ID: 1130104439

View in Genome Browser
Species Human (GRCh38)
Location 15:80918863-80918885
Sequence CTCAGAACTCAGGTCTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130104439_1130104443 11 Left 1130104439 15:80918863-80918885 CCTCTGAAGACCTGAGTTCTGAG 0: 1
1: 0
2: 0
3: 24
4: 233
Right 1130104443 15:80918897-80918919 TAGAGATACAGACACAGAAGGGG 0: 1
1: 0
2: 1
3: 67
4: 600
1130104439_1130104441 9 Left 1130104439 15:80918863-80918885 CCTCTGAAGACCTGAGTTCTGAG 0: 1
1: 0
2: 0
3: 24
4: 233
Right 1130104441 15:80918895-80918917 TTTAGAGATACAGACACAGAAGG 0: 1
1: 0
2: 6
3: 72
4: 600
1130104439_1130104444 26 Left 1130104439 15:80918863-80918885 CCTCTGAAGACCTGAGTTCTGAG 0: 1
1: 0
2: 0
3: 24
4: 233
Right 1130104444 15:80918912-80918934 AGAAGGGGCTTCAGAGATCATGG 0: 1
1: 0
2: 4
3: 25
4: 305
1130104439_1130104442 10 Left 1130104439 15:80918863-80918885 CCTCTGAAGACCTGAGTTCTGAG 0: 1
1: 0
2: 0
3: 24
4: 233
Right 1130104442 15:80918896-80918918 TTAGAGATACAGACACAGAAGGG 0: 1
1: 0
2: 6
3: 60
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130104439 Original CRISPR CTCAGAACTCAGGTCTTCAG AGG (reversed) Intronic
900405785 1:2492456-2492478 CTCAGACCTGAGGTCTGCAGGGG - Intronic
904875447 1:33651339-33651361 CTCAGAACAGAGCTCTTCTGGGG + Intronic
906163570 1:43669183-43669205 CTCAGAACTCAGATCCTCCTTGG - Exonic
907458954 1:54593957-54593979 CTCAGAGCACAGGTCCTCCGAGG - Exonic
908628070 1:66069649-66069671 CTCAGATCTCAAGTCTACTGAGG + Intronic
910899992 1:92110076-92110098 CTCATAACACAGGTCTTCCAAGG + Intronic
912683603 1:111744519-111744541 ATCAGAACTCACTTCCTCAGTGG - Intronic
913517097 1:119614001-119614023 GGCAGGGCTCAGGTCTTCAGAGG - Intergenic
915997258 1:160575909-160575931 GTGATAACTCAGGCCTTCAGTGG - Intronic
917212600 1:172645553-172645575 AGCACAACTCAAGTCTTCAGGGG - Intergenic
918565725 1:185929241-185929263 CTAAGAACACAGGACCTCAGTGG + Intronic
918680802 1:187350702-187350724 CTAAGAACTCAGGAAGTCAGAGG + Intergenic
919852293 1:201681125-201681147 CCCAGAACAGAGGCCTTCAGTGG + Intronic
920989517 1:210923346-210923368 CACAGAAGTCTGCTCTTCAGAGG - Intronic
921015386 1:211185487-211185509 CTCAGTACTGAGGTCTGAAGTGG - Intergenic
923907472 1:238401533-238401555 TTCAGTTCTCAGGCCTTCAGAGG - Intergenic
924356550 1:243183023-243183045 AGGAGATCTCAGGTCTTCAGAGG - Intronic
1064355158 10:14609997-14610019 TTCAGTATTCAGGTCATCAGGGG - Intronic
1064433265 10:15289588-15289610 CTCAGGGCTCAGGTCTGAAGAGG - Intronic
1064683993 10:17840112-17840134 CACGGACCTCAGCTCTTCAGCGG - Intronic
1066313158 10:34217975-34217997 CCCAGATGTCATGTCTTCAGAGG - Intronic
1068032141 10:51717267-51717289 CTCAGAGCTCATGTCTACACAGG - Intronic
1069874700 10:71554567-71554589 CTCTGAACCCAGGGCTGCAGGGG - Intronic
1071090283 10:81910369-81910391 CCCAGAACTCTAGTCTTCAAGGG - Intronic
1071965481 10:90847593-90847615 AGCAGAACTCAGATCATCAGAGG + Intronic
1072153117 10:92699357-92699379 CTGAGACCCCAGGTCTACAGAGG + Intergenic
1075289508 10:121216245-121216267 CTCAGAACTGAGGTCAAAAGTGG - Intergenic
1076514440 10:131035911-131035933 CTCTGACCTCTGTTCTTCAGAGG + Intergenic
1077947194 11:6912570-6912592 CACAGAAGTCAGGAATTCAGAGG - Intergenic
1080356841 11:31458621-31458643 CACAGAACTCAAGATTTCAGGGG - Intronic
1082044875 11:47716954-47716976 CTTAGACCTCAGCACTTCAGGGG + Exonic
1082118692 11:48355857-48355879 CTTAAAACTTGGGTCTTCAGGGG + Intergenic
1082255632 11:50029450-50029472 CTTAAAACTTGGGTCTTCAGGGG - Intergenic
1083766157 11:64842573-64842595 CTGAGCACTCACGCCTTCAGGGG - Intronic
1084981740 11:72832613-72832635 TTCAGAACTCTGGTGCTCAGGGG + Intronic
1085527715 11:77173810-77173832 TTTAGGACTCAGGTCTGCAGGGG + Intronic
1086961729 11:92985041-92985063 CTCAGAACTGAGGGGTCCAGAGG - Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1088682725 11:112257868-112257890 GCCAGAACTCAGGACTTCTGGGG - Intronic
1088915355 11:114223640-114223662 ATCAGAACCCATGTCTTCATGGG + Intronic
1089228182 11:116944921-116944943 TTCAAAACTCAGTTCCTCAGGGG + Intronic
1089268782 11:117286789-117286811 CTGAGTACTCAGCTCTTCAGAGG + Exonic
1090555250 11:127867606-127867628 CTAGGATCTCAGGGCTTCAGAGG - Intergenic
1090828295 11:130403292-130403314 CTCAGAAACCAGATCTGCAGAGG - Intergenic
1092302460 12:7264902-7264924 AACAGTACTCAGATCTTCAGAGG - Intergenic
1092523690 12:9296614-9296636 TTCAGAACTCAGGTCCTCTGAGG - Intergenic
1092543607 12:9435285-9435307 TTCAGAACTCAGGTCCTCTGAGG + Intergenic
1092947930 12:13474289-13474311 CTCAGAACTTAGATGGTCAGAGG - Intergenic
1093044331 12:14424739-14424761 TTCAGAAGTCAGCTCATCAGAGG - Exonic
1093367126 12:18316891-18316913 CTCAGCCCTCAGGGATTCAGGGG + Intronic
1093479947 12:19593994-19594016 CTCTGAACGCAGGTTTTCTGTGG - Intronic
1093638697 12:21501267-21501289 CTGAGAACTCGGGCCTTTAGGGG - Exonic
1094509336 12:31086766-31086788 TTCAGAACTCAGGTCCTCCGAGG - Intronic
1097520069 12:60656257-60656279 CTGTGAACTCAGGTCTCCAATGG + Intergenic
1101966725 12:109287183-109287205 CACTGGACTCAGGTCTGCAGTGG + Intronic
1102723423 12:115037288-115037310 CTCAAAATTCAGGTCTTCTAAGG + Intergenic
1102828378 12:115970812-115970834 CCCAGAAATGAGGTTTTCAGAGG + Intronic
1104364068 12:128161259-128161281 CTTAGCACTCAAGTCTGCAGAGG - Intergenic
1104941269 12:132396544-132396566 CTCAGGCCTCTGGTCATCAGTGG - Intergenic
1105255550 13:18742107-18742129 CTCAGAGCTAATGTGTTCAGAGG - Intergenic
1105293418 13:19069048-19069070 CTCAGAACTCAGGACTGTGGTGG - Intergenic
1106026902 13:25964104-25964126 CCCAGAACTCAGCTTTTCCGGGG + Intronic
1106559081 13:30833319-30833341 CTCAGTGTTCAGGTCTGCAGGGG - Intergenic
1106846485 13:33743080-33743102 TTCAGATCTCACCTCTTCAGAGG - Intergenic
1109245721 13:59952686-59952708 CTCAGAGCTAAAGTCATCAGAGG + Intronic
1111093748 13:83481760-83481782 CTCAAATTTCATGTCTTCAGAGG + Intergenic
1111988189 13:95086948-95086970 CTTAGAACACAATTCTTCAGTGG - Intronic
1112454883 13:99550599-99550621 CTAAGAACTCAAGTATTCAGGGG + Intronic
1113292615 13:108923186-108923208 CGCAGCCCCCAGGTCTTCAGGGG - Intronic
1113700083 13:112378111-112378133 CTGACAACTCAGGCCTTCCGTGG - Intronic
1114175524 14:20316313-20316335 CACAGAACTCAGTCCATCAGAGG - Exonic
1115427761 14:33280454-33280476 GTCAAAACTCAGGTCTTCCGAGG - Intronic
1116363344 14:44029103-44029125 CTAAGAAATCAGTTCTGCAGTGG + Intergenic
1117057410 14:51927151-51927173 CTCAAAAGTCAGGTCTTTTGAGG + Intronic
1118494436 14:66294368-66294390 CTCATCATGCAGGTCTTCAGAGG + Intergenic
1119436589 14:74601455-74601477 CTCAGAGGTCAGGCCCTCAGTGG - Intronic
1119817685 14:77584954-77584976 CCCAGCACTGAGGTCTGCAGGGG - Intronic
1122136165 14:99634129-99634151 CTCTGAGCTCAGGTCTCCAGGGG - Intergenic
1122283726 14:100638889-100638911 CTGAGATCTAAGGCCTTCAGGGG - Intergenic
1122315241 14:100822318-100822340 CCCAGAACTCTGGTTTTAAGGGG + Intergenic
1125258989 15:37800632-37800654 CTCAGGACCCAGGTCTCCAAAGG + Intergenic
1127071610 15:55292381-55292403 CTCAGAACTCAAGTTTTTAATGG + Intronic
1130104439 15:80918863-80918885 CTCAGAACTCAGGTCTTCAGAGG - Intronic
1130861534 15:87895065-87895087 CTCAGAACCCAGGGCTTGAAAGG + Intronic
1131802574 15:96086346-96086368 CTCAGCTCCCAGGTCTTCAGAGG + Intergenic
1131851824 15:96551650-96551672 CACAGAGCTCAGGTCCTCACTGG + Intergenic
1134019918 16:10914358-10914380 CTCAGACTTCAGGATTTCAGAGG + Intronic
1135378789 16:21975358-21975380 CTTAGAATTGAGGGCTTCAGAGG + Intronic
1137522383 16:49205460-49205482 CTCAGAGCTTTGGTCTCCAGTGG + Intergenic
1138277334 16:55745122-55745144 GTCACAACACAAGTCTTCAGAGG - Intergenic
1138283279 16:55788674-55788696 ATCACAACACAAGTCTTCAGAGG - Intergenic
1138285722 16:55808313-55808335 ATCACAACACAAGTCTTCAGAGG + Intronic
1138379202 16:56588830-56588852 CTCAGAACTCAGGTATCTAGAGG - Intergenic
1141380542 16:83572540-83572562 CTCAGTACTGAGGACTTAAGAGG - Intronic
1143499861 17:7332304-7332326 CCCTGAATTCAGGTCTGCAGCGG + Intergenic
1144233804 17:13236403-13236425 CCCAGAACTCAGGTGTTCTGAGG - Intergenic
1144589002 17:16507983-16508005 CTCAGAGCTCATGGTTTCAGAGG + Intergenic
1147319600 17:39637688-39637710 CTAAGAACTCAAGACTTCAAAGG - Intronic
1148165122 17:45478161-45478183 CACAGAACACAGGCCTTTAGCGG + Intronic
1150225246 17:63521134-63521156 CCCCAAACTCAGGTGTTCAGGGG + Intronic
1151335133 17:73435255-73435277 CTCTGGACTCAGGGCTGCAGAGG + Intronic
1151508051 17:74542225-74542247 CTCAGCTCTCAGCTCCTCAGAGG + Intronic
1151509557 17:74550013-74550035 CTCAGCTCTCAGCTCCTCAGAGG + Intergenic
1151723975 17:75874275-75874297 CCCAGAAGTGAGGTCTGCAGGGG + Exonic
1152368298 17:79870131-79870153 CTCAGAAACCAGCGCTTCAGGGG - Intergenic
1152459436 17:80433487-80433509 ATCAGAACTCAGGTCCTCGAAGG + Intronic
1153837684 18:8978688-8978710 GCCAGAACTCAGTTCTGCAGAGG - Intergenic
1154077529 18:11218507-11218529 ATTAGAACTGAGGTCTTCTGGGG + Intergenic
1154435469 18:14338497-14338519 CTCAGAGCTAATGTGTTCAGAGG + Intergenic
1155840927 18:30641485-30641507 CTCAGAACTAAGATCTAAAGAGG + Intergenic
1156307403 18:35890535-35890557 CTCAGAACTCAGCATTCCAGAGG - Intergenic
1157112903 18:44837721-44837743 CTCCTGACTCAGGTCTTTAGAGG + Intronic
1160843766 19:1157658-1157680 TTCTGAAATCAGGTCTTCAAGGG + Intronic
1161534368 19:4809907-4809929 CTAAGACCTCAGGCCTTCATTGG - Intergenic
1161555723 19:4941618-4941640 CTCAGAACTCACGTCTCATGGGG - Exonic
1161710768 19:5846630-5846652 CTCAAAACACAGGCCCTCAGGGG + Exonic
1162176945 19:8837685-8837707 CTCAGATCTCAGGTACTCTGTGG - Intronic
1163325149 19:16598721-16598743 GTCAGAAGTGAGGTCTTCAGTGG - Intronic
1163385311 19:16996494-16996516 CTCTCAACTTAGGTCCTCAGGGG + Intronic
1165164575 19:33842569-33842591 CTAAGACCTCAGAACTTCAGGGG + Intergenic
1165358437 19:35318696-35318718 CTCCGAACTCACTTCTCCAGCGG - Intergenic
1166419983 19:42629259-42629281 CTCAGGACTCATGTGTACAGAGG + Intronic
1166423778 19:42657932-42657954 CTCAGGACTCATGTGTACAGAGG - Intronic
1166849727 19:45753723-45753745 CTCAGAAGTCCTGTCTCCAGGGG + Exonic
1167206875 19:48108431-48108453 CACAGAACTCAGCTTTTTAGTGG - Intronic
925076673 2:1022376-1022398 CTGAGAACGCAGGTCCTCACGGG - Intronic
927689544 2:25198087-25198109 CTAAGAACTCAGGGGTTCAGAGG + Intergenic
930846578 2:55912215-55912237 CTGAGATCACAGGTCTTCACTGG + Intronic
932012382 2:67991532-67991554 CTCAGAACACAGGATTACAGAGG + Intergenic
933183344 2:79251659-79251681 GGCAGACCTCAGGTCTTCATCGG - Intronic
933405207 2:81849473-81849495 CTCAGGAATCAGGCCTTCACTGG - Intergenic
936635035 2:114246451-114246473 CTCAGAAATCAAGTCTCAAGGGG + Intergenic
939009793 2:136832556-136832578 CTCAGAAATCATGTCTACACTGG + Intronic
939245213 2:139614514-139614536 CTCAGAACTCAGGTCAATGGAGG - Intergenic
940169155 2:150808101-150808123 GGCAGATCTCAGGTCTTCACTGG + Intergenic
941765801 2:169295007-169295029 CTCAAAAGTCACTTCTTCAGGGG - Intronic
942432021 2:175921876-175921898 CTCACAACACAGGTGTTCAGGGG - Intergenic
942490308 2:176483312-176483334 CTCAGAACTCACATCCTCATGGG + Intergenic
942492485 2:176503775-176503797 CTCTGAAATCTGTTCTTCAGGGG - Intergenic
943854388 2:192769507-192769529 CCCAAAACTTAGGTCATCAGTGG - Intergenic
945306861 2:208266750-208266772 CTCAGAACTCATGCACTCAGAGG - Intronic
946468045 2:219929849-219929871 CTCAGTACTCAGCTCCTCTGAGG - Intergenic
946979171 2:225188168-225188190 CTCAGAAATAAGCTCTTCAATGG - Intergenic
947078169 2:226366646-226366668 CTCTGCACTCAGGGCCTCAGAGG + Intergenic
947839242 2:233197180-233197202 CTCAGAACTCAGTTCTCAGGAGG + Intronic
948347438 2:237310814-237310836 CTCAGCACTCAGGTCATCCTTGG - Intergenic
948558788 2:238836512-238836534 CTCAGACCTCAGGGTCTCAGTGG - Intergenic
948969733 2:241415640-241415662 CTCAAATGTCAGTTCTTCAGGGG - Intronic
1169288462 20:4328905-4328927 CTCAGATCTTAGGACTTCATGGG - Intergenic
1170900523 20:20457951-20457973 CTCAGCATCCAGGCCTTCAGGGG - Intronic
1172108233 20:32529250-32529272 CACACAACTCAGTTCTTCATGGG - Intronic
1173124869 20:40327202-40327224 TCCAGAGCTGAGGTCTTCAGTGG - Intergenic
1173876858 20:46378314-46378336 ATCAGGACTCAGGACTTAAGTGG - Intronic
1174102417 20:48137708-48137730 CTCATAATTCAGGTCTACAGAGG + Intergenic
1175392160 20:58634369-58634391 CCCAGGGGTCAGGTCTTCAGAGG + Intergenic
1175416750 20:58806247-58806269 CTCAGACCACAGCTCTTCAGAGG + Intergenic
1175896164 20:62336373-62336395 CCCAGAACCCAGGTTTGCAGCGG + Exonic
1176841563 21:13847136-13847158 CTCAGAGCTAATGTGTTCAGAGG - Intergenic
1179571307 21:42280410-42280432 CTCAGGAGTGAGGTCTCCAGGGG + Intronic
1181898112 22:26129082-26129104 ATCAGAAGCCAGGTCTTCAATGG - Intergenic
1182065919 22:27431585-27431607 CTCAGAGCTCAGGGTGTCAGTGG - Intergenic
1183015538 22:34983540-34983562 GACAGAACTGAGGTTTTCAGAGG - Intergenic
1183355286 22:37355531-37355553 CTCAGACCTCACCTCTGCAGCGG + Intergenic
1183586328 22:38755376-38755398 GTCAGAACTCAGGGCCTCAGAGG - Intronic
1184171959 22:42765194-42765216 ACCAGAACTGAGCTCTTCAGGGG - Intergenic
1184352181 22:43951761-43951783 CTGAGGACCCAGGTCCTCAGGGG - Intronic
950015035 3:9749470-9749492 CTGAGACCTCAGGACATCAGAGG - Intergenic
951715127 3:25634398-25634420 CTGTGATCTCAGTTCTTCAGTGG - Intronic
952523524 3:34185886-34185908 CTCAGAATTCAGTGCCTCAGGGG + Intergenic
953049334 3:39326670-39326692 GCCAGAACTCAGGTCTTCCGAGG - Intergenic
953061856 3:39434367-39434389 CTCAGTCCTCAGGTTTTCACAGG + Intergenic
953861298 3:46546121-46546143 GTCAGGATTCAGGTCTTCTGGGG + Intronic
957205374 3:77191695-77191717 GTCAGTTCTCAGGTCCTCAGAGG - Intronic
958864537 3:99485697-99485719 CACAAAACTCAGGCTTTCAGAGG + Intergenic
959118134 3:102201468-102201490 CTCAGGAGTCAGGTTTTCTGGGG + Intronic
959903980 3:111690559-111690581 CTCAGAACACTGGTCTTCAAGGG + Intronic
960196856 3:114779077-114779099 TTCAAATCTCAGGACTTCAGAGG + Intronic
960680384 3:120241761-120241783 CTCAAGACACAGGTCCTCAGGGG + Intronic
962923421 3:139971132-139971154 CTAAGACCCCAGATCTTCAGTGG - Intronic
965130170 3:164688342-164688364 CTCAGAACTCAGGGCTTAGCAGG + Intergenic
965189182 3:165506443-165506465 CACAGAAGTCAAGACTTCAGAGG - Intergenic
970310930 4:14781852-14781874 ATCAGAACTGAGGTCTCCACTGG + Intergenic
970313406 4:14806224-14806246 CTAGGAACTCATGTTTTCAGAGG + Intergenic
970541876 4:17088376-17088398 GGCAGAAGTCAGGTCTTCAAAGG - Intergenic
971011736 4:22445412-22445434 TCCAGAACTCTGGTGTTCAGTGG - Intronic
971096829 4:23416057-23416079 TTTTGAACTCAGGCCTTCAGAGG - Intergenic
971268912 4:25118833-25118855 TTCAGATCACAGGTTTTCAGGGG + Intergenic
971280194 4:25236651-25236673 CTGGTAGCTCAGGTCTTCAGAGG + Intronic
971310237 4:25519809-25519831 CTCAGACCACAGCTCTTAAGAGG + Intergenic
973031705 4:45350541-45350563 AGCAGAACTTAGGTCTTCACTGG + Intergenic
973196157 4:47444630-47444652 TTCAGATCTCAGGTAGTCAGGGG - Intergenic
973735067 4:53863741-53863763 CTCTGAACACTGGGCTTCAGGGG - Intronic
978393677 4:108254756-108254778 CACAAAACTCTTGTCTTCAGAGG - Intergenic
979245267 4:118496582-118496604 AGGAGATCTCAGGTCTTCAGAGG + Intergenic
984042918 4:174758864-174758886 CTCAGAACTATGTTTTTCAGGGG - Intronic
984873086 4:184344653-184344675 CTCAGTGCTCAGGTCTAAAGAGG - Intergenic
986204667 5:5612267-5612289 TTCAGAGCTCATGTCTCCAGGGG + Intergenic
988950972 5:36259846-36259868 CACAGAACTCTGATCTACAGTGG - Intronic
989490207 5:42042230-42042252 CCTAGAATTCAGTTCTTCAGAGG - Intergenic
991031394 5:62085700-62085722 GTCAGAACTCAGCTATTCAAAGG + Intergenic
992003809 5:72459497-72459519 CTCTGTGCTCAGGTCTTCAAGGG - Intronic
993035626 5:82753917-82753939 CTCAGCACTCAGGGCTTCTAAGG - Intergenic
993336986 5:86672029-86672051 CTCAGTAATGAGGTCTTAAGGGG - Intergenic
994634167 5:102323002-102323024 CTCACATCTCAGTTCATCAGGGG + Intergenic
995520607 5:113000834-113000856 GTCAGCAATCAGGTCTACAGTGG + Intronic
995908672 5:117158693-117158715 CTCAGAGCTCAGGGGCTCAGTGG - Intergenic
1000963178 5:167624682-167624704 CTCAGAACACAGCTTTTAAGTGG - Intronic
1002377918 5:178801452-178801474 CTCAGGAGTGGGGTCTTCAGTGG - Intergenic
1002569748 5:180133404-180133426 CACAGAGCTCAGGGCTGCAGAGG - Intronic
1002630753 5:180574664-180574686 TTCATAAATCAGGTCTTCTGTGG - Exonic
1004127005 6:12883597-12883619 CTCAGGTCTCAGGTCTCCTGGGG - Intronic
1006033542 6:31195114-31195136 TGCAGGGCTCAGGTCTTCAGGGG + Intergenic
1006683836 6:35815760-35815782 CCCAGAACTCAGGTCCTCTCTGG + Intronic
1008747652 6:54692096-54692118 GTCAAAACTCAGGTTTTCATTGG + Intergenic
1011429210 6:87267370-87267392 ATGAAAACTCTGGTCTTCAGAGG - Intergenic
1013682242 6:112537314-112537336 CTTGGAACTCAGGTATTAAGAGG - Intergenic
1018111915 6:160544580-160544602 CTCAGGATGCTGGTCTTCAGTGG + Intronic
1018131345 6:160734935-160734957 CTCAGGATGCTGGTCTTCAGTGG - Intronic
1019371558 7:664502-664524 CTCAGCCCCCAGGTCTGCAGGGG + Intronic
1020678170 7:11204421-11204443 ATCAGCACTCATGTCTTCTGGGG - Intergenic
1023737711 7:43249138-43249160 ATCAGAACTCGGGTCATCTGCGG + Intronic
1024787286 7:52922726-52922748 CTCAGGATTCAGGTGTACAGAGG + Intergenic
1026435188 7:70390555-70390577 CTCAGCACTCAGGGCTCTAGAGG + Intronic
1026567958 7:71505296-71505318 CTCAGAAGTCAGCTCTCCTGGGG + Intronic
1032410315 7:131689585-131689607 CTCAGAACTGAGGTCCTCGCTGG - Intergenic
1033542753 7:142372402-142372424 CTCAGAACTCAGCTCTTCCTGGG + Intergenic
1034472789 7:151264601-151264623 CTGAGGAGTTAGGTCTTCAGGGG - Intronic
1035931590 8:3785974-3785996 CTAAGTACTCAGGTCTCCTGGGG - Intronic
1045875319 8:106974998-106975020 CTGAAATCTCAGATCTTCAGAGG - Intergenic
1047157681 8:122339387-122339409 ATCAGATCTGAGGTCTTCAGTGG + Intergenic
1049005288 8:139851556-139851578 CCCTGAACTCTGGTCTCCAGAGG + Intronic
1049949981 9:634494-634516 CTCAGAAGTCAGGTGGCCAGAGG - Intronic
1052673912 9:31594468-31594490 CTCAAACCTCTGGGCTTCAGAGG - Intergenic
1052918361 9:33941712-33941734 CACAGAACTCTGGTCATAAGAGG + Exonic
1055420928 9:76141365-76141387 CTCTGAACTCAGTGGTTCAGTGG + Intronic
1056057527 9:82842472-82842494 CTCAGTAGTCAGGATTTCAGGGG - Intergenic
1057182396 9:93037141-93037163 GTCAGAGCTCAGCTCTGCAGGGG - Intergenic
1057217647 9:93238329-93238351 CCCAGAACCCAGCCCTTCAGGGG - Intronic
1057779844 9:98040585-98040607 CTCAGAGCAGAGGTCTTGAGTGG - Intergenic
1058541222 9:106014475-106014497 CTCAGCACTCAGGTATATAGGGG + Intergenic
1058977900 9:110141618-110141640 GTCAGAACTCCTGGCTTCAGTGG + Intronic
1059451082 9:114371857-114371879 CTCAGAACCCACGAGTTCAGAGG - Intronic
1061536983 9:131256515-131256537 ATCAGAATTCGGGTCTTCTGTGG - Intergenic
1061550081 9:131329316-131329338 CTCAGATTTCAGTGCTTCAGGGG - Intergenic
1062003190 9:134226955-134226977 CTCAGAACCAAGGCCTTCAGGGG - Intergenic
1186778238 X:12887369-12887391 CTTAGAACTCTGGAATTCAGAGG + Exonic
1191229812 X:58085113-58085135 CTCAGACCTCAGGTATTCCAAGG - Intergenic
1192244435 X:69360958-69360980 CTCAGAAGGCAGGTCTGGAGTGG + Intergenic
1192615148 X:72612766-72612788 CACAGAACTCATCTCTTCATGGG - Intronic
1193641993 X:84020771-84020793 CCCAGAGCTCAGATATTCAGTGG - Intergenic
1193910519 X:87300685-87300707 CTCAGGAGTCATGTCTTCAGAGG - Intergenic
1194079281 X:89438486-89438508 TTCAGTACTCAGGACTTCACAGG - Intergenic
1194509613 X:94777363-94777385 CACAGAACTCAGTCCATCAGAGG - Intergenic
1195876629 X:109549289-109549311 CTTAGAACACAGGTCTTCTTTGG - Intergenic
1198014080 X:132590829-132590851 CCAAGAACCCAGGTCTTCAGTGG - Intergenic
1198074553 X:133182049-133182071 CCCTGAACTCTGGACTTCAGAGG + Intergenic
1198561605 X:137856418-137856440 CTCAGATGTCATCTCTTCAGAGG + Intergenic
1200431899 Y:3093792-3093814 TTCAGTACTCAGGACTTCACAGG - Intergenic