ID: 1130131748

View in Genome Browser
Species Human (GRCh38)
Location 15:81149389-81149411
Sequence CATCAAGTACTGCAGGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130131744_1130131748 3 Left 1130131744 15:81149363-81149385 CCCTCTTCAAGAAGGCAAGCATT 0: 1
1: 0
2: 1
3: 17
4: 204
Right 1130131748 15:81149389-81149411 CATCAAGTACTGCAGGATTTAGG No data
1130131745_1130131748 2 Left 1130131745 15:81149364-81149386 CCTCTTCAAGAAGGCAAGCATTT 0: 1
1: 0
2: 1
3: 14
4: 211
Right 1130131748 15:81149389-81149411 CATCAAGTACTGCAGGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130131748 Original CRISPR CATCAAGTACTGCAGGATTT AGG Intergenic
No off target data available for this crispr