ID: 1130127587

View in Genome Browser
Species Human (GRCh38)
Location 15:81106779-81106801
Sequence GAGCCACCACACAGCCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 216}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130127587_1130127596 14 Left 1130127587 15:81106779-81106801 CCAGTGTGGCTGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 18
4: 216
Right 1130127596 15:81106816-81106838 AGGACTTTGGGAGGCCGAGGCGG 0: 698
1: 93124
2: 190199
3: 138687
4: 72601
1130127587_1130127592 5 Left 1130127587 15:81106779-81106801 CCAGTGTGGCTGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 18
4: 216
Right 1130127592 15:81106807-81106829 TGTAATCCCAGGACTTTGGGAGG 0: 2913
1: 305044
2: 268715
3: 150128
4: 132105
1130127587_1130127597 15 Left 1130127587 15:81106779-81106801 CCAGTGTGGCTGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 18
4: 216
Right 1130127597 15:81106817-81106839 GGACTTTGGGAGGCCGAGGCGGG 0: 707
1: 89752
2: 228752
3: 239257
4: 158741
1130127587_1130127588 -6 Left 1130127587 15:81106779-81106801 CCAGTGTGGCTGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 18
4: 216
Right 1130127588 15:81106796-81106818 TGGCTCAAGCCTGTAATCCCAGG 0: 84
1: 2479
2: 3943
3: 3834
4: 4231
1130127587_1130127589 1 Left 1130127587 15:81106779-81106801 CCAGTGTGGCTGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 18
4: 216
Right 1130127589 15:81106803-81106825 AGCCTGTAATCCCAGGACTTTGG 0: 70
1: 9340
2: 235923
3: 278856
4: 185633
1130127587_1130127594 11 Left 1130127587 15:81106779-81106801 CCAGTGTGGCTGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 18
4: 216
Right 1130127594 15:81106813-81106835 CCCAGGACTTTGGGAGGCCGAGG 0: 964
1: 121705
2: 270466
3: 214392
4: 127352
1130127587_1130127598 18 Left 1130127587 15:81106779-81106801 CCAGTGTGGCTGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 18
4: 216
Right 1130127598 15:81106820-81106842 CTTTGGGAGGCCGAGGCGGGTGG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
1130127587_1130127590 2 Left 1130127587 15:81106779-81106801 CCAGTGTGGCTGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 18
4: 216
Right 1130127590 15:81106804-81106826 GCCTGTAATCCCAGGACTTTGGG 0: 2095
1: 228705
2: 277026
3: 183771
4: 140448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130127587 Original CRISPR GAGCCACCACACAGCCACAC TGG (reversed) Intronic
900001081 1:15219-15241 GAGCCACCTCCCAGCCACCTCGG + Intergenic
900020796 1:185740-185762 GAGCCACCTCCCAGCCACCTCGG + Intergenic
900483269 1:2909672-2909694 AAGTCACCGCACAGCCAAACGGG - Intergenic
902792995 1:18781794-18781816 GAGCCACCTCACAGGGATACTGG - Intergenic
903378876 1:22883452-22883474 GAGGCAACAAACAGCCACAGAGG + Intronic
904363227 1:29991930-29991952 CAGGCACCTCACTGCCACACTGG - Intergenic
906693202 1:47806558-47806580 GGGCCTCCACACAGCCATCCAGG - Intronic
915326417 1:155083270-155083292 GAGCAGCTGCACAGCCACACTGG - Intronic
916474925 1:165160065-165160087 GAAACATCACACACCCACACTGG - Intergenic
916780304 1:168019617-168019639 TAACCACCACAGAGCCCCACTGG + Intronic
919477032 1:198041787-198041809 GAACAACCACACAACCACACTGG - Intergenic
919806411 1:201383316-201383338 GAGATACCACACGGCCATACGGG - Exonic
920224005 1:204424821-204424843 GAGCCACCACCCAGCATCCCAGG - Exonic
920704752 1:208243217-208243239 GAGACAGCCCAAAGCCACACTGG - Intronic
922680686 1:227592890-227592912 GTACCACCACACATCCACTCGGG + Intronic
923574159 1:235142641-235142663 GAGCCACCACACACGCCCAGAGG - Intronic
923714343 1:236412122-236412144 GAAGCACCACACAGCTACACAGG - Intronic
924203334 1:241683525-241683547 AAGGCACCACACACACACACAGG - Exonic
1063845955 10:10126941-10126963 GAGCCACCACACACAGACATGGG - Intergenic
1065248196 10:23780963-23780985 GAGCCACCACACCTGGACACCGG + Intronic
1065815625 10:29480183-29480205 GAAGCAGCACACAGCCACATGGG + Intronic
1065957307 10:30705021-30705043 GAAGCAGCACACAGCCACATGGG - Intergenic
1067367431 10:45646781-45646803 GAGCCAGCACACGGCAAAACTGG + Intronic
1067820982 10:49529965-49529987 CAGTCAGCACCCAGCCACACTGG - Intronic
1069609846 10:69765776-69765798 GGCCCTCCACACATCCACACAGG + Intergenic
1070752533 10:78972704-78972726 TGGCAACCACACAGCCTCACAGG - Intergenic
1072786634 10:98287581-98287603 AAGCAACCTCACAGACACACTGG + Intergenic
1073727473 10:106250056-106250078 GAGCCACCACACACCCGGCCGGG - Intergenic
1074851355 10:117442023-117442045 GAGCCATAACTCAGGCACACAGG - Intergenic
1075225904 10:120628640-120628662 GAGCCCCAACACAGCCAGCCTGG - Intergenic
1076442966 10:130492845-130492867 CAGCCAGCACTGAGCCACACGGG - Intergenic
1076503490 10:130955705-130955727 GAGACACCACACACCCACTAGGG - Intergenic
1076800599 10:132826291-132826313 GACCCACCACAGAGCCAGGCAGG + Intronic
1077111656 11:864679-864701 GAGCCACAGCACAGCCTCCCAGG - Intronic
1077305445 11:1866820-1866842 GAGCCACCGCACAGCCAGGCAGG - Exonic
1078934905 11:15941690-15941712 GAGGCCCCACACAGCCAGGCTGG - Intergenic
1079175164 11:18133362-18133384 TGGCCAACGCACAGCCACACAGG + Intronic
1079178728 11:18169427-18169449 CAGCCAACACACAACCACACAGG + Intronic
1079264277 11:18915199-18915221 CGACCAACACACAGCCACACAGG - Intergenic
1079266543 11:18938613-18938635 CGGCCAACACACAGCCACACAGG - Intronic
1079270103 11:18976492-18976514 TGGCCAACACACAGCCACACAGG - Intergenic
1080684939 11:34507422-34507444 GAGCCACCACCCAGCTTCGCTGG - Intronic
1082129494 11:48471097-48471119 GACCCACCCCACTGCCAGACTGG - Intergenic
1082247598 11:49942605-49942627 GACCCACCCCACTGCCAAACTGG + Intergenic
1085173558 11:74467809-74467831 CCACCACCACACAGCCACACTGG - Intergenic
1085419742 11:76345764-76345786 GAGACACCTCACAGCCACACAGG + Intergenic
1089780404 11:120869717-120869739 GGACCAGCACACAGCCTCACTGG + Intronic
1090864683 11:130689039-130689061 GATCCGCCACACATACACACAGG - Intronic
1091374170 12:15334-15356 GAGCCACCTCCCAGCCACCTCGG + Intergenic
1092658819 12:10716889-10716911 GACTCACCACACAACCTCACGGG + Intronic
1096520446 12:52181807-52181829 GAGCCAGCAGACACCCACCCTGG - Intronic
1102842788 12:116144012-116144034 GAGCCACAGAACAGGCACACAGG + Intronic
1105419480 13:20239762-20239784 CAGTCAGCACACAGCCACGCTGG - Intergenic
1106107295 13:26744119-26744141 GGGCTCACACACAGCCACACCGG + Intergenic
1106563394 13:30865410-30865432 GAGCAACGAGACAGCCACAGTGG - Intergenic
1111064350 13:83071741-83071763 GAGTCACCCCACAGCCCCACTGG + Intergenic
1111971141 13:94918021-94918043 GAGCCACCACCCACCAACACGGG - Intergenic
1113890496 13:113732781-113732803 GAGCCACCGCTCACCCACGCGGG - Intronic
1117425522 14:55591461-55591483 GAGCCATCACACATATACACTGG - Intronic
1118486672 14:66220947-66220969 GTGCCACCACTCAGCTACTCAGG - Intergenic
1121145968 14:91582711-91582733 AAGGCCCCACTCAGCCACACTGG + Intronic
1122486731 14:102087007-102087029 GACCAACGGCACAGCCACACCGG + Intronic
1124699675 15:31902079-31902101 GAGCCACCAGCCAGACACAGGGG - Intergenic
1125740274 15:41957976-41957998 GGTCAATCACACAGCCACACGGG + Intronic
1125754222 15:42051487-42051509 GAGCCAGCACACAGAAAGACAGG - Intergenic
1128158687 15:65408973-65408995 CAGGCACCACACTGCCACACTGG + Intronic
1129170731 15:73805962-73805984 GAGCCAGCACAGAACCTCACCGG + Intergenic
1130127587 15:81106779-81106801 GAGCCACCACACAGCCACACTGG - Intronic
1131158374 15:90088813-90088835 AAGCAACAACACAGCCAGACGGG + Intronic
1132452428 15:101975721-101975743 GAGCCACCTCCCAGCCACCTCGG - Intergenic
1132454468 16:14901-14923 GAGCCACCTCCCAGCCACCTCGG + Intronic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133230538 16:4364523-4364545 GAGTTGGCACACAGCCACACGGG + Intronic
1133976615 16:10603705-10603727 ATGCCCCCACACAGCCACTCTGG + Intergenic
1134749362 16:16613676-16613698 GAGCCAGCAGACAGCCTCCCAGG + Intergenic
1134996109 16:18739947-18739969 GAGCCAGCAGACAGCCTCCCAGG - Intergenic
1135203904 16:20465680-20465702 CAGCCACCACTCAGGCACTCGGG - Exonic
1135215101 16:20559262-20559284 CAGCCACCACTCAGGCACTCGGG + Exonic
1137569826 16:49558010-49558032 GAGCCAACAGACAGCCGGACTGG + Intronic
1139702039 16:68713771-68713793 TACAGACCACACAGCCACACTGG + Intronic
1140123894 16:72104892-72104914 GGGCCACCACACCTCCACATGGG - Intronic
1203083608 16_KI270728v1_random:1165538-1165560 AAGCCACCACACATGCACCCTGG - Intergenic
1143103487 17:4516524-4516546 AAGCCACCACCCAGGCACAGGGG + Intronic
1144709563 17:17392466-17392488 GAGCCACCACACCCACACTCTGG - Intergenic
1144945638 17:18968223-18968245 GACCCAACACACAGCCTCAGGGG - Intronic
1145963636 17:28902042-28902064 CAGGCACCACGCAGCCACAAAGG + Intronic
1146272770 17:31495209-31495231 GTGCCACCGCCCAGCCACACTGG + Intronic
1149768064 17:59296818-59296840 GAGCCACCACACCCCGCCACTGG + Intergenic
1151312198 17:73300171-73300193 GTGCCACTGCACAGCCACCCTGG + Intronic
1151635875 17:75347500-75347522 AAGCCCCCACCCAGCCACACTGG + Intronic
1152536137 17:80951223-80951245 AAGCATCCACACATCCACACCGG + Intronic
1152886248 17:82852235-82852257 GAGCCACCACAGAGGACCACAGG - Intronic
1153909564 18:9695167-9695189 GAGACACCACAGGGCCCCACAGG - Intergenic
1155335715 18:24763534-24763556 GAGCCCCCATACAGCCACCACGG - Intergenic
1156341037 18:36210966-36210988 GAGTCCCCAGACACCCACACAGG - Intronic
1156453982 18:37282565-37282587 GAGCCACCTCACTGCCCCAGGGG + Intronic
1158729264 18:60004216-60004238 GATCCACCTGAGAGCCACACGGG - Intergenic
1160556231 18:79727076-79727098 GAGGCCCCACACACCCACGCGGG - Intronic
1161265278 19:3360821-3360843 CAACCGCCACACACCCACACGGG - Intronic
1161416936 19:4152616-4152638 GAGACACCTCTCAGCCACCCGGG + Intergenic
1162153895 19:8663942-8663964 CAGTCACCACACAGCCTCAAAGG - Intergenic
1162991125 19:14302857-14302879 GAGCTTGCACCCAGCCACACTGG - Intergenic
1163272282 19:16261551-16261573 CTGCCCCCACCCAGCCACACGGG - Intergenic
1165025714 19:32959771-32959793 GAGCACCCACGCACCCACACAGG + Intronic
1166824669 19:45601425-45601447 GAGCCACCCCACTGCCCCTCAGG - Intronic
925033492 2:670071-670093 GAGACACCACCCAGCAGCACAGG + Intronic
925655156 2:6139088-6139110 GCCCCACCTCCCAGCCACACTGG - Intergenic
926116243 2:10215171-10215193 GAGCTGCCACACAGCCCCCCAGG + Intergenic
928081247 2:28314522-28314544 TAGCCACTACAAATCCACACTGG - Intronic
929148755 2:38729476-38729498 GAGCCTCCACAAAGGCTCACTGG - Intronic
930776001 2:55171078-55171100 GAGACCCCCCACAGCCACAGTGG + Intergenic
934069569 2:88371572-88371594 GAGCCACCACACACGGACAGAGG + Intergenic
935721415 2:105982614-105982636 GTGCCACCACACATCCACTTGGG + Intergenic
936568641 2:113598195-113598217 GAGCCACCTCCCAGCCACCTCGG - Intergenic
937892166 2:126947070-126947092 GGGCTACAACTCAGCCACACTGG + Intergenic
938973417 2:136452767-136452789 GAGCCACCACCCAGAAAAACTGG - Intergenic
939405180 2:141746370-141746392 CAGCCAGCACCCATCCACACAGG - Intronic
940412844 2:153386520-153386542 CATCCACCACAAAGCCACAATGG - Intergenic
943513954 2:188862164-188862186 CAGCCACCTGAGAGCCACACAGG + Intergenic
944850626 2:203715541-203715563 GAGACACCACACAGCAATGCAGG - Intronic
946193165 2:218018242-218018264 GAGGCACCACACGGCCAGAGAGG + Intergenic
946626687 2:221619725-221619747 TAGCCACCACACAACCCCTCTGG + Intergenic
947862569 2:233371745-233371767 GAGCAACTGCACATCCACACAGG - Intronic
948129182 2:235587825-235587847 GAGCTAACACTCAGCCCCACAGG + Intronic
948311326 2:236989113-236989135 CAGACAGCACACAGCCACACCGG - Intergenic
1168997094 20:2141452-2141474 GAGCTTCCACACTGCCAAACGGG - Intronic
1169151950 20:3296337-3296359 GTGGCCCCTCACAGCCACACTGG + Intronic
1173255808 20:41393803-41393825 GAGCCCCCACACAGCAGCAGAGG - Intergenic
1175856700 20:62124491-62124513 GAGCCACAACACAGCACCCCAGG - Intronic
1177212408 21:18087324-18087346 CAGCCACCACCCAGCCAAAGAGG - Intronic
1179795087 21:43777987-43778009 GAGCCACCACACAGTCCCTTTGG + Intergenic
1179999672 21:44989678-44989700 GAGGCACCCCCCAGGCACACAGG + Intergenic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180147342 21:45928779-45928801 GAGTCCACACACAGCCACGCTGG + Intronic
1181014984 22:20063646-20063668 GAGCCAGTACACAGCCACACAGG + Intronic
1181392732 22:22595294-22595316 AAGCCAAGACACAGCCACTCTGG - Intergenic
1182427646 22:30283378-30283400 AATCCTCCACACAGACACACAGG + Intergenic
1185181068 22:49363683-49363705 GAGCCGACAAACAGCCCCACGGG + Intergenic
950499843 3:13356697-13356719 GAGCCACCAGCCAGCCATTCAGG - Intronic
952501237 3:33964094-33964116 GAGCCATCATTCAGCCTCACTGG - Intergenic
953167056 3:40475009-40475031 GACCCACGACACAGCCCCAGGGG + Intergenic
953413698 3:42703632-42703654 GAGCCTCCCCACAAGCACACAGG - Intronic
953546878 3:43870042-43870064 GCGCTCCCTCACAGCCACACTGG - Intergenic
953629650 3:44602503-44602525 GAGTTACCAGACAGCTACACAGG + Intronic
954156564 3:48688178-48688200 GAGCCACCACCTGGCCATACTGG + Exonic
954222973 3:49165954-49165976 GAGGCGCCACACAGGCAGACCGG + Intronic
954619456 3:51987206-51987228 GAGCCACCCCACTGCCTCCCAGG - Intronic
955359520 3:58261012-58261034 GAGTCAACAGAGAGCCACACCGG + Intronic
960057646 3:113286606-113286628 GAGCCAACACCCAGTGACACTGG - Intronic
960450306 3:117798751-117798773 GAGCCACCTATCAGCCACACCGG + Intergenic
960592816 3:119381701-119381723 GAGCCACCACACAGGCCGCCTGG - Intronic
961119850 3:124364600-124364622 GAGACACCACATAGCCACTAAGG - Intronic
961792823 3:129388873-129388895 GAGCCACAACTCTGCCAAACGGG + Intergenic
961806741 3:129495065-129495087 GAGCCACAACTCTGCCAAACGGG + Intronic
967957291 3:194887013-194887035 GAGACCCCACACAGACCCACTGG - Intergenic
968458803 4:713390-713412 CAGCCCCCACAAGGCCACACAGG - Intronic
968493507 4:903141-903163 TGCCCACCACACCGCCACACAGG - Intronic
968620016 4:1599823-1599845 GAGCCAACACTCAGCGCCACTGG - Intergenic
968629333 4:1642070-1642092 GAGCCACCACAGGGCCTCAGAGG - Intronic
968772973 4:2520186-2520208 GTGCCACCACACTCCAACACAGG - Intronic
969158113 4:5231050-5231072 GAGCCACTGCACAACCCCACGGG - Intronic
969265332 4:6060807-6060829 GAGCCAGAAGCCAGCCACACTGG + Intronic
972918044 4:43904573-43904595 GAGACACTACACAGACACAAAGG + Intergenic
974203412 4:58669460-58669482 GAGGTCCCACTCAGCCACACTGG - Intergenic
980595737 4:134952490-134952512 GCGCCAGCACAGAGCCACAGAGG + Intergenic
981150704 4:141376820-141376842 CAGCCACCACACAGCCAAGGAGG - Intergenic
984126165 4:175813500-175813522 CAGCCAGCACACACACACACAGG + Intronic
984905404 4:184621392-184621414 GAGCCACCAAACAACAAGACAGG - Intergenic
985833301 5:2251762-2251784 GAGCCACCACCTTGCAACACTGG + Intergenic
985967077 5:3345647-3345669 CAGCCACTGCACACCCACACTGG + Intergenic
988835497 5:35028405-35028427 GCCTCACCACACAGACACACAGG + Intronic
993641409 5:90410028-90410050 CACCCGCCAAACAGCCACACAGG - Intergenic
995525777 5:113049602-113049624 GAGCCCCCACTCAGGCACATGGG + Intronic
996789686 5:127279519-127279541 AAGCCACCCCTCAGCCACACTGG + Intergenic
997020933 5:130001013-130001035 GTGCCACCACTCAGCTACTCGGG - Intronic
997262071 5:132473072-132473094 GAGCCACCATGCAGCCCCACAGG - Intronic
998057532 5:139091724-139091746 GAGCCACCAGAAAGGGACACAGG + Intronic
998752566 5:145339505-145339527 GAACTAACACACAGCCCCACAGG + Intergenic
998788722 5:145743572-145743594 GGACCACCAGAAAGCCACACGGG + Intronic
1000636130 5:163645611-163645633 CAGACCTCACACAGCCACACTGG - Intergenic
1000995350 5:167952873-167952895 GAGTCACCACACAGAGCCACTGG + Intronic
1001674483 5:173500644-173500666 GAGAGGACACACAGCCACACAGG + Intergenic
1001957172 5:175855938-175855960 TAGCAACCACACAGAGACACAGG + Intronic
1003248651 6:4405529-4405551 CAGCCACCTAAGAGCCACACGGG + Intergenic
1004359283 6:14956588-14956610 GAGCCACCCCAAAGCTAGACGGG + Intergenic
1005799769 6:29409481-29409503 GAGCATCCACTCAGGCACACTGG + Intronic
1005836083 6:29710641-29710663 GAGCCTCCACCCACCCTCACAGG + Intergenic
1006897728 6:37481511-37481533 GCCCCAACACAGAGCCACACAGG - Intronic
1006931002 6:37688492-37688514 AAGCCACCACCCAGCCACCAAGG + Intronic
1007124365 6:39412831-39412853 GAGACAGCACCCAGCCACGCTGG - Intronic
1007696694 6:43738436-43738458 CAGACACCACACACACACACAGG - Intergenic
1008747565 6:54691275-54691297 GAGCCACCACACACCCAGCTGGG + Intergenic
1014289423 6:119540649-119540671 CAGCCACTGCACAGACACACTGG - Intergenic
1015976448 6:138796022-138796044 GAGCCACCACCCCGCCCCACAGG - Intronic
1017505736 6:155067173-155067195 GAGCTCCCCCACAGCCAGACTGG - Intronic
1018895348 6:168012896-168012918 AACCCACGAAACAGCCACACAGG - Intronic
1025227932 7:57180009-57180031 GTGCCAGCACACAGCAACAGCGG + Intergenic
1033125704 7:138705399-138705421 TAGCAACCAGAGAGCCACACCGG + Intergenic
1033350127 7:140555421-140555443 GAGCCACCCCGCCACCACACCGG + Intronic
1035261923 7:157667467-157667489 GAGAAGCCACACAGCCTCACGGG + Intronic
1035282947 7:157788727-157788749 GGGCCACCCCACTGCCACGCGGG + Intronic
1035469006 7:159097969-159097991 CAGCCCCCACACAGACCCACTGG + Intronic
1036620504 8:10421994-10422016 GAGCCACGACACAGCCTGCCTGG - Intronic
1037807737 8:22067716-22067738 GAGGCCCCCCCCAGCCACACTGG + Intronic
1038180025 8:25218744-25218766 GAGCCACAGCACTGCCACAGAGG - Intronic
1039943612 8:42111657-42111679 GGGCCACCACCCAGCCCCAGTGG + Intergenic
1041444449 8:57934748-57934770 GAGCCCCCACAAAGTCACATAGG - Intergenic
1045016371 8:98004787-98004809 GAGCCACAACAAAGCTCCACTGG + Intronic
1045598331 8:103683472-103683494 AGGCCACAACACTGCCACACTGG + Intronic
1045984987 8:108239484-108239506 GAGCCACCACACAGTGGAACAGG + Intronic
1047956901 8:129983594-129983616 GTGGCCCCACACAGCCCCACCGG + Intronic
1049219187 8:141421139-141421161 TAGCCACCACACAGCCAGCAGGG - Intronic
1049220810 8:141428013-141428035 GAGTGACCATGCAGCCACACAGG + Intronic
1049615212 8:143572927-143572949 GAGCCACACCACAGGCACTCAGG - Exonic
1049700527 8:144009445-144009467 GAGCCACGACAAAGCCGCAGAGG - Intronic
1049777158 8:144412009-144412031 AGGCCACCACACAGGCACTCAGG + Intronic
1049883886 9:15330-15352 GAGCCACCTCCCAGCCACCTCGG + Intergenic
1051183371 9:14434671-14434693 GAGCCACCACACAAAGAAACTGG + Intergenic
1051658847 9:19408005-19408027 GAGCCACCACATACACACAGAGG + Intergenic
1054162042 9:61680453-61680475 ATGCCAACACACAGCCACAGAGG + Intergenic
1054805331 9:69391757-69391779 GAGCGGCCACACAGCCTCATTGG + Exonic
1055461093 9:76520952-76520974 GAGCCACCACACAGCCAGCCAGG + Intergenic
1056007277 9:82285766-82285788 GTAACACCACACAGCCACAGGGG + Intergenic
1057421420 9:94916019-94916041 AGGCCTCCACACCGCCACACGGG + Intronic
1058186327 9:101859893-101859915 GAACCACTACACAGACCCACTGG + Intergenic
1061433799 9:130547914-130547936 GAGCGACAACACGTCCACACTGG + Intergenic
1061675768 9:132214680-132214702 GAGGGGCCAGACAGCCACACGGG + Intronic
1061926174 9:133807137-133807159 GAGCCACCACGGAGCCACAGGGG + Intronic
1061926998 9:133810842-133810864 GATCCCCCACACAACCTCACAGG + Intronic
1062607865 9:137356091-137356113 GGCCCACCTCACAGCCACTCTGG + Intronic
1188629730 X:32339538-32339560 GAGGCAGCGCCCAGCCACACAGG - Intronic
1192495985 X:71616938-71616960 GAGCCCCCAGACAGCCAGGCAGG + Exonic
1192588114 X:72336700-72336722 GAGCCACCACACCCCCAAAATGG + Intronic
1194524839 X:94966497-94966519 GAGGGACCTCACAGCCATACTGG + Intergenic
1197607199 X:128597923-128597945 CAGCCACCTGAAAGCCACACAGG - Intergenic
1200049349 X:153420513-153420535 AAGCCATCACACAGGCAGACAGG - Intronic
1200133836 X:153865123-153865145 CAGCCCCCACTCAGCCACAACGG - Exonic
1200401925 X:156024829-156024851 GAGCCACCTCCCAGCCACCTCGG - Intergenic