ID: 1130125403

View in Genome Browser
Species Human (GRCh38)
Location 15:81089679-81089701
Sequence ATAAACTATCTGGCTCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130125403_1130125406 26 Left 1130125403 15:81089679-81089701 CCAGACTGAGCCAGATAGTTTAT 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1130125406 15:81089728-81089750 TGAGTCAGCCTTTATGGTGATGG 0: 1
1: 0
2: 0
3: 9
4: 133
1130125403_1130125405 20 Left 1130125403 15:81089679-81089701 CCAGACTGAGCCAGATAGTTTAT 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1130125405 15:81089722-81089744 CTTTATTGAGTCAGCCTTTATGG 0: 1
1: 0
2: 0
3: 19
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130125403 Original CRISPR ATAAACTATCTGGCTCAGTC TGG (reversed) Intronic
907942028 1:59097329-59097351 ATAAAATATCTCCCTCAGTTTGG + Intergenic
911203059 1:95066008-95066030 ACAAGCTCTCTGCCTCAGTCAGG + Intronic
912700374 1:111873857-111873879 ATAAAATATCTGGCACAAGCAGG + Intronic
914719725 1:150279956-150279978 TTAAACTATGTTGCTCAGCCTGG - Intronic
915970413 1:160351182-160351204 ACAAACTAGCTGTCTCAGTGGGG + Intronic
916432094 1:164740275-164740297 ATCAAGTATATGGCTCAGTATGG - Intronic
917715303 1:177730107-177730129 ATAAACTATCTGGCTAGTTTTGG - Intergenic
922354800 1:224765523-224765545 CTAAACCATGTGGCTCAGACTGG + Intergenic
923366657 1:233268336-233268358 ATAAAAAATCTGGCTGAGTGAGG + Intronic
1064278149 10:13926295-13926317 CTCAACTATCTGGACCAGTCTGG - Intronic
1073862695 10:107765780-107765802 AAAAACAATCTTGATCAGTCTGG + Intergenic
1074638828 10:115354500-115354522 ATATGCTATCTTGCTCATTCTGG + Intronic
1075580120 10:123611186-123611208 ATAAAATATCTGCCTCAGAATGG + Intergenic
1079012966 11:16844846-16844868 ATCAACTGACTGGCTCATTCTGG + Intronic
1079323644 11:19473160-19473182 AGAAGCTATGTGGCTTAGTCAGG + Intronic
1079703663 11:23585456-23585478 ATAAAATAATTAGCTCAGTCTGG - Intergenic
1082792988 11:57360023-57360045 ATAAACTAGGTGGCACAGCCGGG + Intronic
1084969257 11:72761197-72761219 ATTCACTGTCTGGCTCTGTCTGG - Intronic
1086109586 11:83184989-83185011 ATAAATTGTCTGGCTGAGGCAGG + Exonic
1087841234 11:102923008-102923030 ATAAAGTATGGGGCCCAGTCTGG + Intergenic
1088732690 11:112697234-112697256 AAGAGCTATCTGGCTCAGTAGGG + Intergenic
1089884457 11:121806261-121806283 ATCATTTATTTGGCTCAGTCTGG + Intergenic
1090863527 11:130675261-130675283 TTAAACTCTCTTGCTCAGTAAGG - Intronic
1091976733 12:4831474-4831496 AAAAACGTTCTGGTTCAGTCTGG + Intronic
1093697758 12:22181411-22181433 ATAAAATAATTTGCTCAGTCTGG + Intronic
1093754475 12:22837153-22837175 GTACACTATCTGGTTCAGCCTGG + Intergenic
1095642262 12:44499619-44499641 AAAAACTAACTGGCTTAGTTAGG + Intergenic
1100485755 12:95025360-95025382 ATAAAATGTGTGGCTCAGGCCGG + Intronic
1100703860 12:97179014-97179036 ATCAACTATCTGGGTCAATTTGG + Intergenic
1101215232 12:102575104-102575126 ATAAAATATCTGGCTGGGTGTGG + Intergenic
1102393422 12:112567964-112567986 ATAAACTGTCTGCATCTGTCTGG + Intergenic
1105206016 13:18224977-18224999 ATAAAGTGTGTGGCTCAGCCAGG - Intergenic
1105590287 13:21786729-21786751 AGAAACTAAATGGCTCAGTGTGG - Intergenic
1108009508 13:45990366-45990388 ATAAACTATGTTACTAAGTCAGG + Intronic
1108586165 13:51871604-51871626 TGCAACCATCTGGCTCAGTCTGG - Intergenic
1109436532 13:62310979-62311001 ATAAATAATCTGGCTAAGACTGG + Intergenic
1111425132 13:88069967-88069989 TTAAACCATCTTGCTTAGTCTGG - Intergenic
1113444377 13:110354341-110354363 CTAAACTTTCTGGCTTAGTATGG + Intronic
1114588692 14:23839341-23839363 ATACAGTATTTGGCTCATTCTGG - Intergenic
1120187516 14:81409626-81409648 ATAAAGTAACTGGCTCAGAGAGG + Intronic
1127093433 15:55489381-55489403 ACAAAGTATATGGCTCAGTGCGG + Intronic
1130125403 15:81089679-81089701 ATAAACTATCTGGCTCAGTCTGG - Intronic
1130291273 15:82603631-82603653 GTAAACTGTCTGGCTCAGTGTGG + Intronic
1130291739 15:82607994-82608016 GTAAACTGTCTGGCTCAGTGTGG - Intronic
1131203134 15:90417788-90417810 ATAAATTACCTTGCTCAGTATGG + Intronic
1134337950 16:13318704-13318726 AGAAACTAGCTGTCTCTGTCTGG + Intergenic
1139303477 16:65964150-65964172 ATAAACTATTTGTAACAGTCTGG - Intergenic
1140769537 16:78190743-78190765 ATTAATTATCTGGCTCAGGTTGG - Intronic
1144326089 17:14181652-14181674 TTCAACTATCTGGCTCAGTCAGG + Intronic
1144474963 17:15578540-15578562 TTCAACTATCTGGCTCAATCAGG + Intronic
1146729115 17:35179130-35179152 ATAAACTATCTTGGGCAGTATGG + Intronic
1146767030 17:35532552-35532574 ATAAAGTACCTGGCTCCGTTGGG + Intronic
1149938164 17:60830778-60830800 ATAAATTTTCTGGCTCAATAAGG + Intronic
1150834967 17:68555743-68555765 AACAACTATCTGGCTCTTTCAGG - Exonic
1151883667 17:76910837-76910859 ATGAACGATCTGGCTCAGACAGG + Intronic
1154018600 18:10643106-10643128 ATAAAGGATGTGGCTCAGCCAGG + Intergenic
1154185628 18:12180316-12180338 ATAAAGGATGTGGCTCAGCCAGG - Intergenic
1157339152 18:46763940-46763962 ATAAACTTTGTGGCCCAGACAGG + Intergenic
1159576633 18:70186456-70186478 ATAAACAACATGGCTCAGCCGGG + Intronic
1162916714 19:13878215-13878237 ATAAACAAACTGGCTCGGTGCGG - Intronic
1164446047 19:28318465-28318487 ATAAATTACCAGGCTCGGTCAGG - Intergenic
1167558637 19:50211638-50211660 ACAGACTACCTGGCTCTGTCAGG - Intronic
926515468 2:13840038-13840060 ATATACTATCTGTATCAGTCAGG + Intergenic
929634368 2:43502287-43502309 ATAAAATATCTTTCTCAGTCAGG + Intronic
932439615 2:71724859-71724881 ATAAACTATTTTCCTCATTCTGG - Intergenic
934489333 2:94749010-94749032 AGAAACTGTCTGGGACAGTCTGG + Intergenic
944904536 2:204249665-204249687 ATAAACCACCCAGCTCAGTCAGG + Intergenic
945476626 2:210290152-210290174 ATAAACAATTTTGGTCAGTCTGG - Exonic
947012735 2:225583448-225583470 ATACACTATTTGGCTTAGTGTGG - Intronic
1171814458 20:29772267-29772289 ATAAATTATCTGGGGCAGTATGG - Intergenic
1172661008 20:36568748-36568770 AAAAACTATCTGGCTAGGTCTGG - Intergenic
1173233610 20:41222828-41222850 GTAAACTATCTGGCCCACACTGG - Intronic
1174671873 20:52315780-52315802 ATAAACTATCAGGATCAGACAGG + Intergenic
1175336810 20:58201634-58201656 ATGAACTAATTGGCTCGGTCAGG + Intergenic
1176840391 21:13837156-13837178 AGAAACTGTCTGGGACAGTCTGG + Intergenic
1178275845 21:31236236-31236258 ATAAAGAATTTGGCTCACTCCGG - Intronic
1180759949 22:18193739-18193761 ATAAAGTGTGTGGCTCAGCCAGG + Intergenic
1180770261 22:18378038-18378060 ATAAAGTGTGTGGCTCAGCCAGG + Intergenic
1180775719 22:18430961-18430983 ATAAAGTGTGTGGCTCAGCCAGG - Intergenic
1180776069 22:18484628-18484650 ATAAAGTGTGTGGCTCAGCCAGG - Intergenic
1180808792 22:18741998-18742020 ATAAAGTGTGTGGCTCAGCCAGG - Intergenic
1180828202 22:18880994-18881016 ATAAAGTGTGTGGCTCAGCCAGG + Intergenic
1181071721 22:20346972-20346994 ATAAAGTGTGTGGCTCAGCCAGG - Intergenic
1181194790 22:21175914-21175936 ATAAAGTGTGTGGCTCAGCCAGG - Intergenic
1181214655 22:21316856-21316878 ATAAAGTGTGTGGCTCAGCCAGG + Intergenic
1181344800 22:22211257-22211279 ACAAACTCTATGGCTCAGGCTGG + Intergenic
1181525057 22:23478098-23478120 ATAAAGTGTGTGGCTCAGCCAGG + Intergenic
1203232093 22_KI270731v1_random:119222-119244 ATAAAGTGTGTGGCTCAGCCAGG + Intergenic
1203278298 22_KI270734v1_random:106996-107018 ATAAAGTGTGTGGCTCAGCCAGG + Intergenic
955925018 3:63996028-63996050 AAAAACTGTGTGGCTCACTCTGG + Exonic
959614610 3:108333210-108333232 ATAAATTATGTGGCTAATTCTGG + Intronic
962776973 3:138670487-138670509 ATTTATTATCTGGCTCATTCTGG - Intronic
963806220 3:149725764-149725786 ATAAACTTTTCGGCTCAGTTGGG + Intronic
967062715 3:185886495-185886517 AAACACTATCTGGCTGAGTGTGG + Intergenic
967606751 3:191456202-191456224 ATAAACTTTCAGGCTGAGGCAGG + Intergenic
968351696 3:198061428-198061450 ATAAATTATCTGATTCATTCTGG - Intergenic
969552469 4:7880110-7880132 AAAATCTCTCTGGCTCAGGCCGG + Intronic
970364289 4:15342423-15342445 ATAAAGTATCTGGCACAGAGTGG - Intronic
973126056 4:46586250-46586272 ATAATTTATCTGGATCATTCTGG + Intergenic
976624522 4:87165590-87165612 CTCAACTATGTTGCTCAGTCTGG + Intronic
986275464 5:6271483-6271505 ATACACTTTCTTTCTCAGTCTGG + Intergenic
987199171 5:15557231-15557253 ATTAACAATCTGGCTCCGCCGGG - Intronic
988734311 5:34005755-34005777 ATCAACTATTTGGCTTTGTCAGG - Exonic
990209771 5:53469982-53470004 ACAGACTTTCTGGATCAGTCAGG - Intergenic
993947592 5:94134038-94134060 ATAAACTATCTTGGGCAGTATGG + Intergenic
994479530 5:100316469-100316491 ATAAACTATCTTGGGCAGTATGG + Intergenic
998091799 5:139375374-139375396 ATATACCATCTGGCTAAATCTGG - Intronic
1000996825 5:167967877-167967899 ATATTTTATCTGGCTCAGACAGG + Intronic
1004339054 6:14791459-14791481 ATTAGCTATCTGGCTGAGACAGG + Intergenic
1010828772 6:80505340-80505362 ATAAAGTATCTAGCTCAGGTAGG - Intergenic
1011231190 6:85164234-85164256 CTAAACTCTCTGGCCCAGCCAGG + Intergenic
1012905870 6:105065017-105065039 ATAAACAATCTGGTTCTATCTGG + Intronic
1017359464 6:153549925-153549947 ATAACCTATCTTTCTGAGTCTGG + Intergenic
1017496760 6:154990323-154990345 GTAAACTCTCTGCCTCAGCCTGG - Intronic
1021788138 7:24173003-24173025 ATAAACCGTCTAGCTCAGCCTGG + Intergenic
1023197541 7:37657666-37657688 ATCAGCTCTCTGACTCAGTCTGG - Intergenic
1025211546 7:57021799-57021821 ATCAAGTATCTGACACAGTCTGG - Intergenic
1025660409 7:63555048-63555070 ATCAAGTATCTGACACAGTCTGG + Intergenic
1027685252 7:81272495-81272517 AGAATCTATCTGTCTCAGTCAGG + Intergenic
1028043163 7:86083790-86083812 ATAAACTATTTGGCTTTCTCTGG - Intergenic
1028403051 7:90445655-90445677 ATAAACTATATGTGTCAGTTAGG + Intronic
1028503720 7:91548339-91548361 ATAAACTATTTAGCTCAGGTGGG - Intergenic
1029453923 7:100657714-100657736 AAAAACTATGTTGCCCAGTCTGG + Intergenic
1034476059 7:151282764-151282786 GTTTACTATCTGGCTCAGCCAGG - Intergenic
1034931560 7:155167616-155167638 ATAAACTGTGTGGCTCAGTGTGG + Intergenic
1035083956 7:156240225-156240247 ATAAACTGCCTTGCTCAGTGGGG + Intergenic
1037607534 8:20450194-20450216 CTAGAATCTCTGGCTCAGTCTGG - Intergenic
1039035951 8:33359708-33359730 AAAAACTATCTACCTCAGCCAGG + Intergenic
1039619784 8:38985975-38985997 AGAAACTATGTTGCTCAGGCTGG - Intronic
1039883352 8:41640846-41640868 ATCACCTGTCTGGCTCAGGCAGG - Intergenic
1041453851 8:58036325-58036347 ATAAAATGTCTGGCTGAGCCTGG - Intronic
1041603189 8:59747383-59747405 AAAAATTAACTGGCACAGTCAGG - Intergenic
1043800633 8:84605583-84605605 AGAACCTATCTGCCTGAGTCAGG - Intronic
1048136990 8:131756209-131756231 CTAAACTGTCTGGCACATTCTGG + Intergenic
1052251928 9:26408673-26408695 CTAAACTGTCTGGCTAAATCAGG - Intergenic
1053918252 9:42961570-42961592 AGAAACTGTCTGGGACAGTCTGG - Intergenic
1054379593 9:64475325-64475347 AGAAACCATCTGGGACAGTCTGG - Intergenic
1056132886 9:83602911-83602933 ATAATCTGATTGGCTCAGTCTGG + Intergenic
1058976333 9:110128246-110128268 TTTAACTTTCTGGCTAAGTCAGG - Intronic
1060217526 9:121747195-121747217 AAAAACTATCAGGCTTAGCCTGG - Intronic
1194011347 X:88566405-88566427 ACAAACCAAATGGCTCAGTCAGG + Intergenic
1194545810 X:95232021-95232043 ATAAAGTACCTGGCCCTGTCTGG - Intergenic
1195069492 X:101265686-101265708 ATAAACTGTCTGGATCTCTCTGG - Intergenic
1196137251 X:112223445-112223467 TTAAACTATCTGTCTCATTTAGG - Intergenic
1196552018 X:117039908-117039930 CTACACTCTCTGTCTCAGTCAGG - Intergenic
1197066535 X:122239632-122239654 TTAACCTTTTTGGCTCAGTCAGG + Intergenic
1197637041 X:128926931-128926953 ATAAAGTATTTGACTTAGTCAGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic