ID: 1130123346

View in Genome Browser
Species Human (GRCh38)
Location 15:81071089-81071111
Sequence GGACGAACTTAACATCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130123346_1130123351 14 Left 1130123346 15:81071089-81071111 CCAATCAGATGTTAAGTTCGTCC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1130123351 15:81071126-81071148 AGAGTTTGCTTCTTTTTGTTTGG 0: 1
1: 0
2: 5
3: 48
4: 540
1130123346_1130123347 -10 Left 1130123346 15:81071089-81071111 CCAATCAGATGTTAAGTTCGTCC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1130123347 15:81071102-81071124 AAGTTCGTCCCCTGCATATTTGG 0: 1
1: 0
2: 0
3: 2
4: 41
1130123346_1130123352 15 Left 1130123346 15:81071089-81071111 CCAATCAGATGTTAAGTTCGTCC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1130123352 15:81071127-81071149 GAGTTTGCTTCTTTTTGTTTGGG 0: 1
1: 0
2: 6
3: 163
4: 1911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130123346 Original CRISPR GGACGAACTTAACATCTGAT TGG (reversed) Intronic