ID: 1130123346 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:81071089-81071111 |
Sequence | GGACGAACTTAACATCTGAT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 95 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 90} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1130123346_1130123351 | 14 | Left | 1130123346 | 15:81071089-81071111 | CCAATCAGATGTTAAGTTCGTCC | 0: 1 1: 0 2: 0 3: 4 4: 90 |
||
Right | 1130123351 | 15:81071126-81071148 | AGAGTTTGCTTCTTTTTGTTTGG | 0: 1 1: 0 2: 5 3: 48 4: 540 |
||||
1130123346_1130123347 | -10 | Left | 1130123346 | 15:81071089-81071111 | CCAATCAGATGTTAAGTTCGTCC | 0: 1 1: 0 2: 0 3: 4 4: 90 |
||
Right | 1130123347 | 15:81071102-81071124 | AAGTTCGTCCCCTGCATATTTGG | 0: 1 1: 0 2: 0 3: 2 4: 41 |
||||
1130123346_1130123352 | 15 | Left | 1130123346 | 15:81071089-81071111 | CCAATCAGATGTTAAGTTCGTCC | 0: 1 1: 0 2: 0 3: 4 4: 90 |
||
Right | 1130123352 | 15:81071127-81071149 | GAGTTTGCTTCTTTTTGTTTGGG | 0: 1 1: 0 2: 6 3: 163 4: 1911 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1130123346 | Original CRISPR | GGACGAACTTAACATCTGAT TGG (reversed) | Intronic | ||