ID: 1130101030

View in Genome Browser
Species Human (GRCh38)
Location 15:80894165-80894187
Sequence ACCCAGAGCCCACCATGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130101020_1130101030 25 Left 1130101020 15:80894117-80894139 CCTGGGCTGAATGCTGGGGACAA 0: 1
1: 0
2: 3
3: 28
4: 238
Right 1130101030 15:80894165-80894187 ACCCAGAGCCCACCATGCGGTGG 0: 1
1: 0
2: 0
3: 14
4: 145
1130101019_1130101030 26 Left 1130101019 15:80894116-80894138 CCCTGGGCTGAATGCTGGGGACA 0: 1
1: 1
2: 5
3: 58
4: 336
Right 1130101030 15:80894165-80894187 ACCCAGAGCCCACCATGCGGTGG 0: 1
1: 0
2: 0
3: 14
4: 145
1130101025_1130101030 -9 Left 1130101025 15:80894151-80894173 CCAGCTCCTTGCCCACCCAGAGC 0: 1
1: 0
2: 2
3: 54
4: 496
Right 1130101030 15:80894165-80894187 ACCCAGAGCCCACCATGCGGTGG 0: 1
1: 0
2: 0
3: 14
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130101030 Original CRISPR ACCCAGAGCCCACCATGCGG TGG Intronic
900101992 1:965941-965963 CCCCAGAGCCCACGATGTGGCGG - Intergenic
900249684 1:1661290-1661312 CCCCAGAGCCCACGAGGAGGGGG + Intronic
900260721 1:1727197-1727219 CCCCAGAGCCCACGAGGAGGGGG + Intronic
900552552 1:3264099-3264121 CCCCAGAGCCCACCATCCCCTGG + Intronic
900985966 1:6072926-6072948 ACCCAGAGCCCAGGATTCAGGGG + Intronic
902349988 1:15847474-15847496 ACCGAGAGCCCGCCAAGCAGCGG + Intergenic
903864813 1:26390247-26390269 GCACAGAGCCCACCCTGTGGGGG - Intergenic
911061315 1:93750679-93750701 ACCCTGAGACCACCACGCTGTGG + Intronic
919822611 1:201482462-201482484 AGCCAGAGCCCACCCTGGGCTGG + Intergenic
922768121 1:228166384-228166406 ACCCAGGGCCCAGCACCCGGGGG + Intronic
1066094772 10:32061505-32061527 ACCCTGAGACTACCATGCTGGGG + Intergenic
1067095641 10:43297765-43297787 GCCCTGAGGCCACCATGCTGGGG + Intergenic
1067577096 10:47415753-47415775 TCCCAGTGCCCACCATTTGGAGG - Intergenic
1070457812 10:76634159-76634181 ACTCAGAGCCCAGCATCCTGAGG - Intergenic
1070756959 10:78999248-78999270 ACCAAGACCCCACCAGGCTGTGG + Intergenic
1074186992 10:111106191-111106213 AGCCAGAGCCCAACATGCAAGGG + Intergenic
1075328157 10:121551341-121551363 ACCCAATGCCAACCATGCGGTGG - Exonic
1077260946 11:1619995-1620017 ACACAGAGCCCAGAATGGGGTGG - Intergenic
1077323931 11:1955351-1955373 GCCCAGATCCCACCCTGCGAGGG - Intronic
1078533731 11:12156710-12156732 CCACAGAGCCCACCATGGGCAGG - Intronic
1080613537 11:33926100-33926122 ACCCTGAGGCCACTATGCTGTGG + Intergenic
1084359037 11:68657597-68657619 ACCCACATCTCACCATGAGGTGG - Intergenic
1085205802 11:74731300-74731322 ACCCCGAGCCCACCGAGCAGGGG - Intronic
1087747383 11:101964551-101964573 ACCCAGAGCCCAGGAGGAGGAGG + Intronic
1088788948 11:113207351-113207373 TCCCAGAGCCCACCATGAGCTGG + Exonic
1088875716 11:113934641-113934663 GCCCAAAGCCCACCATCAGGAGG - Intronic
1088877051 11:113944727-113944749 ACCCAGGGCCCAACGTGCTGTGG + Exonic
1090363295 11:126187719-126187741 ACCCAGGGCCCACCTTGGGCAGG + Intergenic
1091205136 11:133815614-133815636 ACACTCAGCCCACCATGAGGTGG + Intergenic
1202806917 11_KI270721v1_random:10546-10568 GCCCAGATCCCACCCTGCGAGGG - Intergenic
1096214513 12:49791975-49791997 CCCCAGGGCCCACCTTTCGGGGG - Exonic
1097116133 12:56698680-56698702 ACCCAGAACCCAGGAGGCGGAGG - Intergenic
1099870658 12:88345389-88345411 AACCAGAGCCTAACATGCTGAGG - Intergenic
1100956633 12:99916169-99916191 ACCCAGAGCCCATCAAGGGGAGG + Intronic
1102036327 12:109772349-109772371 ACACAGACCCCACCCTGTGGAGG - Intergenic
1103049230 12:117765156-117765178 ATCCAGAGCTTACCATGCGATGG - Intronic
1105932926 13:25069324-25069346 GCCCAGGGCCCACCCTCCGGAGG + Intergenic
1109151531 13:58854081-58854103 AGCAAGAGCCCACCATGCTTGGG + Intergenic
1111838352 13:93417452-93417474 ACCCAGAAACCATCATGCAGAGG + Intronic
1113420208 13:110165229-110165251 TCCCAGAGCCCAGAATGCAGTGG - Intronic
1115548974 14:34488161-34488183 ACCCAGAGGCCACCATTAGGAGG - Intergenic
1121145432 14:91578254-91578276 TGCCGGAGCCCACCATGGGGCGG - Intergenic
1122156108 14:99751339-99751361 ACCCAGGACCCTCCATGCAGTGG - Intronic
1122578326 14:102755683-102755705 ACCCAGGGCCCTCCATGCTCGGG - Intergenic
1122693489 14:103542237-103542259 ATCCAGTGCCCTCCATGGGGAGG + Intergenic
1128081260 15:64858264-64858286 ACCCAGGGCCCTGCATGAGGAGG + Intronic
1128238046 15:66080818-66080840 ACACAGAGCCCACCGTCCCGGGG + Intronic
1128590703 15:68894325-68894347 AACCAGAGCCCAACCTGCTGGGG - Intronic
1129676936 15:77636792-77636814 ACCCACAGCCCTCCATGATGGGG + Intronic
1130101030 15:80894165-80894187 ACCCAGAGCCCACCATGCGGTGG + Intronic
1131098960 15:89673297-89673319 ACACAGAGGCCACCAGGGGGTGG + Exonic
1132835522 16:1951054-1951076 ACCCCCAGCCCACCAAGCAGGGG + Intronic
1133270690 16:4609647-4609669 ACCCAGGGCCCACCCTGCCATGG - Exonic
1134214740 16:12308266-12308288 ACCCAGAAGCCACCATGAGCAGG - Intronic
1135189362 16:20342401-20342423 CCCCAGAGCCTACCAGGCCGAGG + Intronic
1138126528 16:54443338-54443360 ACCCTGAAACCACCATGCTGGGG + Intergenic
1140931079 16:79628647-79628669 ACCCAGAGCCCAGCAGCCAGGGG - Intergenic
1142132734 16:88438285-88438307 AGCCAGAGGCCAAGATGCGGAGG + Exonic
1142227373 16:88884209-88884231 TCCCAGCCCCCACCTTGCGGAGG - Intronic
1144968241 17:19091135-19091157 CCCCAGAGCCCAGCATGGGGCGG - Intergenic
1144979676 17:19160928-19160950 CCCCAGAGCCCAGCATGGGGCGG + Intergenic
1144988546 17:19217304-19217326 CCCCAGAGCCCAGCATGGGGCGG - Intronic
1145118230 17:20231930-20231952 TTCCAGGGCCCACCATGCCGTGG - Intronic
1147209953 17:38867249-38867271 ACCCAGAACCCAGGAGGCGGGGG - Intergenic
1152239771 17:79155209-79155231 ACACAGAGCCCACAAGGTGGGGG + Intronic
1152327089 17:79647863-79647885 ACACAGAGCCCACCTGGGGGTGG + Intergenic
1152835180 17:82525251-82525273 ACCCAGAACCCAGGAGGCGGAGG - Intronic
1152994724 18:395980-396002 ACCCAGAGCACACAATGTGGTGG + Intronic
1154024909 18:10697954-10697976 ACCCAGAGCCCACATGGTGGAGG + Intronic
1156459350 18:37312979-37313001 ACACACAGCCCACCTTTCGGAGG + Intronic
1161708624 19:5834464-5834486 ACCCAGTGCCCACACTCCGGGGG - Intronic
1163628641 19:18405094-18405116 CCTCAGAGCCCACCCTGAGGTGG + Intergenic
1167114927 19:47483638-47483660 AGCCAGAGCTCACCATGTTGGGG - Intronic
1167525858 19:49983382-49983404 CCCCAGACCCCTCCAGGCGGAGG + Intronic
925491680 2:4402034-4402056 ACCCTGAGGCCACCGTGCTGTGG + Intergenic
927707320 2:25304512-25304534 ACACAGAGCCCAACATCTGGCGG + Intronic
928637936 2:33266844-33266866 ACTCAGAGCCCACCAAATGGTGG + Intronic
937281804 2:120722422-120722444 ACCCAGAGCCCCTCACCCGGGGG - Intergenic
937789400 2:125943009-125943031 CGCAAGAGCCCACCATGTGGGGG + Intergenic
941684491 2:168434520-168434542 ACTCTTAGCCCACCATCCGGTGG - Intergenic
942151062 2:173076154-173076176 ACCCAGGGCCCGCCCGGCGGCGG + Intronic
943927644 2:193806380-193806402 AGCAAGTTCCCACCATGCGGAGG - Intergenic
945271978 2:207949991-207950013 ATCCAAAGCTCACCATGCTGGGG + Intronic
946621808 2:221570613-221570635 ACCCGGAGCCCTCCAGACGGAGG - Intronic
947900690 2:233718976-233718998 TGCCAGAGGCCACCAGGCGGTGG + Exonic
947904135 2:233747368-233747390 TGCCAGAGGCCACCAGGCGGTGG + Intronic
1169769364 20:9184410-9184432 ACACAGTGTCCACCATGCTGGGG - Intronic
1171339852 20:24419376-24419398 AACCAGAGCCCCACATGCTGGGG + Intergenic
1172296780 20:33817631-33817653 AGCCAGAGCCCACCAGGAGGAGG + Intronic
1176064918 20:63189312-63189334 ACCCAGACCCCACCAGGCTGAGG + Intergenic
1178692316 21:34760294-34760316 ACCCAGAGGGGACCATGGGGAGG - Intergenic
1179508591 21:41857913-41857935 ACCCAGAGCACACCATGGCGGGG + Intronic
1179950391 21:44706143-44706165 TCCCAGTGCCCACCAACCGGCGG + Intronic
1180082646 21:45493796-45493818 CCCCTGAGCCCACCCTGCTGAGG + Intronic
1180843714 22:18970675-18970697 CGCCAGAGCCCAGCAGGCGGCGG + Intergenic
1180984001 22:19893461-19893483 ACCCGCAGCCCTCCTTGCGGCGG + Intronic
1185343249 22:50300725-50300747 ACCCAGAGCCCAGACTGCAGGGG - Intronic
951474160 3:23087468-23087490 ACCCAGGGCCCATCGTGGGGTGG - Intergenic
951524754 3:23643274-23643296 ACGCTGAGACCACCATGCTGTGG - Intergenic
952410782 3:33048133-33048155 AGCCAGAGCCCAGCATGGAGGGG + Intronic
966732495 3:183162647-183162669 GCCCAGCGCCCACCATGCCCCGG - Exonic
968691533 4:1992697-1992719 ACTCAGAGGCCACCAGGAGGCGG - Intronic
969393917 4:6908846-6908868 CCCCAGAGCCCTCCATGAGCTGG - Intergenic
971957495 4:33440462-33440484 ACCCAGAACTCATCTTGCGGAGG + Intergenic
973645249 4:52943784-52943806 ACCCTGAGCTCACCATGCAATGG + Intronic
985665909 5:1181402-1181424 TCCCAGAGCCCACCATGAGCAGG - Intergenic
985846554 5:2353981-2354003 ACTCAGATCCCACCATGCTCTGG + Intergenic
999271934 5:150301963-150301985 TCCCAGATCCCAGCATGGGGTGG + Intronic
1002938431 6:1694890-1694912 ACCCAGAGCCAACCCTGCTTTGG + Intronic
1003165164 6:3671197-3671219 ACCCAGAGCACAGTATGCTGGGG + Intergenic
1007388032 6:41532414-41532436 TCCCAGAGGCCACCCTGTGGAGG - Intergenic
1008337795 6:50327345-50327367 ACCCAGACCACATCATGCAGAGG - Intergenic
1012472571 6:99588715-99588737 ACCCAGCGCCCGCCTTGCGCTGG - Intergenic
1013864602 6:114680066-114680088 ACCCAGAACTCACCAAGCTGTGG - Intergenic
1016735634 6:147476809-147476831 ACCCAGATCCAACCATGCTCTGG + Intergenic
1017930122 6:158945003-158945025 CCCCAGAGCCTAGCATGAGGAGG - Intergenic
1020444850 7:8258219-8258241 ACTCAGACCCCACCATGCTCTGG - Intronic
1022722407 7:32953121-32953143 ACCTAGAGTCCTCCATGCTGGGG - Intergenic
1023264798 7:38393533-38393555 ACCAAGAGCCCACCACTGGGTGG - Intronic
1023938379 7:44755425-44755447 ACCCAGATTCCACCAAGTGGGGG - Intronic
1024644154 7:51357147-51357169 ACCCAGAGGTCACCATGCCCAGG - Intergenic
1026832922 7:73621387-73621409 ACCCAGAGACCAGCCTGCAGAGG - Intronic
1027927636 7:84487266-84487288 ACCAAGAGCCCCCCATGCAAAGG + Intronic
1029170234 7:98625193-98625215 CCCCAGAACCCATCATGTGGTGG + Intronic
1029530562 7:101122454-101122476 ACCCAGGGCCCACCAGTGGGTGG + Intergenic
1030356025 7:108543265-108543287 ACCCTGAGCTCACCATGCTCTGG - Intronic
1032164198 7:129532971-129532993 ACCCAGAGCCCTCCATTCATGGG + Intergenic
1033232832 7:139614994-139615016 ACCCAGAGCTCATCATGTTGTGG - Intronic
1039109196 8:34022929-34022951 TCCCAGGGCATACCATGCGGAGG - Intergenic
1041850491 8:62386015-62386037 ACACTGAGACCACCATGTGGAGG - Intronic
1047111683 8:121796602-121796624 ATTCAGTGCCCACCATGCAGTGG - Intergenic
1048061152 8:130920394-130920416 ACCAGGAGCCCCACATGCGGTGG - Intronic
1049322593 8:142004736-142004758 CTCCAGAGCTCACCCTGCGGTGG - Intergenic
1049423402 8:142526672-142526694 ACCCAGAGCCCACCCAGCCCCGG + Intronic
1049491471 8:142905490-142905512 CCCCAGCACCCACCATGCGTGGG + Intronic
1049980503 9:900042-900064 TTCCAGAGCCCACCATGTGCTGG + Intronic
1050118225 9:2282126-2282148 ACCCAGAGCCCAAGGTGCAGAGG - Intergenic
1050512999 9:6413805-6413827 ACCCACTCCCCACCATTCGGCGG - Intronic
1051369872 9:16349185-16349207 GCCCAGAGCCAACCATCCTGTGG - Intergenic
1051904107 9:22075559-22075581 ACCCAGAGCTCACAATTTGGGGG - Intergenic
1056521450 9:87405492-87405514 GCACAGAGCCCAGCATGAGGAGG + Intergenic
1056551719 9:87658408-87658430 ACACACACCCCACCATGCAGGGG - Intronic
1057189015 9:93075887-93075909 GCCCAGACCCCACCATCTGGTGG - Exonic
1057275900 9:93675834-93675856 AACCTGAGCCCACCAGGTGGGGG - Intronic
1057512683 9:95693743-95693765 ACCCTGAAGCCACCATGCTGGGG - Intergenic
1058773322 9:108260105-108260127 AGTCAGAGTCCACCATGCAGTGG - Intergenic
1060990331 9:127845288-127845310 GCCCAGAGCCCAACGTGCTGTGG - Intronic
1062472513 9:136712652-136712674 GGCCGGAGCCCACCATGCGGCGG + Exonic
1062573643 9:137196721-137196743 CCCCACAGCCCACCGTGCCGAGG + Intronic
1186735451 X:12458604-12458626 ACCCTGAGATCACCATGCTGTGG - Intronic
1189186644 X:39060713-39060735 ACCCAGAACCCACCAAACAGCGG - Intergenic
1189322995 X:40097506-40097528 GCCCAGAGCCCACCCCTCGGCGG - Intronic
1190011861 X:46791986-46792008 ATCCTGAGGCCACCATGCTGTGG + Intergenic
1190265273 X:48824285-48824307 ACCCAGGGCCCACCTGGTGGTGG - Exonic
1190681381 X:52829940-52829962 ACCCAGTCCCCCCCATGCCGAGG + Intergenic
1194584924 X:95720152-95720174 ACCCAGAGCCATGCATGTGGAGG - Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1198035844 X:132800631-132800653 CCCCAGAGCCTACCGTGCAGTGG + Intronic
1199743378 X:150756558-150756580 ACCCAGAACCAACCATGCCCTGG - Intronic
1200092960 X:153644319-153644341 GCGCAGCGCCCACCCTGCGGCGG + Intronic