ID: 1130106480

View in Genome Browser
Species Human (GRCh38)
Location 15:80932317-80932339
Sequence TTCCTAGGCTGTTCCTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130106476_1130106480 -4 Left 1130106476 15:80932298-80932320 CCCGACGTGTGGACTGAGGTTCC 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1130106480 15:80932317-80932339 TTCCTAGGCTGTTCCTCCAAGGG 0: 1
1: 0
2: 3
3: 13
4: 171
1130106473_1130106480 8 Left 1130106473 15:80932286-80932308 CCTCTGGAGGAACCCGACGTGTG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130106480 15:80932317-80932339 TTCCTAGGCTGTTCCTCCAAGGG 0: 1
1: 0
2: 3
3: 13
4: 171
1130106469_1130106480 30 Left 1130106469 15:80932264-80932286 CCCTGCTCAAAACTCAGGCGAGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1130106480 15:80932317-80932339 TTCCTAGGCTGTTCCTCCAAGGG 0: 1
1: 0
2: 3
3: 13
4: 171
1130106477_1130106480 -5 Left 1130106477 15:80932299-80932321 CCGACGTGTGGACTGAGGTTCCT 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1130106480 15:80932317-80932339 TTCCTAGGCTGTTCCTCCAAGGG 0: 1
1: 0
2: 3
3: 13
4: 171
1130106470_1130106480 29 Left 1130106470 15:80932265-80932287 CCTGCTCAAAACTCAGGCGAGCC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1130106480 15:80932317-80932339 TTCCTAGGCTGTTCCTCCAAGGG 0: 1
1: 0
2: 3
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130106480 Original CRISPR TTCCTAGGCTGTTCCTCCAA GGG Intronic