ID: 1130128714

View in Genome Browser
Species Human (GRCh38)
Location 15:81117841-81117863
Sequence AAGGACTAGGAGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 959
Summary {0: 1, 1: 0, 2: 7, 3: 86, 4: 865}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130128714_1130128723 30 Left 1130128714 15:81117841-81117863 CCATCCTCATTCTCCTAGTCCTT 0: 1
1: 0
2: 7
3: 86
4: 865
Right 1130128723 15:81117894-81117916 TTTATCCACACCATCCACCTGGG 0: 1
1: 1
2: 1
3: 10
4: 156
1130128714_1130128722 29 Left 1130128714 15:81117841-81117863 CCATCCTCATTCTCCTAGTCCTT 0: 1
1: 0
2: 7
3: 86
4: 865
Right 1130128722 15:81117893-81117915 CTTTATCCACACCATCCACCTGG 0: 1
1: 0
2: 0
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130128714 Original CRISPR AAGGACTAGGAGAATGAGGA TGG (reversed) Intronic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
902090301 1:13897845-13897867 AAGGACCTGGAGAGGGAGGAAGG - Intergenic
902832697 1:19028097-19028119 AAGGACTGTGAGAACAAGGATGG + Intergenic
902951351 1:19885353-19885375 AAGGACTAGGATACTGACGAGGG - Intronic
903187450 1:21636849-21636871 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
903283611 1:22263906-22263928 AAGGACTCGGTGGAGGAGGATGG - Intergenic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903766966 1:25741299-25741321 AATCACTAAGAGAATGAGGGAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904357856 1:29952918-29952940 AAGGACTAGGGGAATCATCATGG - Intergenic
904683914 1:32247461-32247483 GAGGACGAGGAGGATGAGGAGGG + Exonic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
905436309 1:37957699-37957721 AAAGACTAGGAGGATGAGCCAGG - Exonic
905741493 1:40374642-40374664 AATGACGAGGAGGAGGAGGAGGG + Intronic
905934145 1:41810476-41810498 AGGGACTAGGAGATGGTGGATGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906225652 1:44119128-44119150 AAGGAATGGGAGATTGGGGAGGG + Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906952175 1:50343881-50343903 AGGGACCAGGAGAAGGAGGTTGG - Intergenic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
907049802 1:51322222-51322244 GAGGCCTTGGAGAAGGAGGAGGG - Intronic
907307415 1:53521046-53521068 AAGGACTGAGAGAAGGAGGCAGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908494018 1:64676825-64676847 AAGGACCAGGAGCATGAGTTTGG + Intronic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
909169830 1:72281791-72281813 ATGGTATAAGAGAATGAGGAAGG + Intronic
909320083 1:74274287-74274309 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
909686546 1:78355211-78355233 AAGGAGGAGGAGAAAGGGGAGGG - Intronic
910076358 1:83284162-83284184 AAGGAAGAGGAGAAGGATGAGGG - Intergenic
911125511 1:94337618-94337640 AAGGGCTAGGAGAACAATGAAGG - Intergenic
911401726 1:97383809-97383831 AAAGACTATGAGATTGAGGCTGG + Intronic
911470310 1:98309998-98310020 AATGACTTGGAGAACTAGGATGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912168540 1:107069437-107069459 GAGGAGTGGGAGGATGAGGAGGG + Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912716414 1:111987131-111987153 CAGGACTAGGAGAATGAAAGGGG - Intronic
913046764 1:115080249-115080271 AAGAATTAGGAGAAAGACGATGG + Intronic
913115605 1:115693540-115693562 AAAGACTGGGAGAAAGAGGAAGG - Exonic
913124694 1:115774429-115774451 AAGGACTAGTGGGAGGAGGAGGG - Intergenic
913231899 1:116746878-116746900 AAGGTTTAGGAGAGGGAGGAGGG - Intergenic
913244647 1:116860898-116860920 AAAGACTAGAAGACTGAGGGAGG + Intergenic
913591874 1:120336814-120336836 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
913651482 1:120918332-120918354 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914169627 1:145210738-145210760 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
914524740 1:148454700-148454722 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
914598934 1:149181133-149181155 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914641660 1:149612435-149612457 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915473159 1:156137696-156137718 GAGGACGACGAGGATGAGGATGG + Exonic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915646423 1:157276009-157276031 GAGGTCTGGGAGAGTGAGGATGG + Intergenic
915915403 1:159937635-159937657 AAGGACGGGGAGGAGGAGGATGG - Intronic
916090815 1:161306481-161306503 AAGAAGTGGGAGAATGAGCAGGG + Intronic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
916772345 1:167923532-167923554 AGGGACTGGGAGAAGGAGAATGG + Intronic
917393092 1:174560718-174560740 AAGGACTACTAGAAGGGGGAGGG - Intronic
917633228 1:176910322-176910344 AAGCCCTGGGAGACTGAGGACGG - Intronic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918355656 1:183705022-183705044 TAGGTCTGGGAGAGTGAGGACGG + Intronic
918601360 1:186366270-186366292 AAAGACAAGGAGGATGAAGATGG + Intronic
918748212 1:188234175-188234197 AAGGAGTAGGAGAATAAAGACGG - Intergenic
918840918 1:189538463-189538485 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919911081 1:202111087-202111109 TGGGACTGGGAGAATGAGGCAGG + Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920125420 1:203690508-203690530 GAGGACTAGGTGAGTGAAGATGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
921021653 1:211241073-211241095 AAGATTTTGGAGAATGAGGAGGG - Intergenic
921034219 1:211360974-211360996 AAGGACCAGGAGAAGGAGAGAGG - Intronic
921050658 1:211509010-211509032 AAGGGCAAGGAGGATGAGAAAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921458167 1:215396582-215396604 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
921636349 1:217499144-217499166 AAGGACTAGGAGATTGAGAGAGG + Intronic
921776655 1:219108663-219108685 AAAGACAAGGAGAATTACGAAGG - Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922685728 1:227637602-227637624 GAGGTCTGGGAGAGTGAGGACGG + Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923135998 1:231119759-231119781 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
923810281 1:237307975-237307997 GAGGGCTAGGAAAATGAGGCCGG + Intronic
923810289 1:237308023-237308045 GAGGGCTAGGAAAATGAGGCCGG + Intronic
923976866 1:239273801-239273823 AAGGACTAGGAGAATTGACAGGG + Intergenic
1063237141 10:4128763-4128785 GAGGACTAGGAAAACGAGGCTGG + Intergenic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1064564469 10:16625790-16625812 AAGGAGTAGGAGCAAGAGGTTGG + Intronic
1064569923 10:16682248-16682270 GAGGGCTAGGAAAATGAGGCTGG + Intronic
1064707064 10:18084091-18084113 AAGAAGTGAGAGAATGAGGAAGG - Intergenic
1065932031 10:30488519-30488541 AAGGGCTGAGAGAAAGAGGAAGG + Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1067416183 10:46105181-46105203 GAGGGCTAGGAAAATGAGGAGGG + Intergenic
1067436326 10:46281673-46281695 GAGGGCTAGGAAAATGAGGCGGG + Intergenic
1067702884 10:48586436-48586458 AAGGATTAGGATAATGGAGATGG + Intronic
1067819758 10:49518365-49518387 AAGGGCTTGGAGAAGGAGAAGGG - Intronic
1068398284 10:56493550-56493572 AAGAGCTAAGAGGATGAGGAGGG - Intergenic
1068435735 10:56989022-56989044 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068777863 10:60887615-60887637 AGGGCCAAGGAGCATGAGGACGG + Intronic
1068833949 10:61531364-61531386 AGGGAGTAGGAGAGTGGGGATGG + Intergenic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1070267983 10:74923221-74923243 AAGGAGTAGGAGAAGTAGAAGGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070666711 10:78350234-78350256 AAGGACAGGGAGAATCAGTAGGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071212978 10:83366030-83366052 AAGGAATAGGTGCATGAGAAGGG + Intergenic
1071519481 10:86320203-86320225 AATCACTAAGCGAATGAGGATGG + Intronic
1071711799 10:88057022-88057044 AAGGACTGTGGGAATGAAGAGGG + Intergenic
1072061104 10:91811323-91811345 GATGATTAGGAAAATGAGGAGGG - Intronic
1072289639 10:93952293-93952315 AAGGACCTGGAGAGTGAGGAGGG + Intronic
1073065880 10:100758979-100759001 GAGGACTGGGAGAGTGAGGCAGG + Intronic
1073982775 10:109173803-109173825 GATGACGAGGACAATGAGGAGGG - Intergenic
1074561899 10:114542572-114542594 GAGGACGAGGAGGAGGAGGAAGG + Intronic
1075240456 10:120773856-120773878 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076109410 10:127849448-127849470 ACGGACAAGGGGCATGAGGAGGG + Intergenic
1076150889 10:128161225-128161247 AAGGAAAGCGAGAATGAGGAAGG - Intergenic
1076318935 10:129564354-129564376 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1076558736 10:131347125-131347147 AAGGAATGAGAGAAAGAGGAAGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1077078577 11:712533-712555 CAGGACTAGGAAAAGGAGGGAGG + Intronic
1078667752 11:13340433-13340455 TTGGACTAGGACAATGAGAAAGG - Intronic
1078807891 11:14725047-14725069 AAGGATTATGTGACTGAGGAAGG + Intronic
1078898315 11:15617854-15617876 AGGGAATAGGAGAAAGAGGCTGG - Intergenic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1079901987 11:26198130-26198152 GAGGACTAGGGGATTGAGGATGG + Intergenic
1079915999 11:26369408-26369430 AAGGATGAGGAGAATGAGTAGGG - Intronic
1079985908 11:27200751-27200773 AAGGAGTAGGAGTAGGAGTAAGG - Intergenic
1080369471 11:31618448-31618470 AAGAACCAGGAGAGTGAGAAAGG + Intronic
1080665323 11:34330913-34330935 AAGAAGTTGGAGAATCAGGAAGG - Intronic
1081351903 11:42064387-42064409 GAGGACTAGGAAAATGAAGCTGG + Intergenic
1081545102 11:44066171-44066193 CCGGACTAGGAGACTGAGGGCGG - Intronic
1081567761 11:44270387-44270409 AAGGAACAGGAGAAGAAGGAGGG - Intronic
1082079021 11:47997473-47997495 AAGGACTCAGTGAATGAGAAGGG - Intronic
1082635126 11:55585130-55585152 GAGGTCTTGGAGAGTGAGGATGG - Intergenic
1082762088 11:57136891-57136913 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083050085 11:59769274-59769296 GAGGAGGAGGAGGATGAGGATGG + Intronic
1083287340 11:61668600-61668622 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1083672591 11:64307330-64307352 AAGGAAGAGGAGGATGGGGAGGG + Exonic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084685379 11:70691320-70691342 AAGGCAAGGGAGAATGAGGAGGG + Intronic
1084965279 11:72741340-72741362 GAGGACTGGGAGAGTGGGGAGGG - Intronic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085145900 11:74196991-74197013 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1085150247 11:74246672-74246694 AAGGCATAGATGAATGAGGAAGG - Intronic
1085322756 11:75584608-75584630 AAGGACTGGGAGGAGGAGGAAGG + Intergenic
1085353616 11:75816089-75816111 TGGGACTCGGAGAATTAGGAAGG - Intronic
1085792856 11:79510935-79510957 AAGGACCAGGAGTAGGAAGAGGG - Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086308110 11:85503935-85503957 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1086671068 11:89548551-89548573 AGAAACTTGGAGAATGAGGAAGG + Intergenic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087355388 11:97086946-97086968 AAAAACTAAGAGAAAGAGGAAGG - Intergenic
1087491077 11:98828003-98828025 CAGGATTAGGAGACTGAGCATGG - Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088596027 11:111440881-111440903 GGGGACAAGGAGAGTGAGGAGGG + Intronic
1088695931 11:112365892-112365914 TAGGGCTAGGAGAAGAAGGAAGG + Intergenic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1090078893 11:123597458-123597480 AAAGACTAGGAGGATGAGCCAGG - Intronic
1090351299 11:126110169-126110191 GAGGACTGGGAGGATGGGGATGG + Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090862449 11:130666130-130666152 AAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091667981 12:2432901-2432923 AAGGAATTGGAGACTGAAGAGGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092266648 12:6986231-6986253 AAGGAGGAGGAGAAAGAGAAAGG - Intronic
1092782490 12:11999926-11999948 AAGGAAAAGGAGTATCAGGATGG - Intergenic
1093307286 12:17536951-17536973 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1093732537 12:22582234-22582256 AAGGAGTAGGTGGAAGAGGAGGG + Intergenic
1093775328 12:23067138-23067160 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094234393 12:28146899-28146921 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1095466899 12:42497194-42497216 AAGGAGGAGGAGAAAGATGAGGG + Intronic
1095505126 12:42888646-42888668 AGGGACTACTAGAGTGAGGAGGG - Intergenic
1095651776 12:44619647-44619669 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1095975710 12:47939599-47939621 CTGGACTAGGTGAGTGAGGAGGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096465540 12:51846353-51846375 AAAGACAGGGACAATGAGGAAGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096847092 12:54413309-54413331 ACGGAAGAGGAGAGTGAGGAGGG + Intronic
1096882440 12:54684103-54684125 AAGGACTGGGAGAATAGGCAGGG + Intergenic
1096968215 12:55645652-55645674 AAGGAAGAGAAGAATGGGGAAGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097964422 12:65563607-65563629 GAGGACGAGGAGGAGGAGGAGGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099926464 12:89024590-89024612 AGGGACTACTAGAATGGGGAGGG - Intergenic
1100098755 12:91076627-91076649 AAGGAAGAGGAGAATGAGAGAGG + Intergenic
1100201240 12:92299896-92299918 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1100822898 12:98448146-98448168 AAGCACTTAGACAATGAGGAGGG - Intergenic
1101221825 12:102649615-102649637 AAGAAATATGAGAATGAGGATGG + Intergenic
1102020748 12:109680556-109680578 AAGAACTGGTAGAATGTGGATGG - Intergenic
1102436814 12:112930532-112930554 AGGGACTTGGGGCATGAGGAAGG - Intronic
1102730475 12:115104416-115104438 AAGGACCATGAGAATGATTAAGG + Intergenic
1102746220 12:115251269-115251291 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103262203 12:119597112-119597134 AAGGACAAAGAGGAAGAGGAAGG + Intronic
1103932383 12:124457588-124457610 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1104001695 12:124864177-124864199 AAGGGGTAGGAGAAAGGGGAAGG - Intronic
1105344574 13:19561086-19561108 AAGGAAGAGGAGGATGGGGAGGG - Intergenic
1105532614 13:21233309-21233331 TAGGACTAAGAGAATGAGAGGGG - Intergenic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106553097 13:30788301-30788323 AAGGACAAGGATGATGAGTAGGG + Intergenic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108560426 13:51638001-51638023 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1108712700 13:53049430-53049452 AAGGAAGGGGAGAGTGAGGAAGG + Intronic
1108866775 13:54933360-54933382 AAGGGCTAGGAAAATGAGCCTGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109295733 13:60528219-60528241 AAGGAGTAAGATAATGAGGTAGG + Intronic
1109574864 13:64242070-64242092 AAGGTCATGGAAAATGAGGAAGG + Intergenic
1109994575 13:70107434-70107456 AAGGAAGAGGAGGAAGAGGACGG + Exonic
1110652006 13:77952507-77952529 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1111230970 13:85343453-85343475 AAGGAATACGAGAATGTGAAAGG + Intergenic
1111337045 13:86838563-86838585 AAGGAGTGCGTGAATGAGGATGG + Intergenic
1111350830 13:87028768-87028790 ATGGAATAGTAGAATGTGGATGG + Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111873065 13:93858688-93858710 AAAGAGTATGAGAATGAGAATGG + Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112054936 13:95681815-95681837 AAGGTCTAAAAGAATGAGGTAGG - Intronic
1112373881 13:98820863-98820885 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112744626 13:102512641-102512663 AAGGACTGGGAGAAGGAAGTTGG - Intergenic
1112788991 13:102982808-102982830 AAGGAGGAGGAAGATGAGGAGGG + Intergenic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113556594 13:111240534-111240556 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114870192 14:26646088-26646110 AAGGGCTAGGAGAAGCAGGGTGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116233925 14:42253634-42253656 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116658225 14:47675992-47676014 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116761692 14:49022758-49022780 AAGGACAAGGCAACTGAGGAAGG - Intergenic
1117006390 14:51425234-51425256 AAGGACGAGGATAATCAGGGAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117761636 14:59035328-59035350 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117831206 14:59752566-59752588 AAGTGCTATGAGAATGAAGAGGG - Intronic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1118327396 14:64790927-64790949 AAGGAAGAGGAGAATTAGCAGGG - Intronic
1118388175 14:65274076-65274098 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1118474639 14:66105232-66105254 AAGGGCTAGAAGAATGATGTAGG + Intergenic
1118544352 14:66869591-66869613 AAAGACTAGGAAAAAGAGAATGG - Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118942163 14:70347998-70348020 GAGGTCTGGGAGAGTGAGGATGG - Intronic
1119713167 14:76837733-76837755 AAGGATTAGGAGGATTAGGGAGG - Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120059198 14:79961753-79961775 AGGGACTACTAGAATGGGGAGGG - Intergenic
1120366737 14:83580956-83580978 AAGGGCTAGAAAAATGAGGAAGG - Intergenic
1120393423 14:83937553-83937575 AAGAACTCGGAGAAGGAGGATGG - Intergenic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121735729 14:96216749-96216771 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122579390 14:102762146-102762168 AAGGACTAGGAGAGTGGGGAGGG + Intergenic
1122671744 14:103378137-103378159 AAGGACTTGGAGATTCAGAAGGG - Intergenic
1123886783 15:24734566-24734588 AGAGAATAAGAGAATGAGGAAGG - Intergenic
1124114534 15:26829001-26829023 AAGGGCTGGGAAAATGAGGCGGG - Intronic
1124577150 15:30919808-30919830 GAGGACGAGGAGAGAGAGGAGGG + Intronic
1124701147 15:31913355-31913377 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125045258 15:35237884-35237906 GAGGACGAGGAGGAGGAGGAAGG + Intronic
1125106551 15:35978559-35978581 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125800140 15:42438498-42438520 ATAGAATAGGAGAATGGGGAGGG - Intronic
1126166659 15:45659316-45659338 AAGGACTGGGAGGAAGTGGAGGG + Intronic
1126354434 15:47780241-47780263 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1127122372 15:55782802-55782824 AAGGCCAAGGAGAATAAAGATGG + Intergenic
1127137742 15:55942512-55942534 AAGGAGGAGGAGAATGAAGGGGG - Intronic
1127176472 15:56363775-56363797 AACTACTAGGAGACTGAGGTGGG - Intronic
1127292435 15:57582438-57582460 AAAGACTTGGAGAAAGAGGGAGG - Intergenic
1127482118 15:59387342-59387364 ACGGGCTAGGAAAATGAGGCCGG - Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1128268124 15:66284960-66284982 AAGGAATAGGAGAACCAGGCTGG - Intergenic
1128304164 15:66587049-66587071 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128304189 15:66587127-66587149 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128733294 15:70035075-70035097 AAGGATGAGGGGGATGAGGAAGG - Intergenic
1129596604 15:76969329-76969351 AAGGGCTAGGAAAATGGGGCTGG - Intergenic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130721103 15:86386264-86386286 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131014180 15:89043625-89043647 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131852113 15:96554582-96554604 AAAGAGTAGGAGAAGGAGGGAGG - Intergenic
1131901113 15:97088690-97088712 AAGGAGGAGGAGGAAGAGGAAGG - Intergenic
1132933452 16:2469998-2470020 AAGGACCAGGAGGAAGAGAATGG - Intergenic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133460662 16:5983888-5983910 GAGGAGGAGGAGAACGAGGAGGG - Intergenic
1133943339 16:10328519-10328541 GAGGGCTAGGAAAATGAGGCTGG + Intronic
1134256135 16:12613191-12613213 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1134615891 16:15650687-15650709 AAGGAAGAGGAGAAAGAGGATGG - Intronic
1134997410 16:18750660-18750682 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135565486 16:23508499-23508521 AAGATGGAGGAGAATGAGGAAGG - Intronic
1135604843 16:23814568-23814590 AGGGACAAGGAGATAGAGGAAGG - Intergenic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1136639333 16:31549407-31549429 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1136994624 16:35181358-35181380 AGGCACCAGGTGAATGAGGATGG + Intergenic
1137327465 16:47456315-47456337 AAAGATTAGGAGAAAGAAGAGGG + Intronic
1137514611 16:49132359-49132381 AGGGAATATGAGGATGAGGAAGG + Intergenic
1137767725 16:50991059-50991081 AAGGAACAGGAGAAGAAGGAAGG + Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138395351 16:56700030-56700052 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1138659821 16:58510382-58510404 GAGGCCTAGGAGAATGGTGAGGG + Intronic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1139196299 16:64922024-64922046 AAGGAAAAGGAGAAAGAGAAAGG - Intergenic
1139267606 16:65654923-65654945 AAGGACCAGAAGAGAGAGGAGGG + Intergenic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1140744507 16:77969299-77969321 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141604434 16:85144862-85144884 ATGGATTTGGAGAAAGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1142399394 16:89851435-89851457 AAGGGGCAGGAGAATGAGGCTGG - Intronic
1143035131 17:3990770-3990792 AAGGAGTAGGAGGAAGAAGAAGG - Intergenic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143499766 17:7331864-7331886 AATGACTGGGAAAATGAGGGAGG + Intergenic
1143647266 17:8238787-8238809 AAGGCCTAAGAAAATAAGGATGG + Intronic
1143971237 17:10797420-10797442 AGGGATTGGGAGAGTGAGGAAGG - Intergenic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1145240856 17:21240505-21240527 ATGAGCTTGGAGAATGAGGAAGG + Exonic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146008740 17:29178421-29178443 AGGGATTAGGGGAATGAGAAGGG - Intronic
1146073408 17:29705071-29705093 AACAACTGGGAGAATGAGGCTGG - Intronic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146736388 17:35242556-35242578 AATTACTAGGAGAAGGAGGGAGG + Intergenic
1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG + Intronic
1147838475 17:43352727-43352749 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1148352382 17:46950349-46950371 AAGGGCCAGGAGGGTGAGGATGG + Intronic
1148403964 17:47395031-47395053 ATGGATTAGGAGAAAGCGGAGGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1149470071 17:56909208-56909230 AAGGTCCAGGAGAAGGGGGAAGG + Intronic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150898384 17:69240157-69240179 AAGAGCTAGGAGAATGTGCATGG - Intronic
1151271390 17:72999025-72999047 AAGGACGATGACAATGAAGATGG + Intronic
1151351383 17:73534080-73534102 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1151443528 17:74148811-74148833 AAGGAATAGGATGATGGGGAAGG - Intergenic
1152124550 17:78438425-78438447 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1152184763 17:78848394-78848416 AGGGGCTAGGAGGAGGAGGACGG + Intergenic
1152315955 17:79580279-79580301 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
1152318234 17:79593243-79593265 AAGAGCTGGGAGAAGGAGGAAGG - Intergenic
1152991457 18:367190-367212 AAGGACTAATATAATGACGAGGG + Intronic
1153368760 18:4289165-4289187 AAGGACTGGCTGAATGAAGATGG + Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1155130327 18:22928336-22928358 AGGGCATGGGAGAATGAGGAAGG + Intronic
1155344407 18:24844153-24844175 AAGCACTGGCAGAATGAGGCAGG - Intergenic
1155605082 18:27596010-27596032 CAGGACTAGGAAAATGCAGATGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156315449 18:35965087-35965109 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156445672 18:37235172-37235194 AAGGACAGGGAGAATTTGGATGG + Intergenic
1156461903 18:37326020-37326042 AAGGACCAGGGGAGGGAGGAAGG - Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156791699 18:40983823-40983845 AAGGAGGTGGAGAAGGAGGAGGG - Intergenic
1156930213 18:42632736-42632758 AAGGGCTAGAAAAATGAGGCTGG - Intergenic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157669585 18:49517142-49517164 AAGGACTTGGAGAGTGAGAGAGG + Intergenic
1157711359 18:49851987-49852009 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1159102264 18:63970311-63970333 AGGAACTAGGAGAATGACGGCGG + Intronic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159664709 18:71144165-71144187 TAGAAGTAAGAGAATGAGGAAGG - Intergenic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160254226 18:77233865-77233887 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1160612194 18:80097169-80097191 AAGGACGAGGGGGAGGAGGAGGG - Intergenic
1160816886 19:1040202-1040224 AAGGACTCGGAGAGGGAAGAAGG + Intronic
1161478957 19:4501244-4501266 GAGGACAAGGAGCACGAGGAGGG + Exonic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1163463080 19:17450702-17450724 AAGGAAGAGGAGGAGGAGGAGGG - Intronic
1163465968 19:17468934-17468956 AGGGACTAGGAGGCTGAGGCCGG - Intronic
1163674296 19:18647668-18647690 AAAGAACAGGAGAATGGGGAGGG + Intronic
1163739796 19:19004392-19004414 GAGGACGAGGACGATGAGGATGG - Exonic
1163781252 19:19249876-19249898 GAGGACTGGGAGAAGGACGAAGG + Exonic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1164584414 19:29457526-29457548 CAGGTCTAGGAGATAGAGGATGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1165538900 19:36474353-36474375 AATGACTAGGCAAATGAGGGGGG + Intronic
1165590784 19:36967701-36967723 AAGGTCTTGGTGAATGATGATGG - Intronic
1165716014 19:38046361-38046383 AAGAAATAGGGAAATGAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166643558 19:44514355-44514377 AAGGATCAGGAGGGTGAGGAAGG + Intronic
1167049365 19:47069091-47069113 CAGGACCGGGAGAATGAGGAAGG - Exonic
1167262118 19:48464676-48464698 GAGGACGATGAGACTGAGGAAGG + Exonic
1168239663 19:55082688-55082710 TAGGACTAGGAGAGTAGGGAGGG + Intronic
1168289091 19:55348262-55348284 ATGGACTAGGGGACTGAGGCTGG + Intergenic
1168675908 19:58277983-58278005 GAGGGCTAGGAAAATGAGGCTGG + Intronic
925198016 2:1943107-1943129 GAGGACGAGGAGGACGAGGAGGG - Exonic
925274304 2:2637934-2637956 AAGGAATAGGAGAGTGTGGGGGG + Intergenic
926462594 2:13150554-13150576 AAGGATTAGGAGGATGGGAAAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926546892 2:14252676-14252698 AAGGAGGAGGAGTAAGAGGAAGG - Intergenic
926570573 2:14525351-14525373 AAGGAAGAGGAGAAGGAGGGAGG + Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926950121 2:18233464-18233486 AATGACTACGACAATGAGTATGG - Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927561696 2:24077812-24077834 AAGGCTGAGGAGGATGAGGAGGG - Intronic
927571957 2:24167703-24167725 AAGGAATAGGAGAGTAAGAAGGG - Intronic
927989092 2:27434951-27434973 AAGCACTAGGAGAAAGAGGTAGG - Intronic
928099371 2:28426898-28426920 AAGGAATAGGAGGCTGAGTATGG + Intergenic
928301944 2:30132976-30132998 GTGGACTAGGAGAATGAGCATGG + Intergenic
928816412 2:35300156-35300178 AGGGACAATGAGAGTGAGGAGGG - Intergenic
929154424 2:38776718-38776740 GAGGGCTAGGAAAATGAGGCTGG + Intronic
930208238 2:48609536-48609558 AATGAGTAGGAGACAGAGGAAGG - Intronic
930259233 2:49125865-49125887 AAAGACTAGGAAACTGTGGATGG + Intronic
930357910 2:50345182-50345204 GAGAACTAGGAGAAGGAGAAAGG + Intronic
931007199 2:57865240-57865262 GAGGAAGAGGAGAATGGGGATGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931940137 2:67242960-67242982 AAGGTCTAGGAGAAAGACCATGG - Intergenic
932148143 2:69342885-69342907 AAGCATTAGGGGAATGGGGACGG - Intronic
932511476 2:72297345-72297367 GAGGAACAGGAAAATGAGGAGGG - Intronic
932627485 2:73309119-73309141 AGGGACAAGGGGCATGAGGAAGG - Intergenic
932921847 2:75924956-75924978 GAGGAAGAGGAGAAAGAGGAAGG + Intergenic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
933167868 2:79095279-79095301 GAGGTCTGGGAGAGTGAGGACGG + Intergenic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
934229793 2:90168978-90169000 AATGACTAAGAGAAGGAGCAAGG - Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934818103 2:97347940-97347962 AAGGGCGAGGAGAATGTGGTTGG + Intergenic
934819593 2:97360545-97360567 AAGGGCGAGGAGAATGTGGTTGG - Intergenic
935930161 2:108115423-108115445 AAGGACTAGGGGTATGAGTGGGG + Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936828237 2:116607623-116607645 AAGGATTTGGAGAATGCAGAGGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937490257 2:122359548-122359570 AAGGAGGAGGAGTAGGAGGATGG - Intergenic
937868080 2:126768820-126768842 AAAGACTTGGACAGTGAGGAAGG - Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938736611 2:134191731-134191753 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
939054835 2:137352160-137352182 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
939438360 2:142208267-142208289 AAGGACAAGAAGAGTGAGAAAGG - Intergenic
940092845 2:149940818-149940840 AAGGAAGAGAAGAAAGAGGAAGG - Intergenic
940434810 2:153638901-153638923 ATGGACTAAAACAATGAGGAAGG + Intergenic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943548175 2:189307599-189307621 GAGGGCTAGGAAAATGAGGATGG + Intergenic
943644591 2:190396179-190396201 AAGGAAGAGGAGGAAGAGGAGGG - Intergenic
943961465 2:194269679-194269701 AAGTACTAGGATAATGGGGTTGG + Intergenic
944328770 2:198440517-198440539 AATAAATAGGAGAATGAGGAGGG + Intronic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
944686325 2:202121087-202121109 AAGTCCAAGGAGAACGAGGAGGG - Intronic
944882388 2:204026682-204026704 AAGCCACAGGAGAATGAGGAAGG + Intergenic
945767220 2:213995952-213995974 AAGGACAAGGAGAAAGAGTGAGG - Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946083822 2:217151037-217151059 AGAGGCTAGGAGAATGACGAGGG - Intergenic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946751849 2:222899978-222900000 GAGGGCTAGGAAAATGAGGCTGG - Intronic
947356342 2:229299951-229299973 AAAGAGTAGGAGAAAGATGAAGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948106288 2:235416860-235416882 AAGTATTAGGAGAAAGAGAAAGG - Intergenic
948236119 2:236391962-236391984 AAGGACAAGGTGAGTGGGGAAGG - Exonic
948354554 2:237367735-237367757 AAGGACTAGGAGAAACAGATTGG + Intronic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948771771 2:240254951-240254973 AAGGACTAGGGGAAGAAGGATGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168838926 20:896434-896456 AAGGTCTGGGAGAGTCAGGAGGG + Intronic
1169503981 20:6188645-6188667 CAGGTCTTGGAGAATGAGTAGGG - Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170723794 20:18907731-18907753 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1170976995 20:21174028-21174050 AAGAACGAGGAGAACCAGGAGGG + Intronic
1171028092 20:21651274-21651296 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1171102865 20:22402268-22402290 AAGGAGTAGGTGAATAAGAAAGG - Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172008844 20:31834601-31834623 CAGGCCCAGGAGAATTAGGAAGG + Exonic
1172071026 20:32257257-32257279 AAGGACCAGATGAATGAGGCAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1173076808 20:39827166-39827188 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1173164475 20:40676995-40677017 TAGGAGTAGGAGAAGTAGGAGGG + Intergenic
1173344285 20:42184499-42184521 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1174644281 20:52072218-52072240 GAGGACGAGGAGAAAGAGAAGGG + Intronic
1174762563 20:53220751-53220773 AAGGACTAAGAAAATGATAATGG + Intronic
1174898565 20:54475573-54475595 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1175100624 20:56576247-56576269 GAGGAGTAGGAGGAGGAGGAGGG - Intergenic
1175429383 20:58891271-58891293 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1176918982 21:14663630-14663652 AAGGACCAGAAGGAGGAGGAAGG + Intergenic
1177057602 21:16327229-16327251 AAGGATTTGGATAATGATGATGG - Intergenic
1178397119 21:32252417-32252439 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1178505266 21:33157439-33157461 AAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178717919 21:34983771-34983793 AAGGAAGAGGAGAATGAAGTTGG + Intronic
1178991609 21:37361348-37361370 GATGGCTAGGAGAATGAAGATGG + Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179984745 21:44914085-44914107 AGGGCCTTGGAGAATGAGGAGGG - Intronic
1180516705 22:16151160-16151182 AAGGACTTGCAGAACCAGGAAGG + Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182755876 22:32678530-32678552 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1182825151 22:33258503-33258525 GAGGACTAGGAACATGAGGCTGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184311437 22:43647169-43647191 AAAGTCTAGGAGACTGAGGTGGG + Intronic
1184999419 22:48235326-48235348 AAGGAAGAGGAGAAAAAGGAGGG - Intergenic
949094318 3:67739-67761 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
949113780 3:295032-295054 AAGGAAGAGGAGAAGGAGAAAGG - Intronic
949223488 3:1664395-1664417 AAGCACTAGGAAAATCAGGATGG + Intergenic
949700271 3:6748673-6748695 AAGGAGGAGGAGAAGGAGAAGGG - Intergenic
950145610 3:10647599-10647621 AAGGTTTCGGAGAATGAGGCAGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
951020995 3:17780701-17780723 AAGTACTTAGAGAATCAGGAAGG + Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
952206948 3:31189875-31189897 AAGGCCCAGGAGATTGAGTAGGG + Intergenic
952240826 3:31530268-31530290 ACGGACGAGGAGAAGGAGAATGG - Intergenic
953082682 3:39635355-39635377 AAGGACTGGGGGAATGGGGCTGG + Intergenic
953380096 3:42463589-42463611 AAGGACTAGGACAATGCCCAAGG + Intergenic
953622455 3:44544829-44544851 AAGTACTTGCAGAATCAGGAAGG - Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954259484 3:49428415-49428437 AGGGACTATAAGAATGGGGAGGG + Intronic
954596513 3:51829934-51829956 AAGGCCCAGGAGAATGAGGAGGG + Intronic
955073532 3:55591761-55591783 AAGGACAAGAATAATGGGGATGG - Intronic
955314648 3:57926333-57926355 AAGGAAGAGGATAAGGAGGAAGG - Intronic
955333975 3:58069960-58069982 AAGTATTAGGAAAATGAGGATGG + Intronic
955855516 3:63268663-63268685 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
956018235 3:64907177-64907199 AAGTACTAGGGGAAGGAGTAAGG - Intergenic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957559399 3:81802951-81802973 AAGGAGTAGGGGAATGAGTTGGG - Intergenic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957582535 3:82092961-82092983 AAGTACTAGAAGGAGGAGGAAGG - Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
958140835 3:89560103-89560125 AAAGATTAGGAGAAAGAAGAGGG - Intergenic
958177245 3:90012118-90012140 AAGGAGTAGGAGGAAGAGAAGGG + Intergenic
958746678 3:98144176-98144198 GTGGACTAGTAGATTGAGGAGGG - Intergenic
958900780 3:99884052-99884074 ATGGGCTAGGAGAGTGAGAATGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960183239 3:114607597-114607619 AAAGAGTAAGAGAATGAGGCTGG - Intronic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960275110 3:115720237-115720259 CAGGAATAGGAGAATGTGAAGGG + Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
962060961 3:131926906-131926928 AAGGAGTAGGGGTCTGAGGATGG + Intronic
962436144 3:135368571-135368593 AAGGACTTGAAGAGAGAGGAAGG + Intergenic
963660561 3:148122185-148122207 AAGGTCTAATAGAATGAGGCAGG + Intergenic
963749909 3:149165941-149165963 AATGACCAGGAGAATAAGGTTGG - Intronic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965872466 3:173278398-173278420 GAGGTCTGGGAGAGTGAGGATGG - Intergenic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966059740 3:175740424-175740446 GAGGGCTAGGAAAATGAGGCTGG + Intronic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966668695 3:182502178-182502200 AGGGACTTGGAGAAGGAGGAAGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966928156 3:184658887-184658909 AAGGCCTGGGAGAGGGAGGAGGG - Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967059498 3:185859508-185859530 TAAGACCTGGAGAATGAGGAAGG - Intergenic
967312375 3:188118112-188118134 CACTACTTGGAGAATGAGGAGGG + Intergenic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968293792 3:197557823-197557845 GAAGACTGGGAGAATCAGGAAGG + Intronic
968896330 4:3406073-3406095 GAGGGCCAGGAGAATGAAGATGG - Intronic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970099141 4:12501318-12501340 AAGGAAGAGGAGAAGAAGGAAGG + Intergenic
970099156 4:12501382-12501404 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
970105164 4:12574438-12574460 AAGGAAGAAGAGAGTGAGGAGGG + Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970634864 4:17997732-17997754 AAAAACTGGGAGAAAGAGGATGG + Intronic
970637314 4:18022669-18022691 AAGGACTAGGAAAAAGATGCGGG + Intergenic
970768581 4:19582331-19582353 AAAGAATGGGAAAATGAGGAAGG - Intergenic
970923900 4:21427797-21427819 AAGGACTTTGAAAAAGAGGACGG - Intronic
971025233 4:22582833-22582855 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
971271363 4:25149617-25149639 AAAGTTTAGGAAAATGAGGAAGG - Intronic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
972042031 4:34614703-34614725 AAGCACTGGGAGAATGCAGAAGG + Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973052324 4:45611001-45611023 GAGGTCTGGGAGAGTGAGGATGG - Intergenic
973190540 4:47380474-47380496 AAGGACTCTGAGCATGAAGATGG - Intronic
973542395 4:51947313-51947335 CAGGACCAAGAGAGTGAGGAGGG - Intergenic
974657750 4:64846971-64846993 AAGGACTAAGGGTATGAGAAGGG + Intergenic
975705293 4:77105730-77105752 AAGGACTATGAAAATGAGGCTGG + Intergenic
976455078 4:85237057-85237079 AACTACTGGCAGAATGAGGATGG - Intergenic
976695800 4:87918705-87918727 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
976777188 4:88719602-88719624 AAGGAGGAGGAGAAAGAGAAGGG - Intergenic
976782326 4:88774830-88774852 AAGGACTTGGAAAATGACTAAGG + Intronic
976874520 4:89837160-89837182 GAGGACTAGGAGGAGGAGGACGG - Intronic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977376510 4:96211998-96212020 AGGGACTAGGAGAAAAAGTAAGG + Intergenic
977468114 4:97407379-97407401 AAGCAGTAGGAGAAAGAAGAAGG - Intronic
977710153 4:100115336-100115358 AAGAACTAGAAAAATTAGGAGGG - Intergenic
977862705 4:101984721-101984743 AAGGTCTCTGAGAATGAAGATGG - Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978702307 4:111662589-111662611 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
978903527 4:113980179-113980201 AAGGAATAGGAAAATGATGGGGG - Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979481094 4:121218593-121218615 AGGGACGGGGAGAAGGAGGAAGG - Intronic
980018917 4:127684624-127684646 AAGGAGGAGGAGGAAGAGGAAGG - Intronic
980778731 4:137469036-137469058 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
980875914 4:138661975-138661997 GAGGACTAGGAAAATGAGGTTGG - Intergenic
980909243 4:138978800-138978822 GAGGACTAGGAAAATGAGGCTGG + Intergenic
981399054 4:144290571-144290593 AAGGACCTAGAGGATGAGGAGGG + Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
982002301 4:151032042-151032064 AGGAACTAGGAGATTGAGAAAGG + Intergenic
982196939 4:152925876-152925898 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG + Intronic
982701620 4:158664031-158664053 AAGTACTTGCAGAATCAGGAAGG + Intergenic
983225920 4:165086242-165086264 ACAGACTAGGAGAATAAAGAAGG + Intronic
984097664 4:175451773-175451795 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985900036 5:2780945-2780967 AGGGACTAGGAGGGTGAGGAAGG - Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986451751 5:7872087-7872109 AAGGACTATGTGAAATAGGAAGG - Intronic
986623180 5:9697066-9697088 GAGGACGAGGAGAAGGAGAAAGG + Intronic
986879105 5:12147877-12147899 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987665510 5:20933323-20933345 GAGGACGAGGATAAAGAGGAAGG + Intergenic
988018304 5:25590027-25590049 AAGGACTATGAGACTGAGGAAGG + Intergenic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
988757185 5:34268855-34268877 GAGGACGAGGATAAAGAGGAAGG - Intergenic
989742121 5:44785607-44785629 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
989743075 5:44794562-44794584 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
989983737 5:50672037-50672059 AAGGCTCAGGAGAAAGAGGAAGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990314683 5:54572954-54572976 AAGGGCTAGGAAAATGTGGCTGG + Intergenic
990640706 5:57780589-57780611 AAGGAATAGGGGAAGGAAGAGGG - Intergenic
991128637 5:63095727-63095749 AATGATTAGAAAAATGAGGATGG - Intergenic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
991669677 5:69035546-69035568 AAGGACAAAGAGATTGGGGAGGG + Intergenic
992949538 5:81844777-81844799 AAGGAAGAGGAGGTTGAGGAAGG + Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993043130 5:82837839-82837861 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
993133562 5:83928918-83928940 AAGGAAGATGAGAATGAGAAAGG + Intergenic
993923952 5:93842540-93842562 AAAGACTAGGAGAACAAGGAAGG + Intronic
995129054 5:108610460-108610482 AAGGAAGAGGTGAAGGAGGAGGG + Intergenic
995788762 5:115860726-115860748 AAGGATGAGGAGAATGGGAAAGG - Intronic
995962574 5:117860845-117860867 TAGGAGTAGGAGAATTAGAATGG + Intergenic
996531049 5:124527386-124527408 AAGAATTTTGAGAATGAGGAAGG + Intergenic
997028672 5:130096826-130096848 AAGGAGGAGGAGAATCTGGAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997099482 5:130953223-130953245 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
997462978 5:134067624-134067646 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998015600 5:138729509-138729531 AAGGAGGTGGAGAATGAGGGAGG + Intronic
998368588 5:141646810-141646832 AAGGACAAGGACAAAGAGAAAGG + Intronic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999275517 5:150327393-150327415 AAGAACTGGGAGACTGAGGTAGG - Intronic
999825136 5:155266535-155266557 AATGACTAGGAGAAAAAGGTAGG - Intergenic
999993882 5:157073311-157073333 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1000406238 5:160891366-160891388 AAGGTCAGAGAGAATGAGGAAGG - Intergenic
1000578502 5:163006798-163006820 ACAGACCAGAAGAATGAGGATGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001105836 5:168853873-168853895 AAGGCCTTGATGAATGAGGAGGG - Intronic
1001224381 5:169931238-169931260 GACGACCAGGAGAGTGAGGAAGG + Intronic
1002553420 5:180015540-180015562 AAGGAGTAGGGGAAGGAGTAGGG + Intronic
1002780783 6:364180-364202 AAGGACTGGGAAACTGTGGACGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003105943 6:3216016-3216038 AAGGAAGAGGAGGAAGAGGAGGG + Intergenic
1003389651 6:5702812-5702834 TAGGACTAAGAGAATGAGGAGGG + Intronic
1003406748 6:5832545-5832567 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003610190 6:7606533-7606555 AAAGAATAAGAGAAAGAGGAAGG - Intronic
1003714318 6:8629597-8629619 AAGAGCTAAGAGAATGATGATGG + Intergenic
1004086741 6:12457086-12457108 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1004093640 6:12530659-12530681 AAGGACTTTGAGACTCAGGAAGG + Intergenic
1004176291 6:13342950-13342972 GAAGACTTGGAGAATGAGTACGG + Intergenic
1004444974 6:15689607-15689629 AAGGACTGGGAGAAAGGGGAAGG - Intergenic
1005478301 6:26230923-26230945 AAGGAATAAGAGAATTAGGTGGG - Intergenic
1006738464 6:36291646-36291668 AAGGACTAGGGAAGTGAGGCAGG - Intronic
1007232640 6:40359027-40359049 AGGGACTAGGACTCTGAGGAAGG - Intergenic
1007301223 6:40869359-40869381 CAGGACTCAGAGAGTGAGGAGGG + Intergenic
1007705098 6:43785679-43785701 AAGGACCAGGGGATGGAGGAAGG - Exonic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1008288372 6:49682480-49682502 GAGGAATAGGAGGAGGAGGAGGG - Intergenic
1008395657 6:51003764-51003786 AAGGGCTAGGAAAGTTAGGAGGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009567311 6:65325218-65325240 AAGGATGAGGAGGATGAAGAAGG - Intronic
1011157627 6:84350669-84350691 AAGGTCAAGGTGAATGAGGCTGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011484802 6:87830171-87830193 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1012526673 6:100185953-100185975 AAAGTCTAGGAGAAGAAGGAAGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012631083 6:101468558-101468580 AAGGACTTGTAAAATGTGGATGG + Intronic
1012734315 6:102919713-102919735 AAGGAATGGGAGAAGAAGGAAGG + Intergenic
1013184342 6:107744963-107744985 AAAGTCCAGGAGAAAGAGGAAGG - Exonic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1014362472 6:120497457-120497479 AATGACCAGGAAAATGAAGAGGG + Intergenic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016492362 6:144620753-144620775 TATTACTATGAGAATGAGGAGGG + Intronic
1016928310 6:149376605-149376627 AAGGACTGAGTTAATGAGGAAGG - Intronic
1017190843 6:151651060-151651082 AAGGAGGAGGAGAAAGAGAATGG - Intergenic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017688819 6:156942741-156942763 AAGCAATAGGAGGAGGAGGATGG - Intronic
1017691321 6:156968495-156968517 AAAGACGATGAGAATGATGATGG - Intronic
1017978078 6:159375392-159375414 TAGGACTGGGGGACTGAGGACGG - Intergenic
1018322905 6:162632486-162632508 GGGGACTATGAGAAGGAGGAGGG + Intronic
1018371329 6:163170836-163170858 AAGGAGTGGGAGAATGAAGGAGG - Intronic
1018378095 6:163232478-163232500 AAGGAAGAGGAGAAGGAAGAAGG + Intronic
1018577680 6:165276643-165276665 AGGGACAAGGACAATGAAGAGGG - Intergenic
1019398432 7:836205-836227 AAGATGTAGGAGAACGAGGAAGG + Intronic
1019491558 7:1316195-1316217 TAGGAATTGAAGAATGAGGATGG + Intergenic
1019937735 7:4267319-4267341 AAGGAATAGGGGAGAGAGGAAGG - Exonic
1020019056 7:4851326-4851348 AAGGACTCTGAGAAGCAGGATGG + Intronic
1020410710 7:7888864-7888886 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1020462433 7:8440819-8440841 CAGGACTGGGAGGATGGGGAAGG - Intronic
1020494665 7:8834375-8834397 AAGGAATAGTTGAATGAAGAGGG + Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020794749 7:12665856-12665878 AAAGCCTAGGATAATGAGGTTGG - Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021847105 7:24774101-24774123 AAGGAGTTGGAGGATGAGCAGGG - Intergenic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022659098 7:32349391-32349413 AGGGACTGGGAGAGTGTGGAGGG + Intergenic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023477080 7:40592475-40592497 AAGGGCTAGAGGAATGATGAAGG + Intronic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024336842 7:48217393-48217415 AAGGACTACAAGAATAAGCAAGG - Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024641410 7:51331842-51331864 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1025058040 7:55780956-55780978 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1025236235 7:57236627-57236649 GAGGAATAAGAGAAAGAGGAGGG - Intergenic
1026123804 7:67561805-67561827 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1026126162 7:67581647-67581669 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026328642 7:69333100-69333122 AAGGACTACCGTAATGAGGACGG + Intergenic
1026574401 7:71560300-71560322 AAGGAGGAGGAGAATGAGATAGG - Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027294136 7:76749459-76749481 AAGGAAGAGGAGAAGGATGAGGG - Intergenic
1027297828 7:76796266-76796288 AAGGACTTGGAGGAGGAGAATGG - Intergenic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028246745 7:88488397-88488419 AAAGAAGAGGAGAATGAGAAAGG - Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1029042911 7:97596712-97596734 AAGGACTAGGAGTCAGAAGATGG + Intergenic
1029453280 7:100654788-100654810 AAGGACTTGGAGACAGAGAAGGG + Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029923596 7:104292402-104292424 CAGGAGCAGGAGAATAAGGAGGG - Intergenic
1030266932 7:107630614-107630636 AAGAGATAGGAGACTGAGGAAGG + Intergenic
1030324191 7:108202795-108202817 AAGAACTAAGAGAATGAGAATGG - Intronic
1030473567 7:109999206-109999228 AAGAAATGGCAGAATGAGGATGG - Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032466830 7:132151390-132151412 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032934293 7:136711230-136711252 AAGGAGTGGGAGGAGGAGGAGGG + Intergenic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033560465 7:142525985-142526007 AACCATTAGGAGAAGGAGGAGGG - Intergenic
1034171045 7:149063416-149063438 CAGGAGTAGGAGAATCTGGATGG - Intergenic
1034204839 7:149306384-149306406 GAGGTCTTGGAGAATGAGGCTGG + Intergenic
1034918572 7:155060518-155060540 AAGGACTAGGGGAATTGTGATGG + Intergenic
1035413382 7:158664206-158664228 GAGGACGAGGAGGAAGAGGACGG - Exonic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036612983 8:10366000-10366022 AAGGAGCAGGGGAATGAGGCAGG - Intronic
1037326640 8:17698277-17698299 CAAGACTAGGAGTGTGAGGAGGG + Intronic
1037734261 8:21554381-21554403 AAAGACTTGAAGAATGAGTAGGG - Intergenic
1037834327 8:22207285-22207307 AAGGTCTAGGGGGATGAGGAAGG - Exonic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1038039037 8:23708576-23708598 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1038161364 8:25042162-25042184 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1038238821 8:25788531-25788553 AGGGCCTTGGAGAGTGAGGAAGG - Intergenic
1038271514 8:26079546-26079568 AAAGACCAGGAGGATGAGGAGGG - Intergenic
1039241009 8:35556869-35556891 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039482165 8:37882242-37882264 GAGGGCTAGGAAAATGAGGCTGG + Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039946363 8:42132336-42132358 AACGACTAGAAGAATGTGGGAGG - Intergenic
1040033181 8:42844217-42844239 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040975765 8:53193158-53193180 AAGCAGTAGGAAAATGAGTAAGG - Intergenic
1041406243 8:57502313-57502335 AAGGCTTAGAAGAAAGAGGAAGG - Intergenic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1042158293 8:65867188-65867210 GAGGTCTAGGAGAGTGAGGACGG - Intergenic
1042208307 8:66351262-66351284 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042491910 8:69409354-69409376 AAGAACTAGCAGAAAGAGAAGGG + Intergenic
1042675786 8:71320052-71320074 AAGAACTAGCAGAGTGAGGATGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043112453 8:76203365-76203387 AAGGACTCAGTGAAGGAGGAAGG - Intergenic
1043139692 8:76572814-76572836 AAGAACTAGAAGATTGAAGAAGG + Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1044953159 8:97452940-97452962 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1044972143 8:97630112-97630134 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046412653 8:113867375-113867397 AAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1046626445 8:116581551-116581573 TAAAACTAGGAGAATGAGGAAGG - Intergenic
1046905209 8:119565334-119565356 AAGGACGAGAAGAAAGAGTAAGG - Intronic
1047439974 8:124869080-124869102 AAGGGCTAAGAGGAAGAGGATGG + Intergenic
1047958990 8:129997119-129997141 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1048284382 8:133130482-133130504 AAGGACTTGGCCACTGAGGATGG + Intronic
1048417556 8:134243627-134243649 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048760448 8:137788679-137788701 AAGGTCTAGGAGAAAGAAAAGGG + Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1048922132 8:139240828-139240850 AAAGACCAAGAGAATCAGGAAGG + Intergenic
1049009341 8:139876818-139876840 AAGGCCTAGAAGAGTGAGGTGGG - Intronic
1049515019 8:143049704-143049726 AAGGAGGAGGAGCATAAGGAGGG - Intronic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1051266019 9:15308973-15308995 CAGCACTGGGAGACTGAGGAAGG + Intergenic
1051643264 9:19243517-19243539 AGGGACTAGGAGACTGGGAATGG - Intronic
1052515964 9:29480156-29480178 AAGGAAAAGGAAAATAAGGAGGG - Intergenic
1053073173 9:35112883-35112905 AGGGACTAGGGGGAAGAGGAAGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055218458 9:73897231-73897253 GAGGATGAGGAGAATTAGGAAGG - Intergenic
1056040517 9:82660698-82660720 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1056066296 9:82938936-82938958 AAGGAGTAGAAGAATGATGTAGG - Intergenic
1056271945 9:84955254-84955276 AAGGACATGGAGAATGAAGCTGG - Intronic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056609180 9:88113907-88113929 GAGGACTAGGAGAAGGGAGAGGG + Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1057861212 9:98642250-98642272 TTGGACGAGGAGACTGAGGAAGG - Intronic
1058102381 9:100931688-100931710 AAGAACTAGGAGGGTAAGGAAGG + Intergenic
1058444577 9:105043431-105043453 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058734316 9:107880065-107880087 AAGGGCTAGAATAATGAGGGAGG + Intergenic
1059028055 9:110658460-110658482 AAGACCTAAGAGAATGAGCAAGG + Intergenic
1060862129 9:126962956-126962978 AAAGCCTAGCATAATGAGGAGGG - Intronic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062195472 9:135271144-135271166 AAGGTTTAGGAGAATCAGGAGGG + Intergenic
1062454140 9:136627813-136627835 AAGGACCTGGAGAATGGGGCAGG + Intergenic
1062513981 9:136922886-136922908 GAGGACTAGGACAGGGAGGATGG + Intronic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1186011733 X:5142209-5142231 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1186027814 X:5333110-5333132 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186124716 X:6400918-6400940 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186161652 X:6783009-6783031 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1186205710 X:7197794-7197816 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1187158858 X:16745829-16745851 AAGGACAAAGAGAATGAGAGAGG - Intronic
1187204019 X:17165008-17165030 AATGTCTAGGAAAATGAAGACGG - Intergenic
1187216288 X:17280287-17280309 GAGGACTCGGAGGTTGAGGACGG - Intergenic
1187220949 X:17325266-17325288 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187337826 X:18396160-18396182 AGGGACTAGCAGCATCAGGAAGG - Intergenic
1187363584 X:18649344-18649366 GAAAACTAGGAGAATGAGGTGGG - Intronic
1187421147 X:19134737-19134759 AAGGACTAGGATATTAATGATGG + Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188702095 X:33277663-33277685 AAGGAGTAGGAGGCTGAGGGTGG - Intronic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1189298990 X:39938407-39938429 AAGGAAGAGGAAAAAGAGGAAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190497026 X:51036529-51036551 AAAGACTGGAAGAATGGGGAGGG - Intergenic
1190641020 X:52482761-52482783 AAGGAAGAGGAAAAGGAGGAAGG - Intergenic
1190646652 X:52530104-52530126 AAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1190753551 X:53381888-53381910 AAAGGGGAGGAGAATGAGGAAGG + Intronic
1191777097 X:64826511-64826533 AGGGACTGGGGGAAAGAGGAAGG + Intergenic
1192121977 X:68464878-68464900 AAGAAATATGAGAGTGAGGAGGG + Intergenic
1192499332 X:71639160-71639182 ATGGTCTGGGAGAATGAGAATGG - Intergenic
1193120547 X:77818764-77818786 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1194312594 X:92331349-92331371 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196329488 X:114453753-114453775 AAGAACTAGAAGAAGGAGGGAGG + Intergenic
1196492836 X:116289120-116289142 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1196597609 X:117563559-117563581 AAGGACTAGGAGAAGTTGGAAGG - Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1196975162 X:121151184-121151206 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1197867867 X:131037652-131037674 AAGGAAAAGGGGAATGAGAAAGG - Intergenic
1198778081 X:140202283-140202305 AAGGACAAGGAGGTTAAGGAAGG - Intergenic
1198840982 X:140857927-140857949 TAGGACCAGGAGAATGTGCAGGG - Intergenic
1198985455 X:142447218-142447240 CAGGAATGTGAGAATGAGGATGG + Intergenic
1199295758 X:146156592-146156614 AATGAGTAGGACAATAAGGAAGG + Intergenic
1199393603 X:147308997-147309019 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1199715752 X:150506336-150506358 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1199818891 X:151424732-151424754 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1199996669 X:153030481-153030503 GAGGAGTTGGAAAATGAGGATGG + Intergenic
1200620857 Y:5445495-5445517 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1201254278 Y:12091682-12091704 CAGGAATGAGAGAATGAGGAGGG - Intergenic
1201458095 Y:14193350-14193372 CAGGTCTTGAAGAATGAGGAAGG + Intergenic
1202111705 Y:21427737-21427759 AGGGGCTGGGTGAATGAGGATGG - Intergenic