ID: 1130112860

View in Genome Browser
Species Human (GRCh38)
Location 15:80980452-80980474
Sequence CTATGTTCACACATAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130112860 Original CRISPR CTATGTTCACACATAGAGCT TGG (reversed) Intronic
900094717 1:935674-935696 CCACGCTCACACACAGAGCTAGG + Intronic
901518683 1:9767003-9767025 GAATGTTCACACAGTGAGCTGGG + Intronic
906906101 1:49893856-49893878 CTATGTTCACTCAAAGCCCTAGG - Intronic
907106334 1:51886129-51886151 CTATGGTCACACAAATTGCTTGG - Intergenic
909856922 1:80546544-80546566 TTATGTCCACACCTAGAGATAGG + Intergenic
912891087 1:113531678-113531700 TTATGTTCAAACATAGAGTCGGG - Intronic
915542594 1:156577870-156577892 CTATGTGCAGGCATAGTGCTGGG - Intergenic
916281042 1:163051736-163051758 ATATATTCACACATATAGATAGG - Intergenic
921307376 1:213810435-213810457 CTGGGTTAAGACATAGAGCTTGG + Intergenic
922275373 1:224072602-224072624 CTATTTTCACATATTGTGCTGGG - Intergenic
924605354 1:245529609-245529631 CTATTTTCACACAGGGAACTTGG + Intronic
1064880473 10:20046928-20046950 CTATGTTCACCCATAAATCCCGG - Exonic
1064987420 10:21225395-21225417 CTATGTTCACTCAAGGACCTAGG + Intergenic
1067280844 10:44871432-44871454 CTATGTTCACACATTAATCTGGG + Intergenic
1070059293 10:72967085-72967107 CTATGTTCACTCAAGGACCTAGG + Intergenic
1070645165 10:78196681-78196703 TTATGTTCGCACACAGAGGTGGG + Intergenic
1070869182 10:79733646-79733668 CAAGGTTCACACATTGAGATTGG + Intergenic
1071636096 10:87255823-87255845 CAAGGTTCACACATTGAGATTGG + Intergenic
1071659145 10:87482123-87482145 CAAGGTTCACACATTGAGATTGG - Intergenic
1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG + Intergenic
1073494414 10:103878757-103878779 CTATGTTCACAAATATATTTGGG - Intergenic
1076628463 10:131837092-131837114 GTATGTTCACACTTATAACTGGG - Intergenic
1077952141 11:6971222-6971244 CTATGTTCAGACACTGTGCTAGG - Intronic
1079277700 11:19057043-19057065 CTATGCCCTCACATTGAGCTAGG - Intronic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1085815532 11:79733323-79733345 CTATGTTCTCTCATATAACTTGG - Intergenic
1088746649 11:112809643-112809665 TTATATTCACACACACAGCTTGG + Intergenic
1088964139 11:114700975-114700997 TTATGATGACACAGAGAGCTGGG + Intronic
1090318201 11:125816727-125816749 CTATGTTCACTCAAGGACCTGGG + Intergenic
1090602541 11:128388258-128388280 CAATGTACACAAATACAGCTGGG - Intergenic
1092969172 12:13675200-13675222 CTAAGATCCTACATAGAGCTGGG + Intronic
1094028339 12:25982729-25982751 CAATGTCTCCACATAGAGCTGGG + Intronic
1095432195 12:42145626-42145648 CTAGGTACTCACACAGAGCTTGG - Intergenic
1097808868 12:63996067-63996089 CTTTTTTCACATATAGAGATTGG - Intronic
1098486283 12:71025727-71025749 CCAGGTTCTAACATAGAGCTTGG - Intergenic
1099259820 12:80363865-80363887 CTATGTTCATACATTAACCTTGG + Intronic
1099776623 12:87140549-87140571 CTATGTTTTCACTTAGAGCCAGG + Intergenic
1100623652 12:96306821-96306843 CTATGTTCAAATATAAACCTAGG + Intronic
1100998839 12:100333620-100333642 CTATGTTAAGACATAGTGCTAGG + Intronic
1101695204 12:107119095-107119117 CTCTGTTCACATATGGAGGTGGG - Intergenic
1106050835 13:26187889-26187911 CTGTGGTCTCAAATAGAGCTAGG - Intronic
1106830728 13:33579409-33579431 GTATGTTCTCACATATAGGTGGG + Intergenic
1106911014 13:34463751-34463773 CTATGATCACAGAGAGACCTCGG - Intergenic
1107210951 13:37853087-37853109 CTATGTTCACTCAAAGTCCTAGG - Intronic
1107226408 13:38054084-38054106 CTGTGTTTCCACATAGAGGTGGG + Intergenic
1107668513 13:42717956-42717978 GTTTGTTAACACATAGTGCTGGG - Intergenic
1108764776 13:53613787-53613809 GTCTGTTCACACATACAGTTAGG - Intergenic
1109326814 13:60877908-60877930 CTATGTTCAAATAGAGAACTTGG + Intergenic
1110376813 13:74803210-74803232 CTATGTTCACACAAGGCCCTAGG - Intergenic
1115252235 14:31361517-31361539 CTATTTTCACACATAGCCATAGG - Intronic
1115443997 14:33468351-33468373 TTCTGTTAACACATGGAGCTTGG - Intronic
1120435283 14:84474005-84474027 ATATGTTCACAGAAAGGGCTGGG - Intergenic
1121688815 14:95859769-95859791 CCATGGTCATACAGAGAGCTAGG + Intergenic
1121927239 14:97939000-97939022 CTATGTCAACACTTGGAGCTAGG + Intronic
1124387679 15:29223940-29223962 CTGTGTTCACAGGCAGAGCTGGG - Intronic
1124393795 15:29283003-29283025 CCATGCTCACACAGGGAGCTGGG + Intronic
1126216341 15:46158498-46158520 CTATGTTCACTCAAGGACCTGGG - Intergenic
1129882001 15:79013177-79013199 CCATATTCACACACAAAGCTAGG + Intronic
1129977136 15:79831791-79831813 CCATGTGCTCACATGGAGCTGGG - Intergenic
1130112860 15:80980452-80980474 CTATGTTCACACATAGAGCTTGG - Intronic
1130907214 15:88249235-88249257 CTCTGTTCACATACAGGGCTGGG - Intronic
1131560972 15:93439055-93439077 CTATGTTCACACACAGTTCTAGG - Intergenic
1133453400 16:5922184-5922206 CTGAGTTCACATAGAGAGCTAGG - Intergenic
1136854028 16:33638781-33638803 CTATGTTCAGGCACTGAGCTAGG + Intergenic
1137819756 16:51432792-51432814 CTACCTTCACACACAGAACTGGG + Intergenic
1139787547 16:69406159-69406181 GTATGTGCACACACAGAACTCGG - Intronic
1140145448 16:72302594-72302616 CTATGGTCACACAAAGAGCATGG + Intergenic
1149786140 17:59436982-59437004 CTATGTTCACACAGATAATTTGG - Intergenic
1151757284 17:76082082-76082104 CTAGGTGCACACCTAGGGCTGGG + Intronic
1152160225 17:78664166-78664188 CTAAGTTCTCACATTGTGCTGGG - Intergenic
1156898132 18:42270031-42270053 ATATGTTCACACTTATAACTGGG + Intergenic
1159497716 18:69227533-69227555 CTATGTCCCCACACAAAGCTCGG + Intergenic
1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG + Intronic
1164611310 19:29634236-29634258 CTATGTTCACCCAAAGACATGGG + Intergenic
1168671742 19:58246012-58246034 CTCTGTTGACACATTGATCTTGG - Intronic
927444217 2:23143465-23143487 CTATGAGCCCACATAGAACTTGG - Intergenic
936245153 2:110820133-110820155 CTATGGTCCCACATGGACCTGGG - Intronic
937488894 2:122344969-122344991 ATATGTCCACACCAAGAGCTAGG - Intergenic
937871992 2:126792588-126792610 CCATGCTCACACCTAGAGCAAGG - Intergenic
940373648 2:152930840-152930862 CTCTGTTCACAGAGAGAGATAGG + Intergenic
942734610 2:179096187-179096209 CTATGTTCACTCAAAGCCCTGGG + Intergenic
943971123 2:194407904-194407926 ATTTGTTCACAGATACAGCTGGG + Intergenic
945124152 2:206489594-206489616 CTATGGGTACACATAGGGCTTGG - Intronic
945585129 2:211651834-211651856 CTGTGTTCTCATCTAGAGCTTGG - Intronic
946879575 2:224163539-224163561 CTATGTTCACATATATTGCTGGG + Intergenic
947912407 2:233810099-233810121 CTATGGTAACACATAGGGCTCGG + Intronic
1169571500 20:6911482-6911504 CTAGGCTCACACACAGAGCAGGG + Intergenic
1174426450 20:50434918-50434940 CTATGTTTACACAAAGACTTGGG + Intergenic
1174431240 20:50471026-50471048 CTATGTTCAAAGACAGTGCTAGG + Intergenic
1175474238 20:59258577-59258599 ATATGATCACCCATAGAGCCAGG - Exonic
1177217072 21:18144552-18144574 TTATGTTCACACAAAGACCACGG + Intronic
1177487913 21:21783042-21783064 CTATGTTCGCTCAAAGCGCTGGG + Intergenic
1181024264 22:20118809-20118831 CTCTGTGCTCACATGGAGCTGGG + Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
956613799 3:71151363-71151385 CTTTGTTCCCACATTGAACTAGG - Intronic
957730482 3:84126583-84126605 CCATGTACACACATAGAGTTTGG - Intergenic
958847273 3:99279464-99279486 CTATGTTCACTCAAGGACCTGGG - Intergenic
965272633 3:166638449-166638471 CTAGGTTCACAGATGCAGCTTGG - Intergenic
965980393 3:174682390-174682412 CTAAGTTCACTCAAAGACCTAGG - Intronic
966005188 3:175002169-175002191 ATATCTTTACACATAGAGCAGGG - Intronic
967002943 3:185354267-185354289 CTCTGTTGACACAGAGAGGTAGG - Intronic
967593759 3:191307186-191307208 CTATATTCACACAGAGTGCTAGG - Intronic
967690164 3:192464361-192464383 CTATGTTCTCACTTAGAAGTGGG - Intronic
972168634 4:36318235-36318257 CTTTGTTAGCACATAAAGCTAGG + Intronic
973100568 4:46263462-46263484 CTTTTTTCACACATGGTGCTGGG - Intronic
973620038 4:52717135-52717157 CTAAGATCACAAATATAGCTGGG + Intergenic
973971016 4:56213792-56213814 CTCTGTTTACACATATAGTTAGG + Intronic
977590888 4:98825472-98825494 CTATGTTGAAAAATAAAGCTAGG + Intergenic
979824401 4:125215655-125215677 CTATGTTAAAACATAAACCTGGG - Intergenic
980440809 4:132842128-132842150 CTATGTTCACACAAAAATATTGG - Intergenic
981580605 4:146245270-146245292 CTATGTCCACACAGAAAGCTCGG - Intergenic
981895740 4:149796547-149796569 CTATGTTCACTCAAAGGCCTGGG - Intergenic
983017318 4:162628979-162629001 CTATGTTCACTCAAAGCCCTGGG - Intergenic
983862672 4:172727180-172727202 CTATGGGCACACAAGGAGCTTGG - Intronic
985824193 5:2180602-2180624 CTCTGTTCACCCTGAGAGCTCGG - Intergenic
986881859 5:12184017-12184039 CAATGAACACACATAGAGTTGGG + Intergenic
987858912 5:23458327-23458349 CTAATTTCACACTTAGACCTTGG - Intergenic
989672693 5:43936808-43936830 CTATGTTCACTCACAGCCCTTGG - Intergenic
991456793 5:66812448-66812470 CTATGTTCACTTAGAGAGGTGGG + Intronic
992173374 5:74125681-74125703 CTATTTTCACACAAACAGCAAGG - Intergenic
993278777 5:85898184-85898206 CTATGTTCTCTCAAAGACCTGGG + Intergenic
993954133 5:94211851-94211873 CTATGTTCTCAGATATAACTAGG + Intronic
996746183 5:126848084-126848106 CTATGATCCCAGAAAGAGCTTGG - Intergenic
997027281 5:130080257-130080279 CCATGGTCACACAGAGAGATGGG - Intronic
998035267 5:138909834-138909856 GTATTTTCCCACCTAGAGCTAGG - Intronic
999002437 5:147939263-147939285 CTATGTTCACTCAAAGCCCTGGG + Intergenic
999526048 5:152406879-152406901 CTATGCTCACTCATAAACCTAGG + Intronic
1000270313 5:159677731-159677753 CTATGTTCACTCAAGGACCTGGG - Intergenic
1001268755 5:170295069-170295091 CTAAGGTCACACAGTGAGCTGGG + Intronic
1001478337 5:172066822-172066844 CTGTGTTCACACACACAGTTAGG - Intronic
1004254576 6:14051076-14051098 CTTTCTTCACACTTAGACCTGGG + Intergenic
1004571800 6:16853270-16853292 CTATGTTCTCATATTGACCTTGG - Intergenic
1005435575 6:25807683-25807705 CTATGTTCTCACTTATAACTGGG - Intronic
1005558822 6:27016462-27016484 CTATGTTCACCCAGAGATATTGG - Intergenic
1006458999 6:34147250-34147272 GTGTGTTTACACCTAGAGCTGGG - Intronic
1009371257 6:62905863-62905885 CTATGTTCACTCATGGCCCTAGG - Intergenic
1015825613 6:137308134-137308156 TTATGTTGACACATAGAGCAAGG + Intergenic
1016460443 6:144275616-144275638 CTTTGTTCACCCAAAGTGCTGGG - Intergenic
1016615485 6:146042984-146043006 CTATTTTCATACAGAGAGGTTGG - Intronic
1018848478 6:167571502-167571524 CCATGTACACACATATATCTAGG + Intergenic
1019630292 7:2045417-2045439 CTATGTACACGCAGAGTGCTGGG - Intronic
1022653881 7:32300505-32300527 CTCTGCTCACAGATAGACCTGGG + Intergenic
1024001048 7:45189570-45189592 CTCTGTTCACACAGAGAGGCCGG + Intergenic
1028983917 7:96995526-96995548 ATATATTCACACACTGAGCTGGG + Intergenic
1029151064 7:98480883-98480905 GTGTGATCACACAGAGAGCTGGG - Intergenic
1029660699 7:101959219-101959241 CACTGCACACACATAGAGCTAGG - Intronic
1030620566 7:111785767-111785789 CCATGTGCCCACATTGAGCTAGG + Intronic
1031711388 7:125050430-125050452 ATATGTTTACATATATAGCTTGG - Intergenic
1031808310 7:126334435-126334457 CTATGCACACATACAGAGCTGGG + Intergenic
1031859834 7:126965965-126965987 CTATGGCCACACATTGTGCTAGG - Intronic
1033814800 7:145058675-145058697 GTTTGTACACACAGAGAGCTTGG + Intergenic
1038236278 8:25760274-25760296 GTTTTTTCACACATATAGCTTGG + Intergenic
1043257540 8:78155517-78155539 CTATTTTCATACATAGGCCTTGG + Intergenic
1044023327 8:87134992-87135014 TAATGTTCACACTTAGAGTTAGG + Intronic
1044274822 8:90286675-90286697 CTCTGTGCACACATAGAAATTGG - Intergenic
1045109162 8:98923548-98923570 CCATGTTCACAAGTAGTGCTAGG - Intronic
1046419783 8:113965074-113965096 CTATATTCACACTTAGATCTTGG + Intergenic
1048359295 8:133682452-133682474 CTATTTTCACACAGAGCCCTGGG - Intergenic
1051360061 9:16274163-16274185 CTGTGTTCTCATCTAGAGCTGGG - Intronic
1058327010 9:103710930-103710952 CTATGTTCTCACTTAGAAGTGGG - Intergenic
1059429054 9:114239253-114239275 CTAAGTTCTCACTTAGAGATGGG + Intronic
1059730991 9:117056701-117056723 CTATGTTCACACATCAACCCTGG + Intronic
1061321478 9:129833372-129833394 CTAGGTTCCCTCAGAGAGCTGGG - Intronic
1186197134 X:7120679-7120701 CTATGTTTACACAAAGACTTAGG + Intronic
1186392147 X:9171622-9171644 CTCTCTTCACTCAGAGAGCTTGG + Intergenic
1187533569 X:20117379-20117401 CTGTGTTCACACATTGAGTGAGG - Intergenic
1190614688 X:52217931-52217953 CTATGTTCACTCAAAGCCCTGGG - Intergenic
1191781104 X:64866750-64866772 CTATGTTCACAAGTATAGATTGG - Intergenic
1191974046 X:66850951-66850973 CTATGTTCACTCAAAGCCCTAGG + Intergenic
1194223723 X:91228043-91228065 CTATGTTCACTCAAAGCCCTGGG - Intergenic
1195971417 X:110477796-110477818 CTATGTTCACTCAAAGCCCTGGG + Intergenic
1197291076 X:124658573-124658595 CTATTTACACACATAGGCCTTGG + Intronic
1197561727 X:128032276-128032298 CTATTTTCATACATACAGGTAGG + Intergenic
1198430715 X:136564229-136564251 CTATGTTCACTCAAAGCCCTGGG + Intergenic
1199038791 X:143085417-143085439 CTATGCTCACACCTTGATCTTGG + Intergenic
1200560186 Y:4691425-4691447 CTATGTTCACTCAAAGCCCTGGG - Intergenic