ID: 1130115546

View in Genome Browser
Species Human (GRCh38)
Location 15:81001885-81001907
Sequence GGCCATGCCCAAGAAGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 188}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130115538_1130115546 -2 Left 1130115538 15:81001864-81001886 CCCGCTCCGAGGGCCGCGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115541_1130115546 -8 Left 1130115541 15:81001870-81001892 CCGAGGGCCGCGCCAGGCCATGC 0: 1
1: 0
2: 0
3: 16
4: 170
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115536_1130115546 2 Left 1130115536 15:81001860-81001882 CCTCCCCGCTCCGAGGGCCGCGC 0: 1
1: 1
2: 0
3: 25
4: 239
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115534_1130115546 6 Left 1130115534 15:81001856-81001878 CCGCCCTCCCCGCTCCGAGGGCC 0: 1
1: 0
2: 4
3: 40
4: 451
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115537_1130115546 -1 Left 1130115537 15:81001863-81001885 CCCCGCTCCGAGGGCCGCGCCAG 0: 1
1: 0
2: 0
3: 17
4: 107
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115540_1130115546 -3 Left 1130115540 15:81001865-81001887 CCGCTCCGAGGGCCGCGCCAGGC 0: 1
1: 0
2: 3
3: 15
4: 182
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115527_1130115546 20 Left 1130115527 15:81001842-81001864 CCAGCTTCCCCGTCCCGCCCTCC 0: 1
1: 0
2: 7
3: 86
4: 922
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115529_1130115546 12 Left 1130115529 15:81001850-81001872 CCCGTCCCGCCCTCCCCGCTCCG 0: 1
1: 1
2: 1
3: 72
4: 693
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115530_1130115546 11 Left 1130115530 15:81001851-81001873 CCGTCCCGCCCTCCCCGCTCCGA 0: 1
1: 0
2: 2
3: 52
4: 657
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115526_1130115546 21 Left 1130115526 15:81001841-81001863 CCCAGCTTCCCCGTCCCGCCCTC 0: 1
1: 0
2: 4
3: 27
4: 364
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115535_1130115546 3 Left 1130115535 15:81001859-81001881 CCCTCCCCGCTCCGAGGGCCGCG 0: 1
1: 0
2: 1
3: 13
4: 158
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115533_1130115546 7 Left 1130115533 15:81001855-81001877 CCCGCCCTCCCCGCTCCGAGGGC 0: 1
1: 0
2: 5
3: 40
4: 381
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1130115528_1130115546 13 Left 1130115528 15:81001849-81001871 CCCCGTCCCGCCCTCCCCGCTCC 0: 2
1: 2
2: 14
3: 162
4: 1752
Right 1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130115546 Original CRISPR GGCCATGCCCAAGAAGGCGG CGG Exonic
900170543 1:1266190-1266212 GGCCCAGCCCAGGCAGGCGGAGG - Intronic
900792443 1:4689423-4689445 CGCAAGGCCCAGGAAGGCGGAGG + Intronic
902579103 1:17397161-17397183 GGCCATCCCCAAGAAAGAGCTGG + Intronic
902585888 1:17438496-17438518 GACCATGCCCAGGAAGAAGGCGG - Exonic
902835489 1:19044328-19044350 TCCCCTTCCCAAGAAGGCGGTGG - Intergenic
903288261 1:22290645-22290667 GGTCATGCCCAAGAGGGCACCGG - Intergenic
903975244 1:27145568-27145590 GACCAGGCCACAGAAGGCGGAGG - Intronic
905270249 1:36782944-36782966 GGCCATTCCCCACAAGGCAGGGG + Intergenic
908786665 1:67741314-67741336 GACCTTACACAAGAAGGCGGTGG - Intronic
912373357 1:109190751-109190773 AGCCATGCCCAAGCGGGCTGGGG - Intronic
914050774 1:144128260-144128282 GGCCCTCCTCAAGAAGGTGGAGG + Intergenic
914128407 1:144837184-144837206 GGCCCTCCTCAAGAAGGTGGAGG - Intergenic
914237350 1:145824014-145824036 GGCCAGGCCCAGAAACGCGGCGG + Exonic
915146662 1:153799693-153799715 GGCCATCTGCAAGAAGGCGTTGG - Intergenic
915474709 1:156146888-156146910 GGCCTGGCCCCAGAAGGCAGGGG - Intergenic
915567522 1:156724105-156724127 AGCCATGTCCAAGATGGGGGCGG + Intronic
917967815 1:180189455-180189477 AGCTATGCAGAAGAAGGCGGGGG - Intronic
918279236 1:182987037-182987059 TCCCAGGCCCAAGAAGGAGGAGG - Intergenic
918355740 1:183705501-183705523 GGGCCTGCCCAAAAAGGTGGGGG + Intronic
919786941 1:201264176-201264198 TGCCATGCCCAAGAGAGGGGAGG - Intergenic
921053627 1:211528002-211528024 GGCCAAGCTCAAGAAGGCAGTGG - Intergenic
921670016 1:217914840-217914862 GGCAATGCCAATGAAGACGGAGG + Intergenic
922714313 1:227858957-227858979 GTCCCTGCCCAAGAAGGGGCAGG - Intergenic
922741966 1:228019072-228019094 GGCCATACTCAGGAAGGTGGTGG + Intronic
923039405 1:230309013-230309035 GGCCATGCCCAAGAAACCATGGG - Intergenic
1065811275 10:29445935-29445957 GGCCATGCAAAATCAGGCGGTGG - Intergenic
1067841036 10:49679694-49679716 GGCGATGCCCAAGAACGCAGTGG + Exonic
1068778976 10:60899039-60899061 GGCCTTGCCAAAGAAGGTTGTGG + Intronic
1069818757 10:71214761-71214783 GGGCTTGGCCAAGAAGGCTGGGG + Intronic
1072822123 10:98568501-98568523 GGCCAAGCCCCAGAAGTCTGTGG + Intronic
1072920030 10:99569094-99569116 CCCCATGCCCAAGAAGTTGGGGG + Intergenic
1075031273 10:119026229-119026251 GGAGATGCCCCAGAAGGAGGTGG - Intergenic
1077579293 11:3406545-3406567 GGACCTGCCCATGAAGGTGGTGG + Intergenic
1078680754 11:13473504-13473526 GGGCCTGTCCAAAAAGGCGGGGG - Intergenic
1079755087 11:24248753-24248775 TCCCAGGCCCAAGAAGGCAGTGG + Intergenic
1083630683 11:64093679-64093701 GGCCATGACCAAGAGGGGGTGGG - Intronic
1084236320 11:67790088-67790110 GGACCTGCCCATGAAGGTGGTGG + Intergenic
1084836091 11:71802904-71802926 GGACCTGCCCATGAAGGTGGTGG - Intergenic
1085283416 11:75345251-75345273 GGCCAGTCCCAGGAAGGAGGAGG + Intronic
1085327220 11:75615908-75615930 GGCCAGGCCCCAGAAGAGGGAGG + Intronic
1086511153 11:87559583-87559605 GGCCACTCCCAAGATGGTGGTGG + Intergenic
1089397976 11:118148297-118148319 GGTCATGCACAAGAAAGCCGAGG + Intronic
1090400211 11:126444030-126444052 GGCCAGACCCAAGAAGGTTGTGG - Intronic
1092407225 12:8229495-8229517 GGACCTGCCCATGAAGGTGGTGG + Intergenic
1095089241 12:38088321-38088343 GGCAAAGCCCAACATGGCGGAGG + Intergenic
1095261803 12:40106144-40106166 GGCCCCGCCCAAGGAGGGGGCGG - Intergenic
1096614129 12:52822110-52822132 GGCCATGCCAGAGAGGGCTGGGG + Intronic
1097183393 12:57183730-57183752 GGGGATGCCCAATAAGGCAGGGG - Intronic
1100205008 12:92339367-92339389 GGCCACTCCCAAGATGGTGGCGG + Intergenic
1101845834 12:108362368-108362390 GGACATGCACTAGAAGGAGGAGG + Intergenic
1103034712 12:117647238-117647260 GGGCATGACCAGGCAGGCGGAGG - Intronic
1104016743 12:124966798-124966820 GGCCAGGGCCAAGAAGGCGCGGG - Exonic
1104088058 12:125493778-125493800 GGCCATTCCCAGGGAGGAGGGGG - Intronic
1104547339 12:129724126-129724148 GACTATGCCCAAGACAGCGGGGG + Intronic
1104773013 12:131376022-131376044 GCCCATGCCCTAGAATGAGGGGG - Intergenic
1105405738 13:20131231-20131253 GGCCAGGCCCATTAAGGCTGCGG + Intergenic
1105610002 13:21960258-21960280 GGCCATGCCAAAAATGGCTGTGG + Intergenic
1108782649 13:53855479-53855501 TGCCATGCCCAAGAAGAATGAGG + Intergenic
1109680656 13:65748132-65748154 GGCCACTCCCAAGATGGAGGCGG + Intergenic
1118638068 14:67766421-67766443 GGCAATGCACAAGGAGGCGCTGG + Exonic
1123403844 15:20009262-20009284 GGCCATGTCCAAGAGGGGAGTGG + Intergenic
1123513183 15:21015908-21015930 GGCCATGTCCAAGAGGGGAGTGG + Intergenic
1124999500 15:34755237-34755259 CGCCAGACCCAAGCAGGCGGAGG + Intergenic
1129255156 15:74330209-74330231 GGCCATGCAGAAGATGGCAGAGG + Exonic
1129742632 15:77997164-77997186 GGCCATCCCCAAGGAGGCCATGG + Exonic
1129842841 15:78754282-78754304 GGCCATCCCCAAGGAGGCCATGG - Intergenic
1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG + Exonic
1130384107 15:83396349-83396371 GCCCCTGCCAAAGAAGGGGGAGG + Intergenic
1133347894 16:5082605-5082627 GGACCTGCCCATGAAGGTGGTGG + Exonic
1134227608 16:12403675-12403697 GGCCTTGCCGAAGAAGTCTGTGG + Intronic
1135113505 16:19708237-19708259 AGCCAAGCCCAAGAACTCGGGGG + Intronic
1136684746 16:31987512-31987534 GGCCATCCAAAAGAAGGCTGTGG + Intergenic
1136785362 16:32931047-32931069 GGCCATCCAAAAGAAGGCTGTGG + Intergenic
1138127741 16:54452716-54452738 GGCAATGCTCAAGACAGCGGGGG - Intergenic
1138352650 16:56354110-56354132 GGGCCTGCCCAAGAGGGTGGTGG - Intronic
1139342556 16:66277987-66278009 GTCCATTCCCAAGAAGGGTGGGG - Intergenic
1140761952 16:78117605-78117627 GTCCTTGCCCAAGTAGGCTGTGG + Intronic
1142526453 17:545214-545236 GGCCAGGCCGAAGAAGGGGGAGG - Intronic
1143324214 17:6087893-6087915 GGCCTTGGCCAGGAAGGCAGAGG + Intronic
1144672150 17:17138881-17138903 AGGCATGCCCAGGAAGGTGGGGG + Intronic
1144759801 17:17700829-17700851 TGCCAAGCCCAAGATGGCCGGGG - Intronic
1147040001 17:37711214-37711236 GGCCAGGCCCAAGAGGTCAGGGG + Intronic
1147440278 17:40443478-40443500 GGCCCGGCCCAGGCAGGCGGCGG - Exonic
1147512313 17:41081573-41081595 GGCCATGCTCAGGAAAACGGGGG + Intergenic
1147514486 17:41102744-41102766 GGCCATGCTCAGGAAAACGGGGG + Intronic
1148061997 17:44842979-44843001 GGGCAAGCCCAAGAAGGAGGGGG + Intergenic
1148545273 17:48513959-48513981 AGGCATGCACAAGAAGGGGGAGG - Intergenic
1151556569 17:74849772-74849794 GGCCTCACCCAAGAAGGCCGAGG + Exonic
1151601779 17:75110285-75110307 GGCCATGGCCCAGAAGCCGAAGG + Exonic
1152065976 17:78112772-78112794 GGCCAAGCCCCAGATGGCAGGGG - Exonic
1152436484 17:80279307-80279329 GGCCAGGCCCAGGCAGGTGGGGG + Intronic
1153474967 18:5489114-5489136 GGCCGAGCCCCAGGAGGCGGCGG - Exonic
1153803483 18:8691932-8691954 GTCCATGACCAAGTAGGCAGAGG + Intergenic
1154204531 18:12325746-12325768 GCCCATGTCCATGAAGGAGGTGG + Exonic
1154337489 18:13477252-13477274 GCCCATGCCCAGGAAGGTCGGGG - Intronic
1160518826 18:79493044-79493066 GGCCATGCTCGAGAAGTCTGAGG - Intronic
1162094753 19:8303785-8303807 GGCCACGCCCCAGCAGGCAGTGG + Intronic
1162152492 19:8656086-8656108 GGCACTGCCCAGGAAGGAGGAGG + Intergenic
1165079967 19:33301580-33301602 GGGCAAGGCCAAGAAGTCGGTGG - Exonic
1165754762 19:38286412-38286434 GGCCAGGCCCGAGGATGCGGAGG + Intronic
1167642236 19:50688201-50688223 GGGCTTGCCCAGGGAGGCGGTGG - Intronic
1168100245 19:54137754-54137776 GGCCCGGTCCAAGATGGCGGCGG - Intronic
1202690182 1_KI270712v1_random:80899-80921 GGCCCTCCTCAAGAAGGTGGAGG + Intergenic
925275162 2:2643520-2643542 GTCTATGCCCAAGAAGGGGCTGG - Intergenic
925764310 2:7215830-7215852 TGCAATGCCCAAGAAAGCGCAGG - Intergenic
926272889 2:11379892-11379914 GGACATTCCCAAAAAGGCAGAGG + Intergenic
927181150 2:20447471-20447493 GGCCATCCGCAAGAAGCTGGTGG + Exonic
927602290 2:24454621-24454643 GGCCAGTCCCCAGAAGGCTGAGG + Intergenic
927708655 2:25312162-25312184 AGCCAGGCCCAAGAAGGGGAGGG + Intronic
929568609 2:43006095-43006117 GGCCAGGCCCAAGGAGGGAGAGG - Intergenic
930548733 2:52803839-52803861 GGCCATGTGGAAGAAGGCAGCGG - Intergenic
930843279 2:55871918-55871940 GGCAATGCCAAAGAAGTCAGAGG + Intronic
935179281 2:100675626-100675648 GGTCAGGCCCACGAAGGCAGAGG + Intergenic
936786899 2:116104238-116104260 GGCCATACCAAAGAAAGAGGAGG - Intergenic
938852573 2:135276043-135276065 GGCTATGGCCAAGAAGGAGTTGG + Intronic
941067621 2:160920957-160920979 GGCCATTCCTAAGCAGGCAGTGG + Intergenic
942698523 2:178675936-178675958 GGTCATTCCCAAGAAAGAGGAGG - Exonic
946432832 2:219634718-219634740 GGCCATGCCCTGGAGGGTGGTGG + Intronic
948859617 2:240746520-240746542 GGGGATGCCCAAGAAGGGGAGGG - Intronic
1169058188 20:2641165-2641187 GGCCATGGACAAGAAGGCGCAGG + Exonic
1170113836 20:12835849-12835871 GGCCATGCCTAATAAGGGGATGG + Intergenic
1170632128 20:18074691-18074713 CGCCATGGCCAAGATGGTGGAGG - Intergenic
1172115361 20:32570464-32570486 GGCCAGGCCCCAGAAGATGGGGG - Intronic
1174276459 20:49407964-49407986 GGCCCTGCCCTGGAAAGCGGAGG - Intronic
1176018500 20:62951046-62951068 GGCCAGGCCCAACAAGAGGGAGG + Intergenic
1176622873 21:9070799-9070821 TGCCATGCTCAAGTGGGCGGTGG + Intergenic
1177359293 21:20048298-20048320 GGCCACTCCCAAGATGGTGGCGG + Intergenic
1178506622 21:33168084-33168106 AGCCAGGCCAAAGAAGGTGGTGG + Intronic
1179912375 21:44456958-44456980 GGCCAGGCCCGCGAAGGTGGCGG - Exonic
1180742144 22:18061240-18061262 GGCCATGTCCAAGGCGACGGTGG + Intergenic
1181080616 22:20412394-20412416 GGTCATGCCCAAGTATGCCGTGG - Intergenic
1183479771 22:38057164-38057186 TGCCCTTCCCAAGATGGCGGCGG + Intronic
1183948502 22:41339949-41339971 GACCAAGCCGAAGGAGGCGGGGG - Exonic
1184118211 22:42434214-42434236 GGCCAGGCTCAAGAAGGAGAGGG - Intergenic
1185133254 22:49052467-49052489 GGCCCTTCCCAAGATGGCCGGGG - Intergenic
1185284287 22:49993444-49993466 GTCCCTGGCCAAGGAGGCGGTGG + Intergenic
950106428 3:10391845-10391867 GTCCAGGGCCAAGAAGGCAGAGG - Intronic
950678517 3:14569118-14569140 GGCAAAGCCCCATAAGGCGGGGG - Intergenic
953558996 3:43970510-43970532 GCACAAGCCCACGAAGGCGGGGG + Intergenic
955331205 3:58049245-58049267 GGCCATCCCCGAGAAGGCGGTGG - Intronic
955368813 3:58333210-58333232 GGCCCTGGCCGAGAAGGCTGTGG + Intronic
955380410 3:58433800-58433822 GGACACGACCAAGATGGCGGCGG - Exonic
955943110 3:64165290-64165312 GGCCATGCCCTAGAGGGTGCAGG - Intronic
957052272 3:75419871-75419893 GGACCTGCCCATGAAGGTGGTGG + Intergenic
959449956 3:106486866-106486888 GGCCACCTCCAAGATGGCGGTGG + Intergenic
961302582 3:125931684-125931706 GGACCTGCCCATGAAGGTGGTGG - Exonic
961885888 3:130096095-130096117 GGACCTGCCCATGAAGGTGGTGG + Exonic
964375418 3:156044409-156044431 GGACCTGCCCATGAAGGTGGTGG - Intronic
968995074 4:3940241-3940263 GGACCTGCCCATGAAGGTGGTGG + Intergenic
969423693 4:7111631-7111653 GGCCCTGCCTCAGAAGGCCGAGG - Intergenic
969568163 4:7992448-7992470 GGGCATCCCCGAGAAGGAGGTGG + Intronic
969758911 4:9168547-9168569 GGGCCTGCCCATGAAGGTGGTGG - Intergenic
969818888 4:9706020-9706042 GGACCTGCCCATGAAGGTGGTGG - Intergenic
970591853 4:17566696-17566718 GGCCATGTCCACGGAGGAGGGGG - Intergenic
976096859 4:81517608-81517630 GGCCATGCAAAAGAAGGTGGTGG + Intronic
982332175 4:154192821-154192843 GGCCACTCCCAAGATGGTGGCGG - Intergenic
983171072 4:164537081-164537103 GGCCTTGCCCAAGTATGCTGGGG + Intergenic
985087611 4:186329524-186329546 GGCCATCTCCAAGATGGCGGTGG - Intergenic
987645231 5:20662620-20662642 GGCCATGCATTAGAAGGCGTGGG + Intergenic
991483920 5:67114132-67114154 GGCCATGCCAAAGAAGGACAGGG + Exonic
994608308 5:102000113-102000135 AGCCAGGCTCTAGAAGGCGGGGG - Intergenic
1001052396 5:168423776-168423798 GGCCAAGACCCAGAAGGCAGAGG + Exonic
1001532038 5:172469985-172470007 GCCCATGCCCACGAAGGCCAAGG - Intergenic
1001902331 5:175442850-175442872 GGTCATGCCCTGGAAGGCAGTGG - Exonic
1003639984 6:7868526-7868548 GGCCAGGCCCATGAAGACAGAGG + Intronic
1004369559 6:15040325-15040347 TGCCATGCCCTAGAAGGGAGTGG - Intergenic
1007089424 6:39172924-39172946 GGCCAGGCCCTAGAAGGCAGGGG + Intergenic
1011506342 6:88048023-88048045 GGCCTGGCCCACGAAGGCGAGGG + Exonic
1016386055 6:143531888-143531910 GGTCATGCTAGAGAAGGCGGGGG + Intergenic
1019633891 7:2065206-2065228 GACTGGGCCCAAGAAGGCGGGGG - Intronic
1019921097 7:4163692-4163714 GACCATGCCCAGGAAGGCTGCGG - Intronic
1020086547 7:5313567-5313589 CCCCAAGCCCAAGAAGGCGCGGG - Exonic
1020319335 7:6928566-6928588 GGACCTGCCCATGAAGGTGGTGG + Intergenic
1023806873 7:43878656-43878678 GTCCATGCGCACGAAGGCGAAGG + Exonic
1025207766 7:57003571-57003593 CCCCAAGCCCAAGAAGGCGCGGG + Intergenic
1025664170 7:63573301-63573323 CCCCAAGCCCAAGAAGGCGCGGG - Intergenic
1026403918 7:70044426-70044448 GGCCATCCCAAAAAAGGCAGAGG - Intronic
1027134735 7:75616231-75616253 GGCCATGCACAAGCAGGCTGAGG - Intronic
1027228880 7:76260968-76260990 GGCCATCCCCCAGAGGCCGGAGG + Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1036616187 8:10389636-10389658 GCCCTTGCCCTAGAGGGCGGAGG + Intronic
1036847595 8:12180412-12180434 GGACCTGCCCATGAAGGTGGTGG + Intergenic
1037771276 8:21801549-21801571 GGCCAGGCCTATGAAGGGGGTGG - Intronic
1038425694 8:27462535-27462557 GCCCATGAACAAGGAGGCGGAGG + Intronic
1043792173 8:84485061-84485083 AACGATGCTCAAGAAGGCGGCGG - Intronic
1044988229 8:97773864-97773886 GGCCACTCCCAAGATGGTGGCGG + Intergenic
1045863458 8:106839057-106839079 GGCCACTCCCAAGATGGTGGCGG + Intergenic
1046130594 8:109963085-109963107 GGGCAGGCACAAGAAGGCAGTGG + Intergenic
1048100201 8:131342900-131342922 GCCCACTCCCAAGATGGCGGTGG + Intergenic
1049000392 8:139822332-139822354 GGCCATGCCTTAGAAGGCTGTGG - Intronic
1049690533 8:143957030-143957052 GGCAACCCCCAAGAAGGTGGAGG + Intronic
1057260004 9:93577744-93577766 GGCAAGGGCCAAGAGGGCGGGGG - Intronic
1059933747 9:119286761-119286783 GGTCATGCACAAGAGGACGGGGG + Intronic
1060285433 9:122247544-122247566 GGCCCTGTCCAAGAAGCTGGTGG - Exonic
1061281831 9:129602020-129602042 GGGCCTGCCCAAGAAGGATGGGG - Intergenic
1062305626 9:135905483-135905505 AGCCATGCCCAAGAATGCACTGG + Intronic
1062622441 9:137428953-137428975 GGCCATGTCCAAGTGGCCGGAGG + Exonic
1203746062 Un_GL000218v1:41227-41249 TGCCATGCTCAAGTGGGCGGTGG + Intergenic
1185560980 X:1060440-1060462 GGCCACTCCCAAGATGGTGGCGG - Intergenic
1185560987 X:1060462-1060484 GGCCACTCCCAAGATGGCGGCGG - Intergenic
1188981134 X:36728284-36728306 GGCCATGCCTATTAAGGAGGTGG + Intergenic
1191588168 X:62851423-62851445 GGACATCCCCAAAAAGGAGGTGG - Intergenic
1201159387 Y:11156239-11156261 TGCCATGCTCAAGTGGGCGGTGG + Intergenic