ID: 1130126131

View in Genome Browser
Species Human (GRCh38)
Location 15:81095579-81095601
Sequence GGGCACCAGAACCACTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130126131_1130126134 -9 Left 1130126131 15:81095579-81095601 CCTGCACAGTGGTTCTGGTGCCC 0: 1
1: 1
2: 0
3: 11
4: 145
Right 1130126134 15:81095593-81095615 CTGGTGCCCTCACTTCCGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 85
1130126131_1130126133 -10 Left 1130126131 15:81095579-81095601 CCTGCACAGTGGTTCTGGTGCCC 0: 1
1: 1
2: 0
3: 11
4: 145
Right 1130126133 15:81095592-81095614 TCTGGTGCCCTCACTTCCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 113
1130126131_1130126139 27 Left 1130126131 15:81095579-81095601 CCTGCACAGTGGTTCTGGTGCCC 0: 1
1: 1
2: 0
3: 11
4: 145
Right 1130126139 15:81095629-81095651 GTGTCTTCAATCTTATTGATTGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130126131 Original CRISPR GGGCACCAGAACCACTGTGC AGG (reversed) Intronic
900940216 1:5793608-5793630 GGCCACCACCACCACTGTCCTGG - Intergenic
902336236 1:15756538-15756560 GGGCAGCAGAGCCTCTGAGCTGG + Intergenic
904623709 1:31790567-31790589 GGGCATCAAAACCCCTGTTCTGG + Exonic
909510314 1:76445389-76445411 GTGCATCAGAATCACTGTGAGGG - Intronic
910531349 1:88239207-88239229 GGGAAACAAAACCACAGTGCTGG + Intergenic
912760185 1:112359597-112359619 GGGCACCTGTACCACTGTTGAGG + Intergenic
919830013 1:201534029-201534051 GGGGACCAGATCCAATGTGGAGG - Intergenic
920594832 1:207258911-207258933 GGCCACCATCACTACTGTGCTGG + Intergenic
921582810 1:216914799-216914821 GGCCACCATAACCACTGTCTGGG + Intronic
923071053 1:230564770-230564792 GGGCACCAGAGCCACAGTTAGGG + Intergenic
1065089750 10:22219978-22220000 GGGCACCAGCATCTCTGTGAAGG + Intergenic
1066477070 10:35757773-35757795 GGGCACCAGGAACATTTTGCTGG + Intergenic
1067064448 10:43095900-43095922 AGGAACCAGAACCACGGTGGCGG + Intronic
1067226477 10:44379520-44379542 GTGCCCCTGAACCACTGTTCTGG - Intronic
1067700020 10:48564679-48564701 GGGCTGCAGAAACACTGTGCAGG - Intronic
1068008783 10:51421644-51421666 GGGCACCAAAGCAAGTGTGCAGG - Intronic
1070346464 10:75547476-75547498 GGGCACCACAGCCCCAGTGCAGG - Intronic
1071516006 10:86298482-86298504 GCACTCCAGAACCCCTGTGCTGG + Intronic
1071815089 10:89224585-89224607 TGGCACCCGAACCTCTGTTCAGG - Intronic
1073377966 10:103053165-103053187 GGTCACCAGAAGCAGAGTGCAGG - Intronic
1075705257 10:124496783-124496805 GGGGACCAGCACCACAGAGCCGG - Intronic
1075733173 10:124648328-124648350 GGGCACCAGGCACACTGGGCTGG - Intronic
1075800205 10:125149073-125149095 GGGCAGAAGATCCACTGAGCTGG - Intronic
1076717125 10:132371834-132371856 GGGCTGCAGAGCCAGTGTGCAGG + Intronic
1076884966 10:133258054-133258076 AGGCACCACAACCCCTGTGCAGG - Intergenic
1077368067 11:2169276-2169298 GGTCACCTGAGCCACTGTGCTGG + Intronic
1078060722 11:8041026-8041048 GGGAACCAGCATCACTGTGTGGG + Intronic
1080600314 11:33816240-33816262 GGGTACCATGAGCACTGTGCAGG - Intergenic
1083594326 11:63911818-63911840 GGGCTCCAGGACCCCTTTGCTGG - Exonic
1084531801 11:69731733-69731755 AAGCCCCAGAACCTCTGTGCAGG - Intergenic
1085197724 11:74682535-74682557 GTGCACCATTACCACTGTGATGG + Intergenic
1092108670 12:5944004-5944026 GGGTACCAGAGCCACTCTGCTGG - Intronic
1093714485 12:22366136-22366158 GGGCATGGGATCCACTGTGCTGG - Intronic
1097477107 12:60071884-60071906 AGGCACCAAAACCACTTAGCAGG - Intergenic
1101968127 12:109294605-109294627 GGGTACCAGGAGCACTGTGGTGG + Intronic
1103254700 12:119531083-119531105 GGACACCTGAAACACTGTGGAGG - Intronic
1112342079 13:98561005-98561027 AGACAGCAGAACCACTGTCCTGG - Intronic
1114693292 14:24605521-24605543 GGGCTCCAGGGCCACTGGGCTGG - Intergenic
1118316131 14:64727224-64727246 GGGTACCTGGACCACTGTGCTGG + Intronic
1120015376 14:79467318-79467340 GGGCTTCAGCACCACTGTGAAGG + Exonic
1120066487 14:80047015-80047037 GTGAACCAGAACCCCAGTGCAGG + Intergenic
1120942218 14:89959350-89959372 GGGCACCAGAGCCTCTATGAGGG + Intronic
1121308258 14:92920954-92920976 GGGCACCAGAGCCCCTGCCCGGG - Intergenic
1122141713 14:99666808-99666830 GGGCACCAGTCCCACTGGGGAGG - Intronic
1122308292 14:100779199-100779221 GAGCAGCGGAGCCACTGTGCTGG - Intergenic
1122354271 14:101113831-101113853 GGACACCAGACTCCCTGTGCTGG + Intergenic
1122532659 14:102439705-102439727 GGGCAGCAGAGCCCTTGTGCCGG + Intronic
1125834618 15:42738055-42738077 GGGCAGCAGATCCAAAGTGCTGG + Intergenic
1125956761 15:43795711-43795733 GGGCAGCAGAAACACAGTGAGGG + Exonic
1128358399 15:66944038-66944060 AGGCCCCAGAGGCACTGTGCTGG + Intergenic
1130126131 15:81095579-81095601 GGGCACCAGAACCACTGTGCAGG - Intronic
1132339100 15:101066811-101066833 GGGCAGCAAAGCCACTGTGCAGG - Intronic
1132734237 16:1377689-1377711 GGGCTGCAGAGCCACTGTGTTGG - Intronic
1137641897 16:50039460-50039482 GGGCCCCAGAACTACAGTTCAGG + Intergenic
1140152098 16:72378012-72378034 GGGTACCAGAAACACCTTGCTGG + Intergenic
1141756759 16:85996617-85996639 GGGCAGGAGAGCCACTGTGGGGG - Intergenic
1143367037 17:6415156-6415178 GGGCACTAGGACCCCTGTCCAGG + Intronic
1144770190 17:17755393-17755415 GGGCACTGGAACCACTTGGCAGG + Intronic
1146054025 17:29572422-29572444 GGGCACCTGAGCCTCTGTCCTGG - Exonic
1146400381 17:32496520-32496542 GGGCACCAGGGCCGCTCTGCAGG + Intronic
1148057352 17:44808466-44808488 GTGAGCCAGAGCCACTGTGCTGG - Intronic
1148086530 17:44996947-44996969 GGGCAACAGAACCAACTTGCAGG + Intergenic
1148905677 17:50910300-50910322 CTGGAGCAGAACCACTGTGCTGG - Intergenic
1150266590 17:63836073-63836095 TAGCACCAGTCCCACTGTGCTGG - Intronic
1150801442 17:68286192-68286214 TGGCACCAGAACTTCAGTGCTGG - Intronic
1151152119 17:72097215-72097237 GGGCACCAAAACGAGTGAGCAGG + Intergenic
1151725595 17:75881999-75882021 GGGCACCAAAGCCACGGAGCAGG - Intronic
1152268913 17:79312445-79312467 GGCCACCAGATGCACTGTGAGGG + Intronic
1152647368 17:81475681-81475703 GGGCCCCACAAACACTGTGGTGG + Intergenic
1152655702 17:81518328-81518350 GGGCACCAGCTTCACTGTGGAGG - Intronic
1153274275 18:3352733-3352755 AGGCACCAGGACTACTGTACAGG + Intergenic
1157097151 18:44696357-44696379 GGCCATCAGAACCACTGAGAGGG + Intronic
1158283310 18:55851180-55851202 CAGCACCAGAACCTCTGGGCTGG - Intergenic
1163263016 19:16202623-16202645 GCGCATCAGAATCACTGTGCTGG - Intronic
1164455118 19:28400386-28400408 GGGCCCCAAAGCCACTCTGCTGG - Intergenic
1165301611 19:34973340-34973362 GGGCACTAGAACCACAATCCCGG + Intergenic
1167890660 19:52536684-52536706 TGCCACCAGCACCACTCTGCGGG - Intronic
1168152155 19:54455039-54455061 GGGGGCCAAAACCACTGTGCTGG - Exonic
927938925 2:27091630-27091652 GGGCTCCAGTAACACTGTGAGGG + Intronic
934118947 2:88822160-88822182 GGGCACCGGGACCCCTCTGCAGG - Intergenic
937457683 2:122056983-122057005 AAGCATGAGAACCACTGTGCTGG + Intergenic
939690839 2:145258389-145258411 GGCCACCAGAACCATGGAGCAGG + Intergenic
945117846 2:206426673-206426695 GGTGACTAGAACCACTGGGCTGG + Intergenic
1169038958 20:2476875-2476897 GGGCACCAGAGCAACACTGCAGG - Intronic
1169483497 20:6006436-6006458 GGCCAGCGGAACCACTGTTCGGG + Exonic
1169703199 20:8472368-8472390 GGTCACCAGAACCCCAGTGATGG - Intronic
1175911290 20:62406693-62406715 GGTCACCTGAACCTCTGTCCAGG + Intronic
1176307568 21:5131963-5131985 GGGCACAGGACCCTCTGTGCAGG + Intronic
1179127939 21:38608735-38608757 GGGCACCAGAACCAGTGGGGTGG + Intronic
1179849492 21:44130067-44130089 GGGCACAGGACCCTCTGTGCAGG - Intronic
1181043448 22:20203695-20203717 CTGCACCAGAAACACTGGGCTGG - Intergenic
1182349670 22:29692240-29692262 AGGCACCACAGCCACTGGGCAGG - Intronic
1182718544 22:32378786-32378808 GGGCCACAGAACCCCAGTGCAGG + Intronic
1184379186 22:44134415-44134437 GGGCCCCAGGAGCCCTGTGCAGG + Intronic
1185211846 22:49575002-49575024 GGGCAGCAGACCCACGGGGCAGG - Intronic
949332691 3:2939808-2939830 GGGCTCCAGCACAACAGTGCAGG - Intronic
950243299 3:11391565-11391587 AGGGACAAGAACCGCTGTGCTGG - Intronic
951195914 3:19823259-19823281 GGGCACCAGGACCAGTGCACAGG + Intergenic
960405240 3:117251902-117251924 GGGCACCAGAACAAATATCCTGG + Intergenic
961713179 3:128842606-128842628 GGGCTCCAGCTCCACTGTCCAGG - Intergenic
968429356 4:546276-546298 GGGCACCACAACCACTGTGCTGG - Intergenic
977806201 4:101300699-101300721 GGGCACAAGAATCGCTCTGCCGG + Intronic
987143442 5:14967911-14967933 GGCCACCAGTGACACTGTGCAGG - Intergenic
991745945 5:69741359-69741381 GTTCACCAGATGCACTGTGCTGG + Intergenic
991751759 5:69813882-69813904 GTTCACCAGATGCACTGTGCTGG - Intergenic
991797546 5:70321317-70321339 GTTCACCAGATGCACTGTGCTGG + Intergenic
991825323 5:70616673-70616695 GTTCACCAGATGCACTGTGCTGG + Intergenic
991831048 5:70688775-70688797 GTTCACCAGATGCACTGTGCTGG - Intergenic
991889888 5:71320638-71320660 GTTCACCAGATGCACTGTGCTGG + Intergenic
993047189 5:82881010-82881032 GGGCACCAGTAGCAGTGGGCTGG + Intergenic
998677475 5:144425709-144425731 AGGCAAAAGAAGCACTGTGCTGG + Intronic
999850952 5:155538202-155538224 AGGCACCAGAACCATATTGCTGG + Intergenic
1000820844 5:165981619-165981641 GGGCACCAGTACCACTGAATTGG + Intergenic
1001254950 5:170176357-170176379 CCACACCTGAACCACTGTGCTGG - Intergenic
1003188087 6:3849996-3850018 GGTCACCAGGCCCACCGTGCTGG - Exonic
1003276235 6:4655669-4655691 GGGCACCAGCTCCAAGGTGCAGG + Intergenic
1005145358 6:22683962-22683984 TGGAACCAGACCCACTGGGCTGG + Intergenic
1005556605 6:26991824-26991846 GTTCACCAGATGCACTGTGCTGG + Intergenic
1005956824 6:30670027-30670049 GGGCAGCAGTCCCACTGTACAGG - Intronic
1006117106 6:31781308-31781330 GGGCACAGGAATCACTGAGCAGG + Intronic
1006171399 6:32095461-32095483 GGGCAGCAGAACCACAGGGGTGG - Intronic
1007324260 6:41048335-41048357 AGGCACCAGAATCACAGGGCAGG - Intronic
1018305883 6:162454797-162454819 GTGCACCAGAGCCACCGTGGGGG - Intronic
1022289727 7:28989364-28989386 GGGCATCAGCATTACTGTGCTGG - Intergenic
1022643868 7:32212854-32212876 AGGCATCAGAACCACCGAGCAGG + Intronic
1022891086 7:34700202-34700224 GAGCACCAGAACAACAGAGCTGG + Intronic
1024598414 7:50959578-50959600 GGGCCCCAGAAGCACAGAGCAGG - Intergenic
1024853119 7:53744375-53744397 GGTCACCCAATCCACTGTGCAGG - Intergenic
1031237681 7:119197387-119197409 CTGCACCACAATCACTGTGCAGG - Intergenic
1034192317 7:149222050-149222072 AGGCATGAGAACCACTGGGCTGG + Intronic
1034971176 7:155420254-155420276 GGGCCCCAGCACAACTGAGCAGG + Intergenic
1035901944 8:3466272-3466294 GGGCAGCAGAACCAGTATTCAGG + Intronic
1036620678 8:10423000-10423022 TGTCACCAGAAACACTGTGCTGG - Intronic
1037945957 8:22989679-22989701 TGGCATCAGAACCACAGCGCTGG + Intronic
1038396326 8:27248157-27248179 GGGCAGCTGAGCCCCTGTGCTGG + Intronic
1038498895 8:28027007-28027029 GGGCAGCATCACCACTATGCTGG - Exonic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1040616881 8:49046292-49046314 GGTCACCAGAACCACACTGGAGG + Intergenic
1042284657 8:67094780-67094802 GGGTCCCAGAACCACTTTGGGGG - Intronic
1045240459 8:100396156-100396178 CGGCACCAGCTCCACTCTGCAGG - Intronic
1046012937 8:108572533-108572555 AGGCTCCAGCACCGCTGTGCTGG - Intergenic
1047793850 8:128233878-128233900 GGGGACTACAACCAATGTGCAGG - Intergenic
1049220114 8:141425210-141425232 GGGCACCAAACCCTCTGCGCAGG - Intronic
1049611671 8:143558783-143558805 GGGCACCTGGGCCACTGTGGAGG - Intronic
1049949251 9:628576-628598 GGGCACTTGAACCACAGTGGTGG + Intronic
1050287736 9:4120443-4120465 TGGTTCCAGAACCACTGTGGAGG - Intronic
1052171361 9:25400881-25400903 GGTCACCAGAAGCACTGGACAGG + Intergenic
1057188371 9:93071933-93071955 GGGCTCCCGAAACAGTGTGCTGG + Intronic
1059356388 9:113702548-113702570 AGGCTTGAGAACCACTGTGCTGG - Intergenic
1061003263 9:127914700-127914722 AGGCTCCAGGCCCACTGTGCCGG - Exonic
1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG + Intergenic
1190060261 X:47206309-47206331 GGGCACCAAAGGCAATGTGCAGG + Exonic
1190462926 X:50696682-50696704 AGACACTAGAAGCACTGTGCTGG - Intronic
1190949509 X:55129516-55129538 GGACACCAGAACCAACTTGCAGG + Intronic
1195363281 X:104105232-104105254 GGGGAGCAGAACCACTCTCCCGG - Exonic
1197119471 X:122873142-122873164 GGGCACCATAACTACTTTGGAGG + Intergenic
1198338853 X:135693905-135693927 GGGCAGCAGCAGCATTGTGCGGG - Intergenic
1200151097 X:153951857-153951879 GGGCAGCAGCGCCACAGTGCTGG + Exonic