ID: 1130129840

View in Genome Browser
Species Human (GRCh38)
Location 15:81130918-81130940
Sequence TCTTATATGCCCATGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 26, 3: 101, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130129838_1130129840 4 Left 1130129838 15:81130891-81130913 CCTAACATTTATTGATTGGATTT 0: 1
1: 0
2: 0
3: 39
4: 385
Right 1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG 0: 1
1: 0
2: 26
3: 101
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130129840 Original CRISPR TCTTATATGCCCATGGTTCA TGG Intronic
904454630 1:30640054-30640076 TCTCATGTTCCCAGGGTTCACGG - Intergenic
904665409 1:32116956-32116978 TCTTATATGACCATGGCTCATGG + Intronic
904777012 1:32915876-32915898 TCTGATATGTGCGTGGTTCATGG + Intergenic
904862958 1:33553373-33553395 TTTTATGTGTGCATGGTTCATGG - Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
905535680 1:38720014-38720036 TCTTCAATGCCCATGGTGAATGG - Intergenic
906130036 1:43450513-43450535 TCTGGTAGGCCCATGATTCAAGG - Exonic
906269846 1:44468030-44468052 TCTTATATGAGTGTGGTTCATGG + Intronic
907604849 1:55806184-55806206 TCTAATATGACTAAGGTTCATGG + Intergenic
907610360 1:55863582-55863604 TCTTATATGGGCACAGTTCATGG - Intergenic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
908222152 1:62018123-62018145 TCTTATTTGCTTATGTTTCATGG + Intronic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909189098 1:72529811-72529833 TCTTATATGGCTATGTTTCATGG - Intergenic
909220357 1:72951435-72951457 TCTTATATGGCCACAGTTCATGG + Intergenic
909442498 1:75713542-75713564 TATCATATGCCCATGGGTTAGGG + Intergenic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910231755 1:84995099-84995121 TCTTATATGGGCACAGTTCATGG + Intronic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
911955758 1:104232895-104232917 ACTTATATGGGCATAGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912168187 1:107064755-107064777 TGTTATAAGCCCATGATTTAAGG - Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
913369406 1:118081678-118081700 TCTTATTAGCACATGGTACAGGG + Intronic
914776284 1:150738748-150738770 TCTTATATGCACGTGGCTCATGG - Intronic
915415882 1:155742590-155742612 TCTGATGTGCCCATTGGTCAGGG + Intergenic
916476758 1:165176985-165177007 TGTTACATGCCCATGGTCCTAGG - Intergenic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
920879866 1:209869832-209869854 TCTTATAGGCCCATCTTTGAGGG - Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1069467611 10:68655821-68655843 TCCTATTGGCCCATGGCTCAGGG - Intronic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070420801 10:76235258-76235280 TCTTCTATGAGCATGATTCATGG + Intronic
1070683749 10:78466889-78466911 TCGTATATTCCCATGGCCCAAGG + Intergenic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071054006 10:81487713-81487735 TCTAATATGGTCATGGTTCATGG - Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073668326 10:105558677-105558699 TCTACAATGCCCATGGATCATGG - Intergenic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1075758584 10:124837432-124837454 TCTTATAAGCCTATGTTTTAAGG + Intergenic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1079093057 11:17494177-17494199 CCTTATCTGGCCCTGGTTCAGGG + Intronic
1079431974 11:20399222-20399244 GCTTAAATGCCTATGCTTCAGGG - Intronic
1079832449 11:25285333-25285355 TCTTATAAAGTCATGGTTCATGG + Intergenic
1080656865 11:34265177-34265199 TCTTATATGCTCAGGCTTCAAGG - Intronic
1081186357 11:40047140-40047162 TCTTATATGGACACAGTTCATGG + Intergenic
1081212083 11:40348061-40348083 TGTTATATGGGCATGGATCACGG + Intronic
1086494948 11:87393293-87393315 TCTTATATGAGCCTGGTTCATGG - Intergenic
1087577510 11:100008085-100008107 TCTTCTATGGGCATAGTTCATGG + Intronic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1094278583 12:28708458-28708480 TCTTATATGCTAATGGTACCTGG + Intergenic
1095466960 12:42497584-42497606 TCTTATATGGGCACAGTTCATGG + Intronic
1097453281 12:59763858-59763880 TCTTATATGGGCACAGTTCATGG - Intronic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1097964396 12:65563439-65563461 CCTTAGATGCCCATGGACCATGG - Intergenic
1098114579 12:67161545-67161567 TCCAATAAGCTCATGGTTCATGG - Intergenic
1099218345 12:79880995-79881017 TCTTCTATGAATATGGTTCATGG - Intronic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1104395713 12:128430786-128430808 TCTTATATGGGCACAGTTCATGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104991949 12:132630078-132630100 TCTTCTATGCGCACGGTTCATGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107898026 13:44985659-44985681 TCTTATATGGCCACGATTCATGG - Intronic
1107982978 13:45751105-45751127 TCTTCTAGGGCCATGTTTCAGGG + Intergenic
1109080499 13:57893725-57893747 TCTTATATGGGCACAGTTCATGG - Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110300792 13:73924480-73924502 TCTTCTATGGGCAGGGTTCATGG - Intronic
1111163555 13:84427246-84427268 TCTTATATAAGCATGGTTCCTGG - Intergenic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1112205832 13:97322531-97322553 TCTGATAAACCCATGGTTAATGG - Intronic
1112521143 13:100096344-100096366 ACTTATATGGGCGTGGTTCACGG - Intronic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1112978902 13:105356679-105356701 TCTTCTAAGGTCATGGTTCATGG - Intergenic
1113045146 13:106147408-106147430 TCTTATATGGCCAGGGCACAAGG + Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1115013124 14:28574505-28574527 TCTCATATGGACATGGTTTATGG + Intergenic
1115023656 14:28714129-28714151 TCCCATATGCCCATGTGTCATGG - Intergenic
1115424476 14:33241022-33241044 TCTAATATGCCAGTGGTCCAAGG - Intronic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1119569952 14:75661362-75661384 TCTCATCTTCCCATGGTTCGGGG - Exonic
1120848213 14:89144964-89144986 TCTTTTATGCCTTTGGTTAATGG + Intronic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121804620 14:96806268-96806290 TCTTATATACCCATGGAGGATGG - Intronic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122522702 14:102356789-102356811 TTATATATGCACATGGTTCATGG - Intronic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1126714271 15:51497644-51497666 TCTTTTATGCACATAGTTCAGGG - Intronic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130875222 15:88007945-88007967 TCTTCTGTGCCCATGATTCTAGG - Intronic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132382940 15:101379214-101379236 TGGAATATGGCCATGGTTCAGGG - Intronic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1135498283 16:22971655-22971677 TCATATTTGCCAATGGTCCATGG + Intergenic
1136856706 16:33664984-33665006 TCCTGCATGCCCATGTTTCATGG + Intergenic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1140574681 16:76152798-76152820 TCTTATATGGGCATAGTACATGG + Intergenic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1141994990 16:87630643-87630665 TATTATGTGCCCATAGTTTAAGG + Intronic
1146042985 17:29474624-29474646 TCTTATATGGGCACAGTTCATGG + Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1149015298 17:51902076-51902098 TCTTATAAGCCCTTGTTACAAGG + Intronic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1150162800 17:62913528-62913550 TCTCCTAAGCCCATGTTTCAGGG + Intergenic
1151955798 17:77379588-77379610 TCTTACATGCCCAGGCATCAGGG + Intronic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1153721581 18:7908880-7908902 TCTAATATGCACAAAGTTCATGG + Intronic
1154197903 18:12279610-12279632 TCTCCTGTGCCCATGATTCACGG + Intergenic
1156205381 18:34880459-34880481 CATTAAATGACCATGGTTCATGG + Intronic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1159180607 18:64897869-64897891 TTTTATATGGTCATGATTCATGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925798946 2:7577588-7577610 TCTGATTTCCCCATGGTCCATGG + Intergenic
926057467 2:9782764-9782786 TCTTATATGGGCACGATTCATGG - Intergenic
926608438 2:14921263-14921285 TCTTATATGAGTGTGGTTCATGG + Intergenic
927322550 2:21764284-21764306 TCTTATATGGATGTGGTTCATGG + Intergenic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
931407941 2:61998913-61998935 TCTTCTATGGGCATGTTTCATGG + Intronic
931924857 2:67060971-67060993 TCTTATATGAGTGTGGTTCATGG + Intergenic
931960957 2:67482364-67482386 TCTTATATGAGCATTGTTCATGG - Intergenic
932310132 2:70733118-70733140 TTTTATAAGCCCAGGGTCCAAGG + Intronic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
933626734 2:84609587-84609609 TCTTATATAAGCATGGTTCATGG + Intronic
933896809 2:86818576-86818598 TCATAAATGGGCATGGTTCATGG - Intronic
935796917 2:106651498-106651520 TCTTATATGGCTGTGGTTCACGG + Intergenic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
938960617 2:136337322-136337344 TCTTATATGAGCACAGTTCATGG - Intergenic
939139848 2:138341724-138341746 TCTTATATTCCAAAAGTTCAAGG - Intergenic
940608429 2:155958692-155958714 TCTTATATGGATGTGGTTCATGG - Intergenic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
941974558 2:171388884-171388906 TTTTATATGGATATGGTTCATGG - Intronic
942258981 2:174138411-174138433 TCTTCTATGTGCATCGTTCATGG + Intronic
943169194 2:184374331-184374353 TCTTATATGAGGATGATTCATGG - Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944273949 2:197814388-197814410 TATTATATGGGCATAGTTCATGG - Intronic
944529565 2:200653914-200653936 TCTTATATGGATGTGGTTCATGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
945346116 2:208718777-208718799 TCTTATATGGGCACAGTTCATGG + Intronic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
946490453 2:220144387-220144409 TCTTATATGCCAATGAGTGAGGG + Intergenic
946645529 2:221829379-221829401 TCTTGCATGCCTAAGGTTCACGG - Intergenic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
947317927 2:228882266-228882288 TCTTTTATTCCCTTGGTTGAGGG - Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169774747 20:9240283-9240305 TTTTTTATGACCATGCTTCAAGG + Intronic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1170580179 20:17693293-17693315 TCTGAAATGTCCATGGTTCCTGG - Intergenic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171236695 20:23532856-23532878 ACTTATATGGTCATGGTTCTTGG + Intergenic
1173910714 20:46667964-46667986 TCTTATATGGGCACAGTTCATGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1176702523 21:10072678-10072700 TCTTATATGGATGTGGTTCATGG + Intergenic
1177286296 21:19055685-19055707 TCTTATATGAGCATATTTCATGG - Intergenic
1177684073 21:24414405-24414427 TCTTAAATGCCCATTTCTCAAGG - Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180848870 22:19000846-19000868 TCTTATATGGGCACAGTTCATGG + Intergenic
1180887760 22:19259615-19259637 TCTTATATGTGTGTGGTTCATGG - Intronic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1181664064 22:24378758-24378780 TCTTATATGGGCACAGTTCATGG + Intronic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
949438374 3:4053276-4053298 TCTTTTATGGACATGGTTCGTGG + Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
954114597 3:48459302-48459324 TCTAATATGCCCATGCTTCTGGG + Intronic
954122259 3:48506266-48506288 TCTTATCTGCCCACAGCTCATGG + Intergenic
955211150 3:56942428-56942450 TCTTATATGAGGATGGTTCGTGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
956960612 3:74395973-74395995 TCTTACATGAGCAGGGTTCATGG - Intronic
957372968 3:79320076-79320098 GCTTATATGTCCATGGTCTATGG - Intronic
957764613 3:84606711-84606733 TCTTTTCTGCTCATGGTTTAGGG - Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959721704 3:109498103-109498125 TCTCATATGGGCCTGGTTCATGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963243018 3:143029482-143029504 TCTTATATGACCATAGTTTGTGG - Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964617009 3:158677156-158677178 TCTTATATGGGCAGGTTTCATGG - Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965996034 3:174884244-174884266 TCTTTCATGGCCAGGGTTCATGG - Intronic
966214336 3:177486490-177486512 TCTTATATGGGCACAGTTCATGG + Intergenic
966882160 3:184356664-184356686 TCATCTATCCCCATGGGTCATGG + Intronic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967515024 3:190357967-190357989 TTTTATATTCCCCTGGGTCATGG + Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
969195694 4:5562110-5562132 TGTTATGTGTCCATGGATCAAGG + Intronic
969289614 4:6230329-6230351 TCTGACATGCCCATGGGCCATGG + Intergenic
970302358 4:14694634-14694656 TCTTTTATACCCATGGCCCAAGG + Intergenic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
971044091 4:22785434-22785456 TATTATATGTGCTTGGTTCATGG + Intergenic
971164191 4:24165722-24165744 TCTTATATGGTAATGGATCATGG - Intergenic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
972701585 4:41499326-41499348 TCTTACATTCAAATGGTTCAGGG - Intronic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
974212066 4:58791042-58791064 TCTTATATGAGCATGGCTTATGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974953599 4:68611094-68611116 TCATATATCTCAATGGTTCATGG - Intronic
975124923 4:70771038-70771060 TCTTATATGGGCGTAGTTCATGG + Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975478282 4:74847931-74847953 TCTTATATAGGCATGATTCATGG - Intergenic
975733175 4:77357186-77357208 TCCTATCTGCCCAAGGCTCAGGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977314338 4:95426274-95426296 TCTTATATGAGTGTGGTTCATGG - Intronic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977597073 4:98895068-98895090 TCTTATATCGCCAATGTTCATGG + Intronic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978102852 4:104863840-104863862 CCTTATTTGGCCATGGTTCATGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
981425849 4:144602078-144602100 TCTTTTAAGCCCAAGATTCAAGG + Intergenic
981464422 4:145051307-145051329 TATTATATGAGCATGGTTCATGG + Intronic
982085122 4:151827347-151827369 TCTTACATGAGCATGTTTCATGG + Intergenic
983058260 4:163125048-163125070 TATTATATGGGCATAGTTCATGG - Intronic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
985968803 5:3358557-3358579 TCTTATATACCCACAGATCAGGG + Intergenic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987726654 5:21709324-21709346 TCTTATATGGGCACAGTTCATGG - Intergenic
987975145 5:25005723-25005745 TCTGATTTTCCCATGGTTAACGG + Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988704412 5:33710297-33710319 TCTTATATGGCAATGGTTGGAGG - Intronic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
990364143 5:55052254-55052276 TCTTATATGCCATTCATTCAAGG + Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990979388 5:61588145-61588167 TCTTATATGGGCAGGTTTCATGG - Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
991183459 5:63781245-63781267 TCTTACTTGACCCTGGTTCAGGG - Intergenic
992074548 5:73178957-73178979 TCTTATATGAGCAAGGTTGATGG - Intergenic
992776334 5:80092320-80092342 TGTTATATGCTAATAGTTCAGGG + Intergenic
994628730 5:102254473-102254495 TCTTAAAGGGGCATGGTTCATGG - Intronic
994900741 5:105765406-105765428 TCTTATATGGTCGCGGTTCATGG + Intergenic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995214400 5:109578580-109578602 TCTTATATGGATGTGGTTCATGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996398822 5:123037387-123037409 TCCTACATGACCATGGTTCTGGG - Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000453800 5:161423564-161423586 TCTTATATGGACATGCTTCGTGG - Intronic
1003548009 6:7077165-7077187 TCTCATATGCCCATTCTCCAAGG - Intergenic
1003706081 6:8531939-8531961 TCTTATATGGGCACAGTTCATGG - Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1003849593 6:10208201-10208223 TCTTGTCTCCCCATTGTTCAAGG - Intronic
1004371593 6:15057344-15057366 TCTTATATGGGCGTAGTTCATGG + Intergenic
1006075075 6:31527217-31527239 TCTTATATGAGCATCGCTCATGG + Intergenic
1008268921 6:49466199-49466221 TCTGATATTGGCATGGTTCATGG + Intronic
1008344863 6:50414001-50414023 TCTTATATGCCCATTCTTTTAGG - Intergenic
1008516301 6:52322607-52322629 TCTTGTATGAGCATGGCTCATGG + Intergenic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010064796 6:71669742-71669764 TCTTATATGTGCATGGGTCATGG - Intergenic
1010449404 6:75985987-75986009 TCCAATCTGCCCATGGTTCCTGG - Intronic
1012965077 6:105665347-105665369 TCTTCTATGTGCACGGTTCATGG + Intergenic
1013477565 6:110522954-110522976 TCTCATATGGCAATGTTTCATGG - Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1014975561 6:127877631-127877653 TCTTATATGCTCACTGTTCGTGG + Intronic
1015640710 6:135328486-135328508 TCTTCTATGGCTATGGTTTATGG - Intronic
1015821812 6:137269287-137269309 TCTTATATGAACGTGGTTCATGG + Intergenic
1016199424 6:141389561-141389583 TCTTATATGAGCACAGTTCATGG + Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1019065119 6:169289948-169289970 TCTGATATACCCATGACTCAAGG + Intergenic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020523276 7:9222690-9222712 TCTTATATGGGCGTGATTCATGG - Intergenic
1020802014 7:12743593-12743615 TCTTATATGACCATGGTGTGTGG - Intergenic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021285379 7:18775132-18775154 TCTTATATGGGCACGATTCATGG + Intronic
1022340628 7:29464069-29464091 TCTTATGTGTGCATTGTTCAGGG + Intronic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1024257952 7:47552614-47552636 TCTTATATGGATTTGGTTCATGG - Intronic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1026507719 7:70999977-70999999 TCTTATATGAGTATGGCTCATGG - Intergenic
1026653886 7:72239625-72239647 TCTTAAATCCCCAAGGTGCATGG + Intronic
1027526413 7:79274909-79274931 TATCATATGGGCATGGTTCATGG - Intronic
1027623152 7:80517705-80517727 TCTTATATGGACACTGTTCATGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028829402 7:95311019-95311041 TCTTAGATGCACTTGATTCAGGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030505170 7:110412293-110412315 TCTTATATGGTCATAGTTTATGG + Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031954760 7:127931038-127931060 TCTTATATGACTGTGGTTCATGG - Intronic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1032921583 7:136555002-136555024 TATTATATTCCCATCATTCAAGG + Intergenic
1033140865 7:138825211-138825233 TGTTCTATGGGCATGGTTCATGG - Intronic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1034380026 7:150683786-150683808 CATTTTATTCCCATGGTTCAAGG - Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035387075 7:158480311-158480333 TCTTCTATGGGCACGGTTCATGG - Intronic
1036521137 8:9492603-9492625 TCCTAAATGCCTAAGGTTCAAGG + Intergenic
1036618043 8:10403942-10403964 TCTTAAATGCTCATGGGTCACGG - Intronic
1037327835 8:17711967-17711989 TCTTAGATGAGCATGGTCCATGG + Intronic
1037927762 8:22857922-22857944 ACTTACATGCCCCTGGTGCATGG + Intronic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1040441259 8:47445355-47445377 TCCTATATGGCCACGGTTCATGG - Intronic
1040754030 8:50748780-50748802 TCTTATATGGGCACAGTTCATGG - Intronic
1042098089 8:65241190-65241212 TCTTAAATGCTCAAGGTTAATGG + Intergenic
1042140417 8:65673298-65673320 TCTTACATGTGCTTGGTTCATGG + Intronic
1042419432 8:68568111-68568133 TCTTATATGGACAGAGTTCATGG + Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1044536210 8:93358975-93358997 TCTGATATGCCAGTGGTTCTGGG - Intergenic
1045269968 8:100653280-100653302 TCTAAAATGTCCATGGTTCCTGG + Intronic
1045691465 8:104764050-104764072 TCTTCTATGCTGATGGATCATGG - Intronic
1047514847 8:125545017-125545039 TCTTATAAGCCCTTGGCACAGGG - Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048921472 8:139235063-139235085 ACTTTTAAGCCCTTGGTTCATGG + Intergenic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051123744 9:13780308-13780330 TCTTATATGGGCAACGTTCATGG - Intergenic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051454435 9:17238424-17238446 TCTTTTATGACCATGCTTCATGG - Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1051770764 9:20576626-20576648 TCTTATATGGGCACGCTTCATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052467659 9:28850510-28850532 TCTTTTTTGTCCATAGTTCATGG - Intergenic
1053639724 9:40059395-40059417 TCTTATATGGATGTGGTTCATGG + Intergenic
1054320473 9:63655734-63655756 TCTTATATGGATGTGGTTCATGG + Intergenic
1054545026 9:66317220-66317242 TCTTATATGGATGTGGTTCATGG - Intergenic
1055039533 9:71854369-71854391 TCTTATATGAGCGTGTTTCATGG + Intergenic
1055488205 9:76777689-76777711 TGTTATATGTCAATGGTTGATGG + Intronic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1057287241 9:93767560-93767582 GCTTTTATGCCCATGGATCAAGG - Intergenic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1058196361 9:101981725-101981747 TCTTATATGGGCACAGTTCATGG - Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059420985 9:114192353-114192375 CCTTTTATGTCCATGGTACAAGG - Intronic
1059558892 9:115311722-115311744 TCTTATATGAGCTTGATTCATGG - Intronic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1059952693 9:119483211-119483233 AATTATCTGCCCATGGTGCAGGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1061590004 9:131592050-131592072 TCCAAAATGCCCATGGTGCAGGG + Intronic
1202787542 9_KI270719v1_random:42770-42792 TCTTATATGGATGTGGTTCATGG + Intergenic
1185523260 X:757719-757741 ACTTATTTTGCCATGGTTCATGG + Intergenic
1186304095 X:8235428-8235450 TCATATATGAACATGGTTCATGG + Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187689593 X:21851811-21851833 ACAGATATGCCCATGGTTAATGG - Intronic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1190141940 X:47854720-47854742 TCTTCTATGCGCATGGTTCGTGG + Intronic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193652203 X:84150641-84150663 TCTTATGTGTGCGTGGTTCATGG + Intronic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1194615046 X:96089967-96089989 TCTTATAGGCTCAAGGTACAGGG + Intergenic
1194688463 X:96953860-96953882 TATAATATGCCCATTGTTCTGGG + Intronic
1195338729 X:103883445-103883467 TCTTATATGGGCACAGTTCATGG - Intergenic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196504768 X:116428398-116428420 TCTTATATGAACATAGTTCATGG - Intergenic
1197114047 X:122810968-122810990 TCTTATAAGGGCATGGTCCATGG - Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198621366 X:138514343-138514365 TCTTATATGAACATGGTTTTTGG + Intergenic
1198676101 X:139132903-139132925 TCTTCTATGGCCATAGGTCAAGG + Intronic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199343756 X:146714126-146714148 TCGTATATGGGCATGTTTCAGGG - Intergenic
1200641592 Y:5725293-5725315 TCTTAAATTCCCATGGTTTTAGG - Intronic
1201507856 Y:14724300-14724322 TCTTAGAAACCCATGGTTTATGG - Intronic