ID: 1130121199

View in Genome Browser
Species Human (GRCh38)
Location 15:81049086-81049108
Sequence GGATTCTCTTGTTCTCCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130121199_1130121203 20 Left 1130121199 15:81049086-81049108 CCGAGTGGAGAACAAGAGAATCC 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1130121203 15:81049129-81049151 TTTAAAGCTTGGCTTTGTTGTGG 0: 1
1: 0
2: 1
3: 26
4: 221
1130121199_1130121202 9 Left 1130121199 15:81049086-81049108 CCGAGTGGAGAACAAGAGAATCC 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1130121202 15:81049118-81049140 CAAATAGCTTATTTAAAGCTTGG 0: 1
1: 0
2: 1
3: 17
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130121199 Original CRISPR GGATTCTCTTGTTCTCCACT CGG (reversed) Intronic
902788519 1:18748981-18749003 TGTTTCTCTTGCTCCCCACTGGG + Intergenic
903671940 1:25041270-25041292 GCATTCTCTTATTCACCACCTGG - Intergenic
903794367 1:25917749-25917771 GGATTCTCCATTTTTCCACTGGG + Intergenic
903805503 1:26002665-26002687 GGATTCATTTGAACTCCACTTGG - Intergenic
905417123 1:37811728-37811750 GGCTTCTCTTCTTCACCTCTGGG - Exonic
905439860 1:37988555-37988577 GGATTTTCTTTTTTTCCCCTTGG - Intronic
908475330 1:64482246-64482268 GGATTTTTTTTTTCCCCACTTGG + Intronic
909169717 1:72280889-72280911 AGATCTTCTTTTTCTCCACTGGG - Intronic
911434717 1:97842908-97842930 CCATCCTCTTGTTCTGCACTTGG + Intronic
911460703 1:98186304-98186326 GGATTATCTTCTTTTTCACTTGG + Intergenic
912285538 1:108364830-108364852 GGATTCTTTCCTTTTCCACTGGG - Intergenic
913042006 1:115036140-115036162 AGTCTCTCTTGCTCTCCACTGGG - Intergenic
913612767 1:120524338-120524360 GGATTCTCCTCTTCTCCATGGGG - Intergenic
914578424 1:148997909-148997931 GGATTCTCCTCTTCTCCATGGGG + Intronic
919089082 1:192956520-192956542 GGATTCTCTACTTCTCTACTAGG - Intergenic
921618659 1:217301725-217301747 GGTTTCCCTTGATCCCCACTTGG - Intergenic
921637641 1:217514853-217514875 CCATTCTCTTGTTACCCACTGGG + Exonic
922582122 1:226706320-226706342 GGAGTCTCTTGTACTTAACTTGG - Intronic
922896841 1:229107415-229107437 GGGATCTCTTATTCCCCACTGGG + Intergenic
923044326 1:230344445-230344467 GGATTCATTTTTTCTCCACAAGG - Intronic
923376670 1:233370827-233370849 GGATTGTCTTTTTCTCCAGACGG + Intronic
923578281 1:235181959-235181981 GGTTTTTCTAGTTCTACACTGGG + Exonic
924678355 1:246203980-246204002 GTACTCTCTTGTTCTCCATCCGG - Intronic
1063489889 10:6454335-6454357 AGATGCTCATGTTCTGCACTAGG + Intronic
1065264941 10:23965117-23965139 GGCTGCACTTGTTCTCCAGTTGG - Intronic
1070933878 10:80278824-80278846 GCCTTCTCTTGTCCTGCACTTGG - Intronic
1075926151 10:126253426-126253448 TCATTCTCTTGTTCTCCAGAGGG + Intronic
1077647356 11:3937455-3937477 AGATTCTTTAGTTCTCTACTTGG - Intronic
1081744556 11:45463766-45463788 AGATTCTCTTAGTCTCCGCTGGG - Intergenic
1087305839 11:96487849-96487871 GGTGTCTCTTGTCCTCTACTGGG - Intronic
1090127945 11:124108752-124108774 GAATTCTATTGTTCTCTGCTTGG + Intergenic
1090494532 11:127197275-127197297 TGATTCTGCTGATCTCCACTGGG - Intergenic
1090859386 11:130639645-130639667 ACATCCTCTTCTTCTCCACTTGG + Intergenic
1092357426 12:7808235-7808257 GGATTCTCTTGTGTTCTTCTGGG + Intergenic
1095725290 12:45445730-45445752 GGATTTTCTGGTTCCCCAGTGGG - Intergenic
1096263954 12:50109555-50109577 GGCTTCTGCTGGTCTCCACTGGG - Exonic
1101984527 12:109435358-109435380 AGATTCTGTTGTTCACTACTAGG + Intronic
1102578098 12:113869843-113869865 GGATTCTCTTCATCTCCTCTTGG - Intronic
1105686021 13:22782800-22782822 GAGTTCTCATGTTCTCCCCTTGG + Intergenic
1106036525 13:26050149-26050171 GGATTCCCATCTTCTCCACGCGG - Intronic
1106213231 13:27670205-27670227 GGAAACTCTTGTTCTCAACATGG + Intergenic
1112005284 13:95248249-95248271 GGATTCTTTTGTTATTCAGTGGG - Intronic
1116097527 14:40389523-40389545 GGATTCTCTTGTTCTTCATTAGG + Intergenic
1117200243 14:53382707-53382729 GGATGCTCTTGTGCTGCACTGGG - Intergenic
1121774477 14:96581672-96581694 GGCTTCTCTTTTTGTCCACGCGG + Intergenic
1129223988 15:74155226-74155248 GAATACTCTTGCTGTCCACTGGG - Intergenic
1129300745 15:74624120-74624142 GGACTGTCTCGTTCCCCACTGGG + Intronic
1129718313 15:77864520-77864542 GGATTCTCTGGGTCTCCCCCAGG - Intergenic
1130121199 15:81049086-81049108 GGATTCTCTTGTTCTCCACTCGG - Intronic
1130792280 15:87168290-87168312 GGCTTTCCTGGTTCTCCACTTGG - Intergenic
1131279608 15:91009949-91009971 GGGTTCTCTTGTCTTTCACTGGG - Intronic
1132223333 15:100121839-100121861 GCATTCTCCTGTACTCCAGTGGG + Intronic
1133700589 16:8304755-8304777 GGACTCTCTTTGGCTCCACTTGG + Intergenic
1136244505 16:28966092-28966114 GAATTATCTTGTTCTGCAGTTGG + Exonic
1137770391 16:51011882-51011904 TGTTTCTCTTGTTCACCACTGGG + Intergenic
1140192598 16:72830681-72830703 TTATTCTCTTCTTCCCCACTTGG - Intronic
1140326746 16:74011907-74011929 GGCTTCTGTTGTTTCCCACTAGG - Intergenic
1141793402 16:86252056-86252078 GGTGGCTCTTGTCCTCCACTAGG + Intergenic
1145239463 17:21231690-21231712 GGATTCTCCCTCTCTCCACTGGG + Intergenic
1147178120 17:38669395-38669417 GGATTCTGTTTTCCTCCCCTAGG - Intergenic
1147592918 17:41696605-41696627 GGTTTCTCTTGTTCATCACTGGG - Intergenic
1150907724 17:69355958-69355980 GGATTCTCTTCTTCTTCAGAAGG - Intergenic
1159868932 18:73738949-73738971 AGAATCTCTTATTCTGCACTTGG - Intergenic
1161304510 19:3559495-3559517 TGATTCTCTGCTGCTCCACTTGG + Intronic
1161742253 19:6029167-6029189 GGATTCTTCTGTTCTCCCCAGGG - Intronic
1164861836 19:31567810-31567832 GGATTCACTTGTACAGCACTAGG - Intergenic
1165183215 19:33991025-33991047 GGATTCTTTTTTTTTCCCCTGGG - Intergenic
1166208471 19:41289368-41289390 GGGTTATTCTGTTCTCCACTTGG - Intronic
1166262776 19:41652920-41652942 TGATTTTCATGTTTTCCACTTGG + Intronic
1167008769 19:46792560-46792582 GAACTGTCTTGTTCGCCACTGGG - Intergenic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
926763896 2:16305409-16305431 AGATTCTCAAGGTCTCCACTTGG + Intergenic
927072191 2:19542400-19542422 GGAATCTCAGGTTCTCCAGTTGG - Intergenic
927125585 2:20010320-20010342 TGATTCTTTCCTTCTCCACTTGG + Intronic
928281859 2:29953566-29953588 GGATTTTCTTGAATTCCACTGGG - Intergenic
932488219 2:72099720-72099742 GGATTCTTTTGTTATTCAATGGG - Intergenic
934994040 2:98940793-98940815 GTATTGTCTTGTTTTCAACTTGG + Intergenic
936355124 2:111743399-111743421 GGACTCTCTCGTTCAGCACTTGG + Intergenic
938735823 2:134185902-134185924 GGATTCTCTTCTTCTGAACCAGG - Intronic
939425061 2:142024901-142024923 GTATTCTCTTTATCTCCATTGGG - Intronic
940483667 2:154269650-154269672 TGTTTCTCTTGTTCCCCATTTGG + Intronic
940788302 2:158005483-158005505 TGATTCTGTTGTTTTCCACCTGG - Intronic
940854467 2:158718980-158719002 GGGTTCTTCTGGTCTCCACTGGG + Intergenic
941060491 2:160842070-160842092 GGATTTTCAGGTTCTCCAGTGGG - Intergenic
942499400 2:176572928-176572950 GGATTCTCTTGTGCTGTCCTTGG - Intergenic
943066226 2:183089516-183089538 GGATTTTCTAATTCTCAACTTGG - Intronic
943364399 2:186955617-186955639 GTATTCTCTTTTTGTCTACTAGG - Intergenic
943623696 2:190177455-190177477 GGATTCACTTGTCTGCCACTGGG - Intronic
944139242 2:196437287-196437309 GGATTCTCTTCATCTTCACCGGG - Intronic
946723507 2:222637296-222637318 GGAGTCTCCTGGACTCCACTGGG - Intronic
947702598 2:232247228-232247250 GCATTCTTGTGTTCTCCTCTGGG - Intronic
1169836551 20:9886198-9886220 AGATTCTCTTGTCTGCCACTAGG - Intergenic
1173042919 20:39481725-39481747 GAATTCTGTTTTTCTCCTCTTGG - Intergenic
1177224765 21:18239719-18239741 GGATTATCTTTTACTCAACTTGG + Intronic
1183061851 22:35340956-35340978 GGATTCTCTTGTTGCCCACTGGG - Intronic
1184314359 22:43672679-43672701 AAATTCTCTTGTTCTCCGATAGG - Intronic
950430763 3:12949682-12949704 GGATGGTCTTGTTCTGCACAGGG + Intronic
950448628 3:13053308-13053330 GGATTCACTGGTTCTGCATTAGG - Intronic
951000693 3:17555928-17555950 GGATCCTCTTGTTGTCCAAGGGG - Intronic
951140601 3:19154009-19154031 GGATTATCTTTTTCTCAAATGGG + Intronic
951924181 3:27888791-27888813 GGAGTCTCTTGTGTTCCACAAGG - Intergenic
953217909 3:40938304-40938326 GGATGCTCTACTACTCCACTGGG + Intergenic
954841443 3:53515234-53515256 GGTGTCTCTTGTTCTCTGCTTGG + Intronic
955673844 3:61429496-61429518 GGATTTTCTTTTTTTCCCCTGGG + Intergenic
958517448 3:95136185-95136207 GGCTTATTTTTTTCTCCACTTGG + Intergenic
959017367 3:101150554-101150576 GCAGTCTTTTGATCTCCACTTGG + Intergenic
960570854 3:119183916-119183938 GCATTCTCTTCTTCTCCCTTAGG - Intronic
964058887 3:152496337-152496359 GGATTCTCTTGTGTTCTTCTGGG + Intergenic
964751149 3:160054971-160054993 GTATTCTCTTTTTGTCTACTAGG - Intergenic
965049136 3:163621853-163621875 GGTTTTTCTTTTTCTCTACTAGG - Intergenic
965674680 3:171182201-171182223 GGGTTCTCTTGTTTTCCAAAAGG + Intronic
967958804 3:194901676-194901698 GGATTTTCAGGTTCTCCAGTGGG + Intergenic
968613351 4:1566892-1566914 GGTCTCTCTTCTTCTCCACAGGG + Intergenic
969451566 4:7276795-7276817 GGAAGCTCTTCTGCTCCACTAGG - Intronic
969935459 4:10675481-10675503 GAGAACTCTTGTTCTCCACTGGG + Intronic
973256760 4:48121222-48121244 GCATTCTCAAATTCTCCACTTGG + Intronic
973816748 4:54626313-54626335 GGAGTCTTTTGTTTTCCTCTGGG + Intergenic
974804708 4:66863051-66863073 GGATTCTGTTGATGTCTACTGGG + Intergenic
977001397 4:91508790-91508812 AGATTTTCTTGTTCTTCATTCGG + Intronic
978282828 4:107037214-107037236 GGCTTCTCTTGTAATTCACTGGG - Intronic
980119495 4:128713164-128713186 GGACTTTTTTGTTCTTCACTTGG - Intergenic
981779581 4:148411900-148411922 GGATTTTCTTGTTCTTTACTTGG - Intronic
982676404 4:158381177-158381199 AGACTCTCTTGTTCTTCATTAGG - Intronic
983257288 4:165414558-165414580 GTATTCTCTTGTAGGCCACTTGG + Intronic
986364690 5:7018819-7018841 GCTTTCTCTTTTTCTCCACAAGG + Intergenic
992415301 5:76546923-76546945 GGATTCTTTTTTTCTCTTCTTGG + Intronic
993305588 5:86271552-86271574 GGATTCTTTCCTTTTCCACTGGG - Intergenic
996944124 5:129046312-129046334 GGCTTTCCTTGTTCTCCACCTGG - Intergenic
997179892 5:131817234-131817256 GGCTTCTCTGGTTCTCCAGCTGG + Intronic
998104059 5:139457161-139457183 CCATTCTCTTGTTCACCTCTGGG + Intronic
999546161 5:152630892-152630914 GGATTATCTTGTCTTCCACCAGG + Intergenic
1000651924 5:163829441-163829463 GGGTTCTCTTTTTCTACATTTGG + Intergenic
1001323257 5:170700130-170700152 GGCTTATCTTGTTCTCCTGTGGG + Intronic
1001416893 5:171551585-171551607 TCATTCTCATGATCTCCACTTGG - Intergenic
1004416601 6:15430046-15430068 AGATTCTCTGGTTCTTCCCTTGG + Intronic
1004890291 6:20094804-20094826 GGGTGCTCTTGTTCTCCAGCTGG - Intergenic
1007904196 6:45442919-45442941 GGATCCTCTTCCTCTCCACGTGG + Intronic
1007944386 6:45812309-45812331 GTATGCTCTCTTTCTCCACTAGG + Intergenic
1008471038 6:51885596-51885618 TGATTCTGTTGTTCTCTTCTAGG + Intronic
1010963260 6:82172071-82172093 GTATTCTCTAGTGCTGCACTTGG - Intronic
1011585469 6:88919986-88920008 GGATTCAGTAGTTCTCAACTGGG + Intronic
1014278684 6:119417096-119417118 GGATTTTCATGATCTCCAGTAGG + Intergenic
1015745542 6:136505639-136505661 GGATCCTCTTGTCCTCCGGTAGG - Intronic
1020370026 7:7421967-7421989 GGGTTTTCATGTTCTCTACTTGG - Intronic
1020495490 7:8846560-8846582 TGTTTCTCTTTTTTTCCACTTGG + Intergenic
1022738577 7:33099479-33099501 GGATTCTCTCCTGCTCCCCTTGG + Intronic
1023618337 7:42044017-42044039 AGATTCTGTTGGTTTCCACTGGG - Intronic
1024141744 7:46469014-46469036 CGATGCTCTTGCTCTCAACTGGG + Intergenic
1027631686 7:80614395-80614417 AGATTCTCTTGTTGGCCAGTGGG - Intronic
1028108850 7:86914105-86914127 GGTTTATCTTGTTCTCACCTTGG + Intronic
1030260776 7:107562129-107562151 GGATCCTCTTTTTCTCCCCAGGG + Intronic
1030919978 7:115371172-115371194 GGATTCACTTTTTCTGGACTGGG + Intergenic
1034834875 7:154342943-154342965 GGATGCTCTTGGTCTCATCTTGG - Intronic
1035344859 7:158191273-158191295 GCATCCTCTTGGACTCCACTGGG - Intronic
1035766845 8:2113319-2113341 GGATTGTGTTGTACTCCACCTGG - Intronic
1039823070 8:41150935-41150957 GGATTGTCTTGTTGTTCTCTTGG - Intergenic
1040868125 8:52070968-52070990 GGATTTTCAGGTTCTCCAGTGGG + Intergenic
1044312715 8:90712532-90712554 GACCTCTCTTGTTCTCCACATGG + Intronic
1049184924 8:141245103-141245125 TCATTATCTTTTTCTCCACTTGG - Intronic
1049996972 9:1043370-1043392 GGATTCTCCTGTTCTACTCCTGG - Intergenic
1051769555 9:20561989-20562011 GGATTCTCTCCATCTCCCCTTGG - Intronic
1052261878 9:26526174-26526196 GGATTATCTTTTTCTTCACTTGG + Intergenic
1053458162 9:38247215-38247237 GGATTGTCTTGTTGTCAACTTGG - Intergenic
1059470770 9:114503643-114503665 AGGACCTCTTGTTCTCCACTTGG - Intronic
1059972924 9:119685975-119685997 AGATTCTCATGGTCTCTACTGGG + Intergenic
1060062419 9:120472726-120472748 GCATTTTCTTGGTCTCCTCTGGG - Intronic
1187334086 X:18366585-18366607 GGTTTCTCATGTTCTGGACTTGG + Intergenic
1192157188 X:68755323-68755345 GGGTTCTATTATACTCCACTGGG - Intergenic
1194645647 X:96455322-96455344 GGCTTCTCTTGTACACCACCTGG - Intergenic
1196183016 X:112715624-112715646 GGATTCTTGTGTTCATCACTAGG - Intergenic
1196462495 X:115944923-115944945 GGAGTCTCTTGCTGGCCACTTGG - Intergenic
1196649871 X:118157760-118157782 GGACTGTCTTGTTCTCCTCGTGG - Intergenic
1196894658 X:120323028-120323050 AGCTTTTCTGGTTCTCCACTGGG - Intergenic
1197118513 X:122862438-122862460 GGATTATTTTCTTCCCCACTGGG + Intergenic
1197883584 X:131194124-131194146 GGATCATCTTGTACACCACTAGG - Intergenic
1199340942 X:146676313-146676335 GACTTCTCTTTTTCCCCACTGGG + Intergenic
1199451316 X:147981611-147981633 GGATGCTCATGCTCTCCATTTGG + Exonic
1199586732 X:149423012-149423034 GGATTTTCAGGTTCTCCAGTGGG - Intergenic
1201192531 Y:11457977-11457999 GGCTGCTATTGTTCTCCACACGG - Intergenic
1201418079 Y:13768034-13768056 GGATTTTCATTTTCTCCAGTGGG + Intergenic