
1167933812 19:52890431-52890453 CTGGGGCAGTGGGCAGCAGAGGG - Intronic
1167941043 19:52946151-52946173 CTGGGGCAGGGCGGGGGAGAGGG - Intronic
1168011000 19:53532238-53532260 CTGGGACAGGGGTGGGAATAGGG - Intronic
1168115424 19:54219563-54219585 CTGGGGCAGGGGAGGGGAGCAGG - Intronic
1168121253 19:54253785-54253807 CTGGGGCAGGGGAGGGGAGCAGG - Intronic
1168181551 19:54665464-54665486 CTGGGGCAGGGGAGGGGAGCAGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1202654183 1_KI270708v1_random:3443-3465 CTGGGGCAGTGGTGGGGAAGTGG + Intergenic
924963619 2:56925-56947 CAGGGGCTGTGGTGGGAAGTGGG + Intergenic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925309488 2:2872336-2872358 CTGGGGAAGGGGAGGGGACAAGG - Intergenic
925689373 2:6505618-6505640 GTGGGGTAGAGGAGGGAAGAGGG - Intergenic
926113743 2:10198068-10198090 ATGGGCCTGGGGAGGGAAGAGGG - Intronic
926163105 2:10501873-10501895 CAGGCCCAGTGGAGGGAAGGAGG - Intergenic
926314711 2:11700839-11700861 CTGGGGAGGTGGAGGGATGTGGG - Intronic
926515057 2:13832974-13832996 CTGGGGCAGGGGTGGGGGGAGGG + Intergenic
926622624 2:15060615-15060637 CTGGGTCAGTGCAGGGAGGATGG + Intergenic
926832835 2:16982254-16982276 CTGGGACAGAGAAGGGAAAATGG - Intergenic
927002419 2:18811943-18811965 TTGGAGAAGTGGAGGGGAGAGGG + Intergenic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
927864596 2:26580452-26580474 CTGGGGCAGGGGTGGGACGGGGG + Intergenic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929437665 2:41940701-41940723 CTGGGGCAGTGGGGGGTGGGGGG - Intronic
929510452 2:42562406-42562428 GTGGGGAGGGGGAGGGAAGATGG - Intronic
929567707 2:43000058-43000080 GTGGGGCAGTGGAGGGGGGGTGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929630080 2:43450931-43450953 CTGGGGCACTGGAGGAAAAGGGG + Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
930873633 2:56190825-56190847 CTGGGGTAGGGGAGGAAAGAAGG - Intronic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931799825 2:65747672-65747694 GTAGGGCAGGGGAGGGAGGAAGG + Intergenic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
932216506 2:69969640-69969662 CTGGGGCAGTGGGGAGAGGATGG - Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
933239083 2:79898979-79899001 CTGGGCAAGTGAAGGGAAGGAGG + Intronic
933809530 2:86024351-86024373 CTGGGGAGGTGGAAGGAATAGGG + Exonic
934187759 2:89762279-89762301 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
934308858 2:91845669-91845691 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
934578037 2:95415274-95415296 CTGGGGCAGTGGCTGGACCAAGG - Exonic
934601401 2:95661428-95661450 CTGGGGCAGTGGCTGGACCAAGG + Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934852887 2:97712670-97712692 TTGGGGCACTAGAGGGGAGATGG + Intergenic
935656660 2:105429134-105429156 TTGTGGCAGTGGAGGGAGGGTGG - Intronic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
936600529 2:113890355-113890377 CTGAGGCGGAGGAAGGAAGATGG + Intronic
937044645 2:118844780-118844802 CTTGGGCAGTTGGGGGAGGAGGG - Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937091468 2:119209252-119209274 CTGGGGGAGTGAAGTGGAGAAGG - Intergenic
937094437 2:119226221-119226243 CTGGGGCAAGGGAAGGAAGCAGG + Intronic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937495362 2:122413489-122413511 TTGGGTCAGTGGAGAGAAAATGG + Intergenic
937514465 2:122637864-122637886 ATGGGGCAGTGGAGTGAAGAGGG + Intergenic
937900680 2:127016717-127016739 ATGGGGCTGCGGAGGGGAGAAGG - Intergenic
937977927 2:127593036-127593058 CTGGGGCCGGGGAGGGCAGCGGG - Intronic
938014698 2:127857884-127857906 GTGGGGCTGGGGAGGGAACATGG - Intronic
938256896 2:129866203-129866225 GTGGGGCAGTGGAAGGAATGTGG - Intergenic
938548890 2:132361313-132361335 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
938555855 2:132423620-132423642 CTGGGGAAGGGGATGGAAGTGGG - Intronic
940182090 2:150946050-150946072 CTTGGGCAGTGGAGGTAGGTGGG - Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
941889812 2:170568304-170568326 CAGGGGCAGAGTATGGAAGAAGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942117591 2:172743362-172743384 CTGGGGCAGGGGAAGCAAGAGGG - Intronic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
943236542 2:185328269-185328291 GGGGTGCAGTGGAAGGAAGATGG - Intergenic
944155613 2:196604270-196604292 CTGGGGCAGTGGAAGGGGCATGG - Intergenic
944306573 2:198186469-198186491 CTGGAGCAGGGCAGAGAAGAAGG - Intronic
945931905 2:215863856-215863878 ATGGGGCAGTGGAACTAAGAGGG - Intergenic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946413115 2:219525634-219525656 CAGGTGCAGAGGAAGGAAGATGG - Intronic
946419415 2:219556578-219556600 CTGGGGCCCTGGAGTGACGACGG + Exonic
947721002 2:232369270-232369292 CTTGGGCAGAGGAGGGCAGTGGG - Intergenic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947851673 2:233293490-233293512 CTAGGTCAGTGGAGAGAAGCTGG + Intronic
947903771 2:233744292-233744314 CTCGGCCACAGGAGGGAAGAGGG + Intronic
947905160 2:233755643-233755665 CTCGGCCACAGGAGGGAAGAGGG + Intronic
948540236 2:238686082-238686104 ATGGGGCTGTGGAGGGAGAAAGG - Intergenic
948757947 2:240170032-240170054 CTGGGGCAGAGGTGGGAGAAGGG - Intergenic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
948874920 2:240821056-240821078 CTGGGACGGTGGAGGGAGGACGG - Intergenic
948903636 2:240967879-240967901 GTGAGGCAGTGGGGGGCAGAAGG - Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
949023744 2:241755364-241755386 GTGGGGCAGGGTAGGGAAGGGGG - Intronic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169826111 20:9770544-9770566 CTGGGTGAGTGTAGGCAAGATGG + Intronic
1170182615 20:13549208-13549230 CTTGAGGAGTGGAGGGAATAGGG - Intronic
1170272068 20:14538344-14538366 CTGGAGCAATGGAGGAGAGATGG + Intronic
1170709654 20:18778872-18778894 CTGTCACAGTGGAGGGAAGTAGG + Intergenic
1170796470 20:19551816-19551838 TCCGGGCAGTGGAGGGAAGGAGG - Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171772060 20:29330481-29330503 CTCGGTCAGTGGAGCCAAGAGGG + Intergenic
1171814024 20:29767696-29767718 CTTGGTCAGTGGAGCCAAGAGGG + Intergenic
1171877713 20:30593840-30593862 GTGGGGAAGGGGAGGGACGAAGG + Intergenic
1171971560 20:31568250-31568272 CCGGGGCAGTAGGGGGAAGCGGG - Intronic
1172156643 20:32830477-32830499 CTGGGACACTGGAAGAAAGATGG - Intronic
1172186913 20:33036625-33036647 CTAGGGCTGTGGAGGGAGGGAGG + Intronic
1172292089 20:33783981-33784003 ATGGAGAAGTGGAGGGAAAAGGG - Intronic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1173251660 20:41366837-41366859 CTGGGGCCGCGGAGGGGAGGCGG + Intergenic
1173362097 20:42353947-42353969 CAGGGGCTGAGGTGGGAAGATGG + Intronic
1173441762 20:43083798-43083820 CTGGGGTAGGGGTGGGAACAGGG - Intronic
1173521138 20:43701232-43701254 ACGGAGCAGAGGAGGGAAGATGG - Intronic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1173531261 20:43771575-43771597 CAGGGGCAGTGGAGGAAAGGGGG - Intergenic
1173688648 20:44941879-44941901 TTGATGCAGTGGAGGGAAGGGGG - Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1174543619 20:51308496-51308518 CAGGTCCAGGGGAGGGAAGAAGG + Intergenic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174910789 20:54605484-54605506 TTGGGGAGGTGGTGGGAAGAGGG - Intronic
1175124814 20:56743292-56743314 GTGGGGCTGAGGCGGGAAGATGG - Intergenic
1175259750 20:57667069-57667091 ATGGGCCTGTGGAGTGAAGATGG + Intronic
1175519160 20:59588623-59588645 GTGGGGCAGTACCGGGAAGATGG - Intronic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176062873 20:63179898-63179920 CTGGGGTGGGGGTGGGAAGATGG - Intergenic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1176633462 21:9162978-9163000 CTGGGGCAGTGGTGGGGAAGCGG - Intergenic
1176996182 21:15558056-15558078 CTGGCAAAGTGAAGGGAAGATGG - Intergenic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179104094 21:38383271-38383293 CTGGGGCTGGGGAAGGAAGCCGG - Exonic
1179178020 21:39022687-39022709 CTGGGGCATTGGAGGGATTAGGG - Intergenic
1179226235 21:39455714-39455736 CCAGGCCAGAGGAGGGAAGAGGG - Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179400261 21:41076575-41076597 GTGGGCCAGAGGAAGGAAGAGGG - Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179457137 21:41507711-41507733 CGGGGGCCGTGGAGGGCAGGCGG + Intronic
1179673208 21:42964210-42964232 GTGGGGTAGGGGAGAGAAGAGGG - Intergenic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1180081654 21:45490119-45490141 CAGGGGCTGTGGAGGGATGGAGG - Intronic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180317477 22:11288298-11288320 CTTGGTCAGTGGAGCCAAGAGGG + Intergenic
1180389315 22:12210990-12211012 CTGGGGCAGTGGTGGGGAAGTGG - Intergenic
1180416624 22:12723486-12723508 CTGGGGCAGTGGTGGGGAAGTGG + Intergenic
1180535941 22:16392757-16392779 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1180692862 22:17731985-17732007 GTGGGGCTGTGGAGTGAAGTAGG + Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181038086 22:20179425-20179447 GTGGGGCAGGGGAGGGGAGGTGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182166309 22:28177847-28177869 TTGGGGGAGTGGAGGACAGATGG + Intronic
1182435364 22:30326534-30326556 GTGGGGCAGGGGAGGGAACGGGG + Intronic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182557357 22:31136527-31136549 CTGGGGCAGCAGGGGGTAGAGGG + Intronic
1183306599 22:37086242-37086264 CTGGGGCAGGGGAGGGGTGGTGG - Intronic
1183492955 22:38126555-38126577 CAGGGGGAGTGGGGGGATGAGGG - Intronic
1183945845 22:41325260-41325282 CTGGGGCTGTGGCTGGAAGTGGG + Intronic
1183950091 22:41347932-41347954 CTGGGTCAGAGGAGTGAGGAAGG - Intronic
1184152250 22:42645979-42646001 CAGGAGCAGTGGAGGGGCGAAGG + Intronic
1184392525 22:44212694-44212716 CTTGGGCAGTGGTGAGCAGAGGG + Intronic
1184648953 22:45910919-45910941 CTGGAGCAGGGGACAGAAGAGGG - Intergenic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185076865 22:48687809-48687831 CTGGGGCAGCCCAGGGAAGGTGG - Intronic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
950026478 3:9823693-9823715 CTGGGGCAGTGCCAGGAACAGGG - Intronic
950199159 3:11030642-11030664 CTGAGGCATTTGAGGGACGAGGG + Intronic
950391476 3:12700232-12700254 CATGGGCAGTGGACTGAAGAAGG + Intergenic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
950704167 3:14769755-14769777 TAGGGGCACTGGATGGAAGAGGG + Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
951310382 3:21117859-21117881 CTGCTGCAGGGGTGGGAAGATGG + Intergenic
952368364 3:32695164-32695186 CTTGTCCAGTGGAGGGAATATGG + Intronic
952400547 3:32959450-32959472 GTGGGGCAGTGGAGCAAAGTAGG + Intergenic
952946558 3:38481536-38481558 CTGGGGAGGTGCAGGGATGAGGG + Intronic
952948362 3:38496545-38496567 CTGGGCCAGCGAAGGGAGGACGG - Intronic
953184001 3:40621317-40621339 CTTGGGCAGCAGTGGGAAGAGGG + Intergenic
953412697 3:42699146-42699168 CTGGGGCAGTCCGGGGCAGAAGG + Intronic
953451130 3:43007325-43007347 CTGGGACAGTTGAGGGCAGTGGG - Intronic
954086579 3:48249073-48249095 TTGGGGCAGAGAAGGGAATACGG - Intronic
954266219 3:49472169-49472191 CTGGTGGAGTGGCAGGAAGAGGG + Intronic
954345832 3:49998441-49998463 CTGAGGCAGTGGAGGAAGCATGG + Intronic
954374625 3:50187871-50187893 CATGGACAGTGGTGGGAAGAGGG - Exonic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
954937906 3:54343727-54343749 CTTGGGCTGTGGGGGGTAGAGGG - Intronic
955799285 3:62669292-62669314 ATGGGGCTGTGGAGGAAAGGAGG - Intronic
955972117 3:64445795-64445817 CTGGGGTAGGGGAGTGGAGATGG + Intergenic
956088207 3:65636109-65636131 CCGGGGCAGAGGGAGGAAGAGGG + Intronic
956167604 3:66408197-66408219 CTGGGGCAGGGATAGGAAGATGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
959498588 3:107079168-107079190 CTGGGGCAGAGGAAGGAGGCAGG + Intergenic
959613922 3:108326016-108326038 CTGAGGCAGTGGCAAGAAGAGGG - Intronic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
960498976 3:118412175-118412197 CTGGGGCAGTGGAGGCCATGGGG + Intergenic
960548231 3:118942861-118942883 GTGGGGCAGAGGAGGTAGGAGGG + Intronic
961169231 3:124784558-124784580 TTAAGGCAGTGGAGGGAAGATGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962372356 3:134831238-134831260 CTGGAGCAGAGGAGGGCAGCTGG + Intronic
962931350 3:140040506-140040528 CTTGGGAGGTGGAGAGAAGAAGG + Intronic
963050806 3:141141461-141141483 CTGGGGGGGTGGAGCCAAGATGG - Intronic
963744963 3:149116834-149116856 ATTGGGCAGTGGAGGAAAGGAGG - Intergenic
963940595 3:151092624-151092646 CTGGGGAAGTGGAGTGAGGGAGG + Intronic
964388028 3:156169993-156170015 CTTGGGCAGTAGAGGGAAAAAGG - Intronic
965256364 3:166418616-166418638 CTGGGGCAGGGCTGGGAGGAGGG - Intergenic
965377360 3:167941933-167941955 CTAGAGCAGGGGAGGGAAGTAGG - Intergenic
965825899 3:172729505-172729527 CGGAAGCATTGGAGGGAAGAAGG + Intergenic
965827554 3:172746033-172746055 CTCGGGCAGTGGACTGAAGGGGG + Intergenic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
965992955 3:174843245-174843267 CTGGGGAAGGGAGGGGAAGATGG - Intronic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967169837 3:186814415-186814437 CTAGGGCAGCTGAGGGAAGAAGG - Intergenic
967817981 3:193815306-193815328 CTGGGGAAGGGAAGGGAAGGGGG - Intergenic
968131813 3:196196636-196196658 CTGGGGAAGTGGAGGGGTGGGGG - Intergenic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968698923 4:2045616-2045638 TGGGGGCAGAGGAGAGAAGAGGG + Intergenic
968815887 4:2821456-2821478 CTGGGGCAGTGGAGCTAGGGTGG + Intronic
968874401 4:3257698-3257720 CGGCGGCAGTGGTGGGAGGAGGG + Intronic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
969591481 4:8124418-8124440 CAGGGGCTGCGGAGGGAAAACGG - Intronic
969639322 4:8387612-8387634 CGGGGGCTGTGGTGGGAGGAAGG + Intronic
970046145 4:11856873-11856895 CTGCTGCAGTGGAGGGCAGGAGG - Intergenic
970559103 4:17265603-17265625 ATGGGGCAGTGCAGGGGAAAAGG - Intergenic
970887869 4:21007528-21007550 CGGGGGCAGAGTAGAGAAGATGG - Intronic
971116240 4:23648795-23648817 GTGGGGAAGTGGAGAGAAAATGG - Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
972381487 4:38524278-38524300 CTGGCGCAGGGAAAGGAAGAAGG - Intergenic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975996988 4:80327231-80327253 CTGGGGCAGGGAAGGAGAGATGG + Intronic
976098863 4:81539122-81539144 CTGAGGCCTTGGAGGCAAGAAGG - Intronic
976406025 4:84660924-84660946 TGGGGGCAGTGGAGTGAACAAGG + Intergenic
976744803 4:88392068-88392090 AGGGGGGAGTGGAGGGGAGAAGG - Intronic
977343499 4:95790147-95790169 GTGGGGCAGCGGAGGTGAGATGG + Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979306855 4:119155580-119155602 GTGGGGCTGAGGAGGGCAGAGGG + Intronic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979433644 4:120662876-120662898 CTGGGGCAGGGGATGGGAGGAGG - Intergenic
979677845 4:123429196-123429218 TAGGGTAAGTGGAGGGAAGATGG + Intergenic
980516313 4:133867098-133867120 CTGGGGTAGTGAAGAGAAGGTGG - Intergenic
981113744 4:140965750-140965772 GTGGGGGAGTGGAGAGAAAATGG + Intronic
981522388 4:145676722-145676744 CTGGGGCAATGGTGGGAGGCAGG - Intergenic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984709290 4:182871767-182871789 CTGGGGAAGTGGTGGGGAGGTGG - Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
986009049 5:3695443-3695465 TGGGGGAGGTGGAGGGAAGAAGG - Intergenic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
986618301 5:9643053-9643075 CTGGGGTATGGGAGGGAAGGAGG - Intronic
986710239 5:10483376-10483398 CTGGGGCAGTGGGGTGAGGTTGG + Intergenic
986756378 5:10840137-10840159 TTTGGAAAGTGGAGGGAAGAAGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987294878 5:16541020-16541042 CTGGGGCAGTGCAGCGACCAAGG - Intronic
987351467 5:17025896-17025918 TTGGGGGAGGGGAGGGGAGAGGG + Intergenic
988067846 5:26245152-26245174 CTGGGGCTGTGGATGGAAACTGG - Intergenic
988376280 5:30439666-30439688 CTGGGGCAGTGGTGGCCACAGGG + Intergenic
988921432 5:35946251-35946273 CAGGGGCCGTGGAGCCAAGAAGG - Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989685658 5:44083762-44083784 CTAAGGAAGTGGAGGCAAGATGG - Intergenic
990047889 5:51457168-51457190 GAGGGGCAGTGGAGGGAGGGAGG - Intergenic
990395071 5:55369509-55369531 CTGGTACAGTGGAGGATAGAGGG + Intronic
990625282 5:57603871-57603893 CTGAGGCAGTGAAGGATAGAGGG + Intergenic
990731271 5:58811789-58811811 GTGGTGCAGTGGAGGGAGGGTGG - Intronic
990774261 5:59287291-59287313 CTGGGGCAGTGGTGGCCACAGGG + Intronic
991666759 5:69006981-69007003 GAGGGGCACAGGAGGGAAGAAGG + Intergenic
992025066 5:72662159-72662181 CTGGGTCTGTGGAGGGCAGTGGG - Intergenic
992219636 5:74558945-74558967 TTGGTGGAGTGGAGGGAAGGGGG + Intergenic
992528034 5:77630388-77630410 CTGGGGCCGGGGAGGGAGGCGGG + Exonic
992648402 5:78833549-78833571 GGGAGGCAGTGGAGGGAGGAAGG + Intronic
992696805 5:79297363-79297385 ATGGAGCAGTGCAGGGAAGGTGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994901036 5:105769495-105769517 GTGGGGCGGGGGAGGGGAGAGGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995319994 5:110823713-110823735 GTCTGCCAGTGGAGGGAAGATGG - Intergenic
996500137 5:124207530-124207552 TAGGGGCAGGGAAGGGAAGAGGG + Intergenic
997281548 5:132651150-132651172 CTGGGTAAGTGGAGGGGATATGG + Intergenic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997583096 5:135029322-135029344 CTGGGGGAGGGGACGGGAGAAGG + Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
997656355 5:135557653-135557675 CTGCTGCAGTGGAGAGAGGATGG + Intergenic
997836227 5:137195537-137195559 CTGGGGCAGTGGATGAAGGATGG + Intronic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
998153646 5:139771777-139771799 CTGGGGCAGTGTAGCGCATATGG + Intergenic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999443062 5:151617369-151617391 CTGGGCCTGTGGAGGAAGGAAGG + Intergenic
999492390 5:152063930-152063952 CCAGGGCAGGGAAGGGAAGATGG + Intergenic
999673230 5:153975425-153975447 CTGGGACAGTGAAGGAAACATGG + Intergenic
1000109681 5:158095943-158095965 GTGGGGGAGTGGAAAGAAGATGG + Intergenic
1000169148 5:158684630-158684652 CTGGGCCCGTGGAGTGAAGGTGG + Intergenic
1000193754 5:158938340-158938362 CTGGAGCAGAGGAGGGGAGGAGG - Intronic
1001132278 5:169074096-169074118 CTGGGGCAGTGGTGGATGGAGGG + Intronic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001581728 5:172803135-172803157 CTGGAGCACTGTTGGGAAGAGGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002061876 5:176630186-176630208 CTGGGGAAGGGGATGGAAAATGG - Intronic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1002172833 5:177385002-177385024 CTGGGGCAGTGCGGGGACAAGGG + Intronic
1002204475 5:177553634-177553656 GCGGAGCAGGGGAGGGAAGAAGG + Intronic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002355651 5:178626993-178627015 CAGCGGCCGAGGAGGGAAGACGG - Exonic
1002875268 6:1204404-1204426 TTGGGTCAGTGGATGGAAAATGG + Intergenic
1002945410 6:1756675-1756697 CTGGGGCAGTGGGGCCAAGATGG + Intronic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003516171 6:6820892-6820914 CAGGGGCAATGCAGGGGAGAGGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004513520 6:16302530-16302552 CTGGGGCAGAGGGGGGAGGGAGG - Exonic
1005407129 6:25501290-25501312 CTTGGGGAGGGGAAGGAAGATGG - Intronic
1005460951 6:26070026-26070048 CTTAGGCAGTGGAGAGAAGGAGG + Intergenic
1005473466 6:26184643-26184665 GTGAGGCGGTAGAGGGAAGAGGG - Intergenic
1005475747 6:26205955-26205977 CTGTGGCAGTGAAGGGGAGCTGG - Intergenic
1005495387 6:26383494-26383516 AGGGGGAAGTGGAGGGACGAGGG + Intronic
1005759442 6:28954263-28954285 CTGGGGCAGGGGTGGGAACAAGG - Intergenic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006002856 6:30979449-30979471 TTGGTGCAGAGGAGGGTAGAGGG + Intergenic
1006072501 6:31507632-31507654 CTGGGACAGGGGATGGAAGCTGG + Intronic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006107736 6:31726955-31726977 TGGGGTCAGTGCAGGGAAGAAGG - Intergenic
1006193693 6:32224180-32224202 CTGGGGAAGTAGGGGGAAGTAGG + Intergenic
1006209197 6:32378868-32378890 CTGGGGAAGTGGGGCGAATATGG + Intergenic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006517313 6:34552191-34552213 CTGGAGGAGGGTAGGGAAGAGGG - Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1009750114 6:67871337-67871359 CTGGGGCAGTCTGGGGAGGAGGG - Intergenic
1009750399 6:67873024-67873046 CTGGGGCAGTCTGGGGAGGAGGG + Intergenic
1010977588 6:82333241-82333263 GTGTGGCAGTGGAGGGGTGAGGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011997623 6:93613120-93613142 GTGGGGCGGTGGGGGGAAGAGGG + Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1014474933 6:121860388-121860410 CTGGGGCAGAGGAGAGAGGCAGG + Intergenic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014657281 6:124123298-124123320 CTAGAGCATTGGAGGGGAGAAGG + Intronic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1014858715 6:126436056-126436078 CGGGGTCAGTGTAGGTAAGAAGG + Intergenic
1015440540 6:133241760-133241782 CTGGGGCGGGGGTTGGAAGAAGG - Intronic
1015843655 6:137496905-137496927 CGGGGGGAGGGGAGGGAAGGAGG + Intergenic
1016646203 6:146411379-146411401 CTGGAGCAGAGGAAGTAAGAAGG + Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017196705 6:151709130-151709152 CTGGGGCAGTGTCGGGCAGAGGG - Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017627084 6:156359629-156359651 CTGGCAAAGAGGAGGGAAGATGG - Intergenic
1017802526 6:157910623-157910645 CTGGGGGAGGGGAGGGAATGTGG - Intronic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019266745 7:121470-121492 GGGGAGCAGAGGAGGGAAGATGG + Intergenic
1019314257 7:377246-377268 CTGGGGCAGTGGATGGAAGGGGG + Intergenic
1019406383 7:886250-886272 CTGGGGCTGTGGGTGGCAGAGGG + Intronic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019477746 7:1252132-1252154 CCGGGGCAGGGGAGGGGAAAGGG - Intergenic
1019567535 7:1691870-1691892 CTCGGGCGGTGTGGGGAAGAAGG + Intronic
1019698894 7:2463077-2463099 CAGGGGCAGGGGAGGGAATGGGG + Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020012715 7:4815445-4815467 AGGGGCCTGTGGAGGGAAGAAGG + Exonic
1020013581 7:4818791-4818813 GCGGGGCACTGGTGGGAAGAGGG + Intronic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1021196297 7:17678240-17678262 TTGGGGCATGGGAGTGAAGAAGG + Intergenic
1021245174 7:18252912-18252934 CTGGGGTGGAGGATGGAAGAGGG - Intronic
1021451044 7:20784394-20784416 CTCGGGCAGCGGCGGCAAGAAGG - Exonic
1021572284 7:22078282-22078304 ATGGGGCCGTGGTGGGAAGGAGG + Intergenic
1021900802 7:25283262-25283284 GATGGGCATTGGAGGGAAGATGG + Intergenic
1021932647 7:25596996-25597018 ATGGGCCAGAGGTGGGAAGAGGG - Intergenic
1022132981 7:27421176-27421198 CTGGGGAAGTCTCGGGAAGAAGG + Intergenic
1022171797 7:27838607-27838629 CTTGGGTACTGGAGAGAAGAGGG - Intronic
1022198662 7:28094854-28094876 TGAGGGCAGTGGAGGAAAGAGGG - Intronic
1022490518 7:30813906-30813928 ATGGGGCAGTGTAGGGTGGAAGG + Intronic
1022518025 7:30988022-30988044 CTGGGGCAGAGGTGGGATGCAGG + Intronic
1023630351 7:42157458-42157480 CTGGGGCTGTGGTGTGAGGAAGG - Intronic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1023779381 7:43641979-43642001 CAGGGGCAGGGGAGGGAATTGGG + Intronic
1023780416 7:43650189-43650211 CTGGGACAGGGGTGGGCAGATGG + Exonic
1024189428 7:46990672-46990694 CAGGGGCTGGGGAGGGAAAATGG + Intergenic
1024562389 7:50655557-50655579 CTAGGGCAGTGGAGTGAAGTTGG - Intronic
1024578483 7:50782998-50783020 AGGAGGCAGTGGAGGGAACAAGG - Intronic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1026539819 7:71269817-71269839 CTGGGGGAGGTGATGGAAGACGG + Intronic
1026618914 7:71933167-71933189 CTGGCAAAGAGGAGGGAAGATGG - Intronic
1026739031 7:72966977-72966999 CTGGGGAAGGGGAGGAGAGAAGG - Intronic
1026828894 7:73599961-73599983 CTGGGGCTGGGGAGGGGAGGGGG - Intronic
1026850428 7:73719893-73719915 CTGGGGCAGAGGAGGCAGCAGGG - Intergenic
1027104702 7:75398096-75398118 CTGGGGAAGGGGAGGAGAGAAGG + Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1028458329 7:91062530-91062552 CTGGGGGAGTGGAGCCAAGATGG - Intronic
1029098367 7:98107080-98107102 CTGAGGCAGCGGAGGGAGGCAGG + Exonic
1029371066 7:100151018-100151040 CTGGGCAAGTGGTGGTAAGAAGG + Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030288065 7:107847140-107847162 GTGGGGCAGGGGTGGGAGGATGG + Intergenic
1030881519 7:114886211-114886233 ATGATGCAGGGGAGGGAAGAAGG + Intergenic
1031016999 7:116586018-116586040 CTGGGGCAGTTTAGGGCAGTGGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031986127 7:128165955-128165977 CAGGGGCAGGGGCAGGAAGAGGG + Intergenic
1032475131 7:132206701-132206723 CTGGGGCAGGGTAGGGGAAAGGG + Intronic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034803882 7:154071432-154071454 CCAGGGCAGTGGAAGGAATACGG - Intronic
1034823675 7:154240485-154240507 CTGAGGCATGGGATGGAAGATGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1035050158 7:155994149-155994171 GTGGGGCAGGAGTGGGAAGAGGG - Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035524042 8:298439-298461 CTCACGCAGTGGATGGAAGATGG + Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1036930573 8:12951841-12951863 CTGCGGCCGCGGCGGGAAGAAGG + Intronic
1037924781 8:22835575-22835597 CTGGAGCACTGGAAGGAATAGGG + Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1038727646 8:30095558-30095580 CTGGGGCCGGCGGGGGAAGATGG + Intronic
1039494899 8:37973387-37973409 AGGGGGCAGTGGTGGGAAGGGGG - Intergenic
1040016198 8:42702227-42702249 CATGGGCAGAGGAAGGAAGATGG - Intronic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1041309930 8:56506266-56506288 CTGAGCCAGTGGAGGGAAAAGGG - Intergenic
1041606971 8:59793089-59793111 CTGGGGCAGTGGTGGCCACATGG + Intergenic
1041714320 8:60920480-60920502 TTGGGGTAGTGGAGGGGAGGGGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042454891 8:68989541-68989563 CTGGGCCAGTGGAGGGCTGCAGG - Intergenic
1042874761 8:73431042-73431064 CTTGGGGAGTTGTGGGAAGAAGG + Intronic
1043973832 8:86563352-86563374 ATGGGGCACTGGAGAGAAGTGGG - Intronic
1044089127 8:87977530-87977552 CTTGTCCAGTGGAGAGAAGATGG + Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044483256 8:92718082-92718104 CTGTGGCAGTGGAGAGATAATGG - Intergenic
1044503728 8:92992234-92992256 CTGGGGGAGTGGAGGAGAAATGG + Intronic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044629784 8:94267088-94267110 CTGGGCCAATGGAGGGAAGGAGG - Intergenic
1044837754 8:96312833-96312855 CTGGGGCAGAGGAAGGAAGTGGG - Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045398463 8:101785637-101785659 CTGGGTTAGTACAGGGAAGACGG + Intronic
1045482056 8:102600681-102600703 CTGGGGCAGTGGCTGAGAGACGG - Intergenic
1045864164 8:106845806-106845828 CTATGGCAGTGGAGGGTAGGGGG - Intergenic
1045944259 8:107777621-107777643 ATGGGGAAGTTGAGGGAAAATGG - Intergenic
1046088382 8:109467394-109467416 GCGGGGCAGTGGGGGGAAGGGGG - Intronic
1046742072 8:117840244-117840266 CTGGGGCAGTGCAGTCAGGAAGG + Intronic
1047292618 8:123542769-123542791 CTGGGGCCGAGGTGGGAGGATGG - Intergenic
1047731934 8:127735586-127735608 CAGGGAGAGTGGAGGAAAGAAGG - Intronic
1048281171 8:133106541-133106563 CGGGGTCAGTGGAGTGATGAGGG - Intronic
1048398904 8:134044762-134044784 CTGGGGCCGAGCATGGAAGAGGG + Intergenic
1048831544 8:138482249-138482271 GTGAGGAAGTGTAGGGAAGAGGG + Intronic
1049032961 8:140050708-140050730 TGGGGGCTGGGGAGGGAAGAAGG + Intronic
1049155292 8:141062534-141062556 ATGGGGAAGTGGAGGGATCATGG + Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049377656 8:142296665-142296687 CTAGGGCAGTCGAGGGCAGTGGG + Intronic
1049420617 8:142514937-142514959 TTGGGGCAGTGGCAGGACGAAGG + Intronic
1049589315 8:143449059-143449081 CTGGGGCTGTGCAGGGCAGTGGG + Intronic
1049595948 8:143483426-143483448 CTGGGGCAATGCAGGGGAGGTGG + Intronic
1049790878 8:144472282-144472304 CTGGGCCAGGGGTGGGGAGAAGG - Intronic
1050652446 9:7789091-7789113 CTGGGGAATTGTAGGGAATATGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051156925 9:14158359-14158381 CTGGGCCAGTGGGTGGTAGAAGG - Intronic
1051543131 9:18243733-18243755 CTGGGTCTGTGGACAGAAGATGG - Intergenic
1051667809 9:19481714-19481736 CTGGAGCAGTGGAGGGTATGTGG + Intergenic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1052290779 9:26837600-26837622 GTCGGGGAGTGGCGGGAAGAGGG + Intergenic
1052358645 9:27529966-27529988 CTGGGCCAGGGCAGTGAAGAAGG + Intergenic
1053010907 9:34632602-34632624 TGGGGGCAGTGGAGGTGAGAAGG + Intergenic
1053540147 9:38965263-38965285 CTAGGGCAGTGTGGAGAAGAGGG - Intergenic
1053752011 9:41266612-41266634 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1054257532 9:62830942-62830964 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1054333781 9:63784780-63784802 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
1054811784 9:69440913-69440935 CTGGGGGGGTGGAGCCAAGATGG - Intronic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056198659 9:84253279-84253301 ATGAGGCTGTGTAGGGAAGAGGG - Intergenic
1056628444 9:88273307-88273329 CTGGTTCACTGTAGGGAAGAGGG + Intergenic
1056832738 9:89929860-89929882 CAGGGGCAGAGGAAGGGAGAAGG + Intergenic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058382823 9:104396614-104396636 CAGGGGCAGCGAAGGGGAGATGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058618474 9:106860703-106860725 CCGGGACAGTGGAGGGACGGCGG + Intergenic
1059341691 9:113601025-113601047 CTGGGGCAGGGTGGGGAAGGAGG + Intergenic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060196710 9:121628678-121628700 CAGGGGCAGGGGAGGGAAAGCGG + Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060820986 9:126661588-126661610 CTGGGGCAGTTGGGGCAGGAGGG - Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061022667 9:128026365-128026387 CTGGGGCAGACGAGAGAGGAAGG + Intergenic
1061044463 9:128157351-128157373 GTGCTGCAGTGGAGGGTAGAGGG - Intergenic
1061116358 9:128615609-128615631 CTGGGGCAGGGGACATAAGAGGG - Intronic
1061156060 9:128862549-128862571 CTGGGGCAGGGCAGAGAAGAGGG - Intronic
1061218515 9:129235697-129235719 CTGGGACGCTGGAGGGATGAGGG - Intergenic
1061412717 9:130430018-130430040 CTGGGGCACTGAAGGGCTGAGGG + Intronic
1061416640 9:130450813-130450835 CTGGGGAAGTGGAGCCCAGAAGG - Intronic
1061539919 9:131272619-131272641 CTGGGGCAGGGGAGACAGGAAGG + Intronic
1061664885 9:132154828-132154850 CCGGGGCAGTGGGAGGCAGAGGG + Intergenic
1061675388 9:132212702-132212724 CTTGGGCACTAGAGGGAAGGAGG - Intronic
1062003355 9:134227699-134227721 CTGGGGCAGTGGAAGGCATTCGG + Intergenic
1062169972 9:135129385-135129407 CTGGGGCAGTGGGGTGGGGATGG + Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062362608 9:136194757-136194779 AAGGGGAAGGGGAGGGAAGAGGG - Intergenic
1062390080 9:136330375-136330397 CGGGGACAGGGGAGGGAGGAAGG - Intronic
1062446721 9:136598331-136598353 CTGGGGCAGTGTGGGCATGAGGG + Intergenic
1062446749 9:136598429-136598451 CTGGGGCAGTGTGGGCATGAGGG + Intergenic
1062446790 9:136598576-136598598 CTGGGGCAGTGTGGGCATGAGGG + Intergenic
1062446825 9:136598699-136598721 CTGGGGCAGTGTGGGCAGGAGGG + Intergenic
1062446839 9:136598748-136598770 CTGGGGCAGTGTGGGCAGGAGGG + Intergenic
1062448365 9:136605096-136605118 CTGGGGCAGGGGAGGGCGGCAGG + Intergenic
1062549618 9:137079979-137080001 CTGGGGCACGGGAGAGCAGAGGG - Intronic
1062551223 9:137087428-137087450 GCGGGGCGGTGGTGGGAAGAGGG + Intronic
1203756302 Un_GL000218v1:130604-130626 CTGGGGCAGTGGTGGGGAAGTGG - Intergenic
1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203365707 Un_KI270442v1:254015-254037 CTTGGTCAGTGGAGCCAAGAGGG + Intergenic
1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1185474114 X:403463-403485 CTGTGGCAGAGAAGGGAAAATGG - Intergenic
1185483948 X:468266-468288 CTGGGGCAGGGCAGGAAGGAGGG - Intergenic
1185734857 X:2488911-2488933 CTTGGGCAGCAGGGGGAAGAGGG + Exonic
1185767049 X:2733752-2733774 CTAGGACACTGCAGGGAAGAGGG - Intronic
1185850119 X:3477393-3477415 ATGGGGCCGTGGAGGAGAGAGGG - Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1186782677 X:12929083-12929105 CTGAGGCAGTAGAGGGTTGAGGG + Intergenic
1186872788 X:13789030-13789052 CTGTGCCAGTGGAGCAAAGATGG - Intronic
1187172938 X:16869793-16869815 CTGGAGGAGGGAAGGGAAGAGGG + Exonic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1189317223 X:40064600-40064622 CTGGGGGAGGGGAGACAAGAGGG + Intronic
1190030085 X:46963674-46963696 CTGGGGCAGTGGTAGGAGGTAGG + Intronic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1190723716 X:53172360-53172382 CTGGGGCACTGGAAGTAAGATGG - Intergenic
1190862889 X:54360196-54360218 GTGTGGCAGTGGTGGGAATAGGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1190984655 X:55489711-55489733 CGGGGGCAGGAGAGGGAAAAGGG - Intergenic
1192171586 X:68858896-68858918 CTGGGGCTGTGGTGAGATGACGG + Intergenic
1192216825 X:69165008-69165030 AAGGGGCCGAGGAGGGAAGAAGG + Intronic
1192888056 X:75358036-75358058 CTGGTGGAGCGGAGGGAAAATGG + Intergenic
1194184491 X:90757060-90757082 GTGTTGCAGTGGAAGGAAGAGGG + Intergenic
1194466568 X:94240995-94241017 CTGGAGGAGTTGAGGCAAGATGG - Intergenic
1195004625 X:100673514-100673536 ATGGGGCAGTGGGGAGAAGTGGG - Intergenic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195913338 X:109911620-109911642 CTGGGCCAGAGGTAGGAAGAGGG + Intergenic
1196322677 X:114360707-114360729 GTGGGAAAGTGGAGGGGAGATGG + Intergenic
1196781187 X:119385822-119385844 TGGGGGCAGTGGGGGGATGAGGG + Intergenic
1196923397 X:120607787-120607809 TTGGGGAAGTGGGGGGAGGAAGG - Intronic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198627686 X:138596856-138596878 CTGGGGCTGTGCAGGGGAAAAGG + Intergenic
1198929540 X:141838776-141838798 CTGGTGCAGAGGTGGGACGAAGG - Intronic
1199336946 X:146629437-146629459 CTGTGGCAGTGTAGGAAACATGG + Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199774666 X:151000328-151000350 CTGGGGCACTGGAGGGATTGTGG + Intergenic
1199963851 X:152801547-152801569 TTGGGGGAGAGGATGGAAGAGGG + Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1200098862 X:153678502-153678524 CTACGGCAATGGATGGAAGACGG - Intronic
1200795268 Y:7335256-7335278 CTGGGGAGGTGCAGGGAAGGGGG + Intergenic
1201169891 Y:11248228-11248250 CTGGGGCAGTGGTGGGGAAGTGG - Intergenic