ID: 1130106473

View in Genome Browser
Species Human (GRCh38)
Location 15:80932286-80932308
Sequence CACACGTCGGGTTCCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130106473_1130106480 8 Left 1130106473 15:80932286-80932308 CCTCTGGAGGAACCCGACGTGTG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130106480 15:80932317-80932339 TTCCTAGGCTGTTCCTCCAAGGG 0: 1
1: 0
2: 3
3: 13
4: 171
1130106473_1130106479 7 Left 1130106473 15:80932286-80932308 CCTCTGGAGGAACCCGACGTGTG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130106479 15:80932316-80932338 GTTCCTAGGCTGTTCCTCCAAGG 0: 1
1: 0
2: 1
3: 20
4: 147
1130106473_1130106478 -7 Left 1130106473 15:80932286-80932308 CCTCTGGAGGAACCCGACGTGTG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130106478 15:80932302-80932324 ACGTGTGGACTGAGGTTCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130106473 Original CRISPR CACACGTCGGGTTCCTCCAG AGG (reversed) Intronic