ID: 1130115205

View in Genome Browser
Species Human (GRCh38)
Location 15:81000622-81000644
Sequence GCTTACGTAAGGCCCGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130115197_1130115205 -4 Left 1130115197 15:81000603-81000625 CCCCCTGGTCCGGCTAAGAGCTT No data
Right 1130115205 15:81000622-81000644 GCTTACGTAAGGCCCGCGGGCGG No data
1130115198_1130115205 -5 Left 1130115198 15:81000604-81000626 CCCCTGGTCCGGCTAAGAGCTTA No data
Right 1130115205 15:81000622-81000644 GCTTACGTAAGGCCCGCGGGCGG No data
1130115199_1130115205 -6 Left 1130115199 15:81000605-81000627 CCCTGGTCCGGCTAAGAGCTTAC No data
Right 1130115205 15:81000622-81000644 GCTTACGTAAGGCCCGCGGGCGG No data
1130115200_1130115205 -7 Left 1130115200 15:81000606-81000628 CCTGGTCCGGCTAAGAGCTTACG No data
Right 1130115205 15:81000622-81000644 GCTTACGTAAGGCCCGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130115205 Original CRISPR GCTTACGTAAGGCCCGCGGG CGG Intergenic
No off target data available for this crispr