ID: 1130106478

View in Genome Browser
Species Human (GRCh38)
Location 15:80932302-80932324
Sequence ACGTGTGGACTGAGGTTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130106467_1130106478 28 Left 1130106467 15:80932251-80932273 CCGCTTGCTCTCTCCCTGCTCAA 0: 1
1: 1
2: 3
3: 61
4: 508
Right 1130106478 15:80932302-80932324 ACGTGTGGACTGAGGTTCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 83
1130106466_1130106478 29 Left 1130106466 15:80932250-80932272 CCCGCTTGCTCTCTCCCTGCTCA 0: 1
1: 0
2: 7
3: 55
4: 533
Right 1130106478 15:80932302-80932324 ACGTGTGGACTGAGGTTCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 83
1130106473_1130106478 -7 Left 1130106473 15:80932286-80932308 CCTCTGGAGGAACCCGACGTGTG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130106478 15:80932302-80932324 ACGTGTGGACTGAGGTTCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 83
1130106469_1130106478 15 Left 1130106469 15:80932264-80932286 CCCTGCTCAAAACTCAGGCGAGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1130106478 15:80932302-80932324 ACGTGTGGACTGAGGTTCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 83
1130106470_1130106478 14 Left 1130106470 15:80932265-80932287 CCTGCTCAAAACTCAGGCGAGCC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1130106478 15:80932302-80932324 ACGTGTGGACTGAGGTTCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130106478 Original CRISPR ACGTGTGGACTGAGGTTCCT AGG Intronic