ID: 1130135381

View in Genome Browser
Species Human (GRCh38)
Location 15:81177487-81177509
Sequence CCTTTTATGCAGGGGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130135372_1130135381 -8 Left 1130135372 15:81177472-81177494 CCTGTTCCCTCGGCTCCTTTTAT 0: 1
1: 0
2: 1
3: 11
4: 261
Right 1130135381 15:81177487-81177509 CCTTTTATGCAGGGGAGGGATGG 0: 1
1: 0
2: 2
3: 16
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130135381 Original CRISPR CCTTTTATGCAGGGGAGGGA TGG Intronic
900183448 1:1322526-1322548 ACTTTTGAGCAGGGGAGGGGAGG + Intronic
900493944 1:2967684-2967706 CCTTTTAGGCAGGAGAGGGCAGG - Intergenic
900907496 1:5571188-5571210 GATTTCATGAAGGGGAGGGAAGG - Intergenic
901695805 1:11007082-11007104 CTTTTTCTGCGGGGGCGGGAAGG + Intergenic
901886827 1:12229658-12229680 CGTTTTAAGCAGGGAAGGGCAGG + Intergenic
902324277 1:15688842-15688864 CATCTTCTCCAGGGGAGGGAAGG + Intronic
903035558 1:20490462-20490484 CCTTTCAAGGAGGGTAGGGAAGG - Intergenic
903140476 1:21335933-21335955 GCTGTTCTGCAGGGTAGGGAAGG - Intronic
904486790 1:30830200-30830222 CCTCTTATTCAGGGAAGGGAAGG + Intergenic
904642961 1:31944485-31944507 CCTCTTTTGCAGGGGCGGGGCGG + Intronic
905757932 1:40527493-40527515 CCTGTTATGGAGTGGGGGGAAGG + Intergenic
908903171 1:68979486-68979508 CTTTCTTTGCTGGGGAGGGAAGG + Intergenic
909015086 1:70372121-70372143 CCTGTTATGTAGGGAAGGGAGGG - Intronic
910434442 1:87190953-87190975 GCTTTTCTGCTGGAGAGGGAGGG + Intergenic
911655585 1:100439282-100439304 TCTTTTTTGTAGGGGAAGGATGG + Intronic
911980461 1:104559720-104559742 CAATTAGTGCAGGGGAGGGAAGG - Intergenic
912096405 1:106149951-106149973 CCTTTTAGTCATGGGTGGGATGG - Intergenic
912565797 1:110586355-110586377 ACTTTTATGCAGGGTGGGCAGGG - Intergenic
912757409 1:112335915-112335937 CCTATAATGCAGGAGAAGGAAGG - Intergenic
912932844 1:113980191-113980213 CCTTTTCTGCAGGAGTGGAAGGG + Intronic
913228629 1:116722162-116722184 GCTGTCATGCAGGGGAGAGATGG + Intergenic
915078819 1:153337254-153337276 CCATTTATGAAGGGGTGGGCTGG - Exonic
915919934 1:159968565-159968587 CCTTCTTTGTAGGGGAGAGAGGG + Intergenic
916891144 1:169113674-169113696 TCTTTTAGGAAGGGGATGGAAGG - Intronic
917625547 1:176842469-176842491 CCTCTGAGGCAGTGGAGGGAGGG - Exonic
918454669 1:184696467-184696489 CCCTTTATGATGGGGAGGAAAGG + Intronic
920092105 1:203462176-203462198 ACCTTGATGCAAGGGAGGGAAGG + Intergenic
920197218 1:204236887-204236909 CCTTGAATGAAGGGGAGGCAGGG + Intronic
920349049 1:205325545-205325567 CCTTTCTTGGAGGGGAGGTAGGG - Intergenic
921235482 1:213123174-213123196 CATTTTATGGAGGGGAGGCGGGG + Intronic
922222752 1:223621015-223621037 GCTCTTATGCTGGGGAGAGAAGG - Intronic
922288157 1:224186904-224186926 ACTTTTTGGCGGGGGAGGGAAGG + Intronic
923079195 1:230637587-230637609 CCCTTTATGATGGGGAGGAAGGG + Intergenic
923803064 1:237229281-237229303 CCTTTTATGCATGGTGGGGATGG + Intronic
1062902988 10:1159632-1159654 CGCTTTATGCAGATGAGGGATGG + Intergenic
1063889858 10:10618206-10618228 GATTTTAAGCAGGGGAGTGACGG - Intergenic
1064463223 10:15554871-15554893 CCTTTTTTGCAAGGCAGAGAGGG + Intronic
1069081586 10:64094288-64094310 CCTCTTATACTGGGAAGGGAAGG - Intergenic
1069120001 10:64557498-64557520 CCATTTTTGGAGGGGAAGGAAGG + Intergenic
1069521550 10:69124963-69124985 CCTATGAGGCAGAGGAGGGAGGG + Intronic
1069620865 10:69836504-69836526 ACATATAAGCAGGGGAGGGAGGG + Intronic
1071256588 10:83877261-83877283 CCTCATCTGCAGTGGAGGGATGG - Intergenic
1071299889 10:84248522-84248544 CCTTTTAGGCTGGGGAGGCCTGG + Intronic
1072165996 10:92813692-92813714 CTTTGTAGGCAAGGGAGGGAAGG - Intergenic
1075685024 10:124357773-124357795 CCATTCATCCAGGGTAGGGAAGG - Intergenic
1076567745 10:131410492-131410514 CCTTCCACGCAGGGCAGGGAAGG + Intergenic
1078545928 11:12246972-12246994 CCTGGAATGCTGGGGAGGGAAGG + Intronic
1078896734 11:15603508-15603530 CTCTTCTTGCAGGGGAGGGAGGG + Intergenic
1079294463 11:19219941-19219963 CTTTTCCTGCAGGAGAGGGATGG + Intergenic
1080859789 11:36143255-36143277 ACTTTTAAGCAGGGGAAGCAAGG - Intronic
1081337779 11:41888229-41888251 TATTTTATGTATGGGAGGGAAGG - Intergenic
1081758070 11:45558841-45558863 ACTTATAGGCAGGGGATGGAGGG - Intergenic
1082856935 11:57816620-57816642 CCTTTTGTGGAGGGGAGGGATGG + Exonic
1083268674 11:61559501-61559523 GCTTTTGAGCAGGGGAAGGATGG + Intronic
1083525403 11:63360445-63360467 CCTGTCATGCAGTGGAGGGATGG - Intronic
1084423447 11:69071840-69071862 CCTGTTCCCCAGGGGAGGGAAGG + Intronic
1084558363 11:69888864-69888886 CCTTTTATTCGGGGGAGGTCGGG + Intergenic
1084867271 11:72069436-72069458 CCTTTTGATCAGGGGAGTGAAGG - Intronic
1084952215 11:72672878-72672900 CCACTGATGCAGGGCAGGGAGGG - Intronic
1085255568 11:75170776-75170798 CTTTTCTTTCAGGGGAGGGAGGG - Intronic
1085527398 11:77172384-77172406 TCCTTTATACAGGGAAGGGAGGG + Intronic
1088893271 11:114060466-114060488 CCCCTTTTGCAGGGGAGGGAGGG + Intronic
1089740436 11:120578565-120578587 CCCTCTATGGAAGGGAGGGAAGG - Intronic
1090095336 11:123737391-123737413 ACTTTTATGAAGGGGCGGGGGGG - Intronic
1090492520 11:127177256-127177278 TATTTTATGCAGGGGAAGGCAGG + Intergenic
1092203196 12:6600002-6600024 CCTTTACTGCAGGAGAAGGAAGG - Exonic
1092908953 12:13128235-13128257 CCTTTTCTGGTGGGGAGGGATGG - Intronic
1096431975 12:51552458-51552480 CCCTTTCTGCTGGGGAGGCAAGG + Intergenic
1097028751 12:56076905-56076927 CCTTTAATGTGGGGGAGGGTAGG + Intergenic
1097520355 12:60661311-60661333 CCTTTCAGAGAGGGGAGGGAAGG - Intergenic
1098243990 12:68497403-68497425 GCTATCATTCAGGGGAGGGAAGG - Intergenic
1101822054 12:108191800-108191822 CCTTTTCTCCTGGGGAGGGAAGG - Intronic
1104313922 12:127679576-127679598 GCATTTATGCAGGGGCAGGAAGG - Intergenic
1104960990 12:132488747-132488769 CCTCTTGTGCAGGGCAGGAAGGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105585415 13:21738646-21738668 CCTTCCATGCAGGGCAGGGCTGG + Intergenic
1108418116 13:50221595-50221617 CCTTTGGTGAAGAGGAGGGATGG + Intronic
1109196669 13:59385209-59385231 CCATCTTTGCAGGGGAGGAATGG + Intergenic
1111035747 13:82670276-82670298 CATTTTATGCAAGGGACTGAAGG - Intergenic
1113490355 13:110686871-110686893 TTTTTTGTGCAGGGGAGGGTGGG + Intronic
1114373374 14:22114633-22114655 CCTTTTTTTCGGGGGAGGGGAGG + Intergenic
1116860280 14:49989918-49989940 GCTTTTATGCAGGTGAGGTGGGG + Intronic
1118900761 14:69983530-69983552 CCACCTCTGCAGGGGAGGGAAGG + Intronic
1118984279 14:70740115-70740137 CCTTTTATCCATGGTAGGGGAGG + Exonic
1119529845 14:75352431-75352453 CCTTTGCAGCAGGTGAGGGAGGG + Intergenic
1119666385 14:76488200-76488222 CATTTTGTGCAAGGAAGGGAGGG - Intronic
1121388817 14:93556612-93556634 CCTCTCATGCAGGGCAGTGAGGG + Intronic
1121792013 14:96705687-96705709 CCTTTTCCCCAGGGGAGGAAAGG - Intergenic
1121843972 14:97157179-97157201 CCTTTTATGCAGCCAAGTGATGG + Intergenic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1124693822 15:31847001-31847023 CCTGCTAGGCAGGGCAGGGAAGG + Intronic
1125608216 15:40954084-40954106 CCATTCATGCAGGGGAAGGTGGG - Intronic
1125744086 15:41987370-41987392 CGTCTTCTGCAGGGGAGGGAGGG + Exonic
1126389648 15:48132891-48132913 CCTTTTATGTAGGGGATTAAAGG + Intronic
1129233522 15:74209719-74209741 CCCTCTAGGAAGGGGAGGGAGGG - Intronic
1130135381 15:81177487-81177509 CCTTTTATGCAGGGGAGGGATGG + Intronic
1130926354 15:88388492-88388514 ACTTTTAAGCAGTAGAGGGATGG + Intergenic
1131311838 15:91297308-91297330 CCTTTGCTGCAGAGGAGGCAGGG + Exonic
1131433079 15:92402043-92402065 TCTTTTATGAAAGGGAGTGATGG + Intronic
1131475961 15:92739609-92739631 CCTGTCGTGCAGTGGAGGGATGG + Intronic
1131486359 15:92824256-92824278 CCTTTTTTGCGGGGGGGGGGGGG + Intergenic
1132028970 15:98425278-98425300 TCTGATATGCAGGGGAGGGAAGG + Intergenic
1133255442 16:4513419-4513441 CCTTGTGTGCAGGAGAGGGGTGG - Intronic
1133343645 16:5055470-5055492 CGTTCAATGCAGAGGAGGGAAGG + Intronic
1136587871 16:31199418-31199440 CCATTTAAGCAGGGGAGTGGTGG + Intergenic
1137785217 16:51133088-51133110 CTTTTTAGGGAGTGGAGGGAGGG - Intergenic
1137851501 16:51750372-51750394 GCATTTGTTCAGGGGAGGGAAGG - Intergenic
1138239009 16:55411447-55411469 CCTCTCCTGCAGGGGAAGGACGG + Intronic
1140208537 16:72952718-72952740 CGGTTTATGCAGGGCAGTGATGG - Intronic
1143368417 17:6423175-6423197 CCTTTTCTTCAAGGGTGGGAAGG + Intronic
1144058179 17:11559587-11559609 CCTTTGATCCAGAGGAGGCACGG - Exonic
1144288224 17:13800306-13800328 CCTTCTCTGCAAGGGAGAGAGGG - Intergenic
1146569355 17:33939511-33939533 CTTTTTATGCAGGGGATCCAGGG - Intronic
1148743948 17:49908177-49908199 GCTTTTCTGCTGGGGTGGGAAGG - Intergenic
1148908152 17:50924599-50924621 CTTTTTTTGCTGGGGAGAGATGG + Intergenic
1151037821 17:70821704-70821726 CCTTTAATGAAGGGGAGGCTGGG - Intergenic
1151585358 17:75005166-75005188 CATTTTATGGGAGGGAGGGAGGG - Exonic
1152024191 17:77798084-77798106 TGTTTTATGCGGGGTAGGGAGGG - Intergenic
1152468029 17:80476629-80476651 CCTTTTATGCCGCCGCGGGAGGG + Intronic
1152511860 17:80795422-80795444 CCTTTGGTGCTGGGGAGGGAGGG - Intronic
1152521031 17:80857166-80857188 CCTCAGAGGCAGGGGAGGGAGGG - Intronic
1154440716 18:14387866-14387888 CATGTTATGCATGGGAGTGATGG + Intergenic
1155994054 18:32311588-32311610 CCTTTGGTGTAGGTGAGGGAGGG + Intronic
1157414524 18:47490777-47490799 CTTCTTATGGAGGGAAGGGAAGG + Intergenic
1157903364 18:51542590-51542612 CCGTTCATGCAGGGAGGGGATGG - Intergenic
1160880737 19:1318867-1318889 CCATTCCTGCCGGGGAGGGAAGG + Intergenic
1160994244 19:1875089-1875111 CCTCTTATGCTGGTGGGGGAGGG + Intergenic
1161366125 19:3880805-3880827 TCTTTTGTGCAGGGGTGGGTGGG - Exonic
1161409445 19:4108723-4108745 CCCTTTCTGCATGGGAGGAAGGG + Intronic
1163117013 19:15195211-15195233 CCTCTTATGCAGGGATGGGAGGG + Intronic
1164572115 19:29382050-29382072 CCCATTCTGCAGGGGAGAGAAGG + Intergenic
1166376613 19:42331001-42331023 GCTTTGGGGCAGGGGAGGGACGG + Intronic
1168050568 19:53826644-53826666 AGTTTTGAGCAGGGGAGGGATGG + Intergenic
925452299 2:3980030-3980052 CTCTTTATGAAGGGAAGGGAAGG - Intergenic
926810597 2:16752173-16752195 CCTTGAATGCAGGGGAGGCTGGG - Intergenic
927711806 2:25330788-25330810 CTTTTTAATAAGGGGAGGGAGGG - Intronic
927717292 2:25360890-25360912 CCTCTCCTGCAGGGGAGGGCAGG + Intergenic
927729092 2:25454522-25454544 GCTGTTATGTAGGGGAAGGATGG + Intronic
927731395 2:25475808-25475830 CCTTTTATGGAGTGCAGGCAAGG - Intronic
928238948 2:29569872-29569894 CTTATAATGCAGAGGAGGGAAGG - Intronic
931046275 2:58357513-58357535 CCTTTTGTGCATGTGAAGGAGGG + Intergenic
931200550 2:60093302-60093324 CATTTTAGGCAGGGGAAGCATGG + Intergenic
931723286 2:65083186-65083208 CCCTTTGTGCAGGGCAGGGGTGG - Intronic
933243380 2:79947991-79948013 CCTTTCTTGCAGGGCAGGGACGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934792165 2:97070564-97070586 AATTTGATGCAGGGGAAGGAAGG + Intergenic
934814455 2:97313145-97313167 AATTTGATGCAGGGGAAGGAAGG - Intergenic
934823238 2:97395338-97395360 AATTTGATGCAGGGGAAGGAAGG + Intergenic
935317332 2:101848652-101848674 CCCTTTTTGCAGGTGAGGGAGGG + Intronic
935520362 2:104096759-104096781 GCTTTTTGGCAGGGGTGGGAGGG - Intergenic
935797394 2:106658149-106658171 CCATTTATACAGGGGAGGACAGG - Intergenic
936677603 2:114733307-114733329 CCATTGATGCTGAGGAGGGATGG - Intronic
936971815 2:118183781-118183803 ACTTGTGTGCAGGAGAGGGAGGG + Intergenic
942044622 2:172092962-172092984 TCTTTGAGGCATGGGAGGGAAGG - Intergenic
942360784 2:175168814-175168836 GGTTTTTTGGAGGGGAGGGATGG - Intergenic
943077253 2:183210393-183210415 CCTGTTGTGCGGTGGAGGGAGGG - Intergenic
943569407 2:189555563-189555585 CCTTTTATTGAATGGAGGGAGGG + Intergenic
944735596 2:202560050-202560072 TCTTTGTTGCAGGGGTGGGAGGG - Exonic
945215716 2:207431840-207431862 CTTTTGATGCAGGGTAGGTAAGG - Intergenic
945726389 2:213475947-213475969 ACTTAAATGCAGAGGAGGGAAGG + Intronic
946717807 2:222571704-222571726 CCTAATATGCAGGGAAAGGATGG + Exonic
947634263 2:231672290-231672312 CCTGTTATGAAGGCGGGGGAGGG - Intergenic
948071812 2:235134013-235134035 CTTTTTAGGTGGGGGAGGGAGGG + Intergenic
948200955 2:236129381-236129403 CCCATTATGCAGGAGAGAGAAGG + Exonic
1169482595 20:5998249-5998271 CCTATAATGCAGGGGCTGGAAGG + Intergenic
1170801654 20:19595375-19595397 CCCTTGATGCAGGGCAGGGGAGG + Intronic
1171295448 20:24012839-24012861 CGTGTTATGAAGAGGAGGGAAGG - Intergenic
1171964463 20:31518895-31518917 TCTTTTATGGTGGGGAGGGTAGG + Intronic
1172840308 20:37898962-37898984 CCTCTCAAGGAGGGGAGGGAGGG + Intergenic
1173362900 20:42360316-42360338 CATGTGAGGCAGGGGAGGGAAGG - Intronic
1173628862 20:44494678-44494700 CCTCCTCTGCAGGTGAGGGAGGG + Intergenic
1173688651 20:44941882-44941904 AATTTGATGCAGTGGAGGGAAGG - Intronic
1175620844 20:60446068-60446090 CCTTGTCTGCAGTGGAGGAAAGG - Intergenic
1176455334 21:6903309-6903331 CATATTATGCATGGGAGTGATGG - Intergenic
1176833506 21:13768357-13768379 CATATTATGCATGGGAGTGATGG - Intergenic
1176954846 21:15090264-15090286 CCTTCTCTTGAGGGGAGGGAGGG - Intergenic
1177678036 21:24328098-24328120 CCTGTTGTGCGGGGGAGGGGAGG - Intergenic
1177912983 21:27054731-27054753 CCTTGAATGAAGGGGAGGCAGGG + Intergenic
1178178360 21:30130732-30130754 CCTCTTATACATGGGAGGTATGG + Intergenic
1178234109 21:30821876-30821898 GGTTTTAAGCAGGGGAGGGATGG + Intergenic
1178961346 21:37068984-37069006 TGTTTTCTGCAGGGGAGGGCAGG + Intronic
1179553139 21:42156065-42156087 CCTTTTCTCCAGGGGAAGGCTGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181063780 22:20295704-20295726 ACTGTTGTCCAGGGGAGGGATGG + Intergenic
1181065999 22:20306344-20306366 CCTCTCATGCAGGGCCGGGAGGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
1182460450 22:30480021-30480043 CCTTTTTATCTGGGGAGGGAGGG - Intergenic
1183485679 22:38086553-38086575 CCTTTCATGCAGGTGCGGGGAGG - Intronic
1183543105 22:38441257-38441279 CCTTTCTGGCTGGGGAGGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949460015 3:4281302-4281324 GCTTTGATTCAGGGAAGGGATGG + Intronic
950690670 3:14653604-14653626 CCTTTTTTGCAGAGTAGGCAGGG + Intronic
950881836 3:16328564-16328586 CATTTTATACAGCGGAGGAAAGG - Intronic
951589044 3:24243524-24243546 CCCTTAATGGAGGTGAGGGAGGG - Intronic
951911547 3:27755378-27755400 CCTCTTCTACAGGGGATGGAGGG + Intergenic
953328928 3:42035710-42035732 GATTTTAAGCAGGGGAGTGATGG - Intronic
955844642 3:63149260-63149282 GCTTTTAAGCAGGAGAGTGACGG + Intergenic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
958929192 3:100190916-100190938 TCATTTATGAAGGGGAAGGATGG + Intronic
960707412 3:120494215-120494237 CCTTTGATGAAGTGGAGGTAGGG - Intergenic
961145071 3:124586515-124586537 GCTGTGATGCAGGGGAGGGCTGG + Intronic
961650787 3:128415795-128415817 CCTCTTATGGATGGGTGGGAAGG + Intergenic
961930394 3:130527096-130527118 TCTTTTATTGTGGGGAGGGAAGG + Intergenic
962875101 3:139529858-139529880 CCTTTTTAGAAAGGGAGGGATGG + Intronic
963176063 3:142299009-142299031 TCATTTATCCAGAGGAGGGATGG - Intergenic
963768266 3:149361488-149361510 CCTTTTATGCATGGGAGTAGAGG - Intergenic
964889479 3:161518816-161518838 CCTAATATGCAGGGAGGGGAAGG - Intergenic
966051231 3:175619488-175619510 ACTTAAATGCAGAGGAGGGAAGG + Intronic
966355262 3:179072352-179072374 ACTTTCGTGTAGGGGAGGGAAGG - Intergenic
967197202 3:187038795-187038817 ACTATTATCCATGGGAGGGAAGG - Exonic
968133110 3:196203668-196203690 CATTCTGGGCAGGGGAGGGAGGG + Intronic
968136417 3:196223003-196223025 CCATTTATGAAGGTGAGGGTGGG - Intronic
970732355 4:19121028-19121050 CCACATATTCAGGGGAGGGATGG + Intergenic
971860647 4:32100221-32100243 AGTTTTATAGAGGGGAGGGAGGG - Intergenic
971867539 4:32191391-32191413 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
973958036 4:56082502-56082524 CCTTTTATGAGGGGGATGGTAGG + Intergenic
974097181 4:57376136-57376158 CCTCTTACTCAGGGGAGGGGAGG - Intergenic
977354248 4:95925575-95925597 TTTTTTTTGCAGGGGAGGGCGGG + Intergenic
977562299 4:98544892-98544914 TCTTATGTTCAGGGGAGGGATGG + Intronic
978336920 4:107679082-107679104 GCTGTTATGCAGGGAGGGGAAGG + Intronic
979946174 4:126833986-126834008 CCTTTTCTTCATGGCAGGGAGGG - Intergenic
980279898 4:130706116-130706138 CCTTCTATATAGGGGAAGGAAGG - Intergenic
980585258 4:134805534-134805556 AATTTTATGGCGGGGAGGGAAGG + Intergenic
989637566 5:43553063-43553085 GTTTTTTTGCAGGGGAGGAAGGG + Intronic
990254083 5:53946857-53946879 CTTTTTATGCCTGGGAGGAAAGG + Intronic
990731272 5:58811792-58811814 CCTGTGGTGCAGTGGAGGGAGGG - Intronic
991234018 5:64373098-64373120 CCTTATATAGAGGGGAAGGAGGG + Intergenic
995411118 5:111858284-111858306 ACCTTACTGCAGGGGAGGGAGGG - Intronic
996062849 5:119051070-119051092 CCTTTTCTTCAGGTGATGGAAGG + Intronic
996818005 5:127595040-127595062 CCTCTTAGCCTGGGGAGGGATGG - Intergenic
997684514 5:135779315-135779337 CCTAATATGCAGGGAGGGGAAGG + Intergenic
998295500 5:140966232-140966254 CCCGTTAAGCAGGGGAGAGACGG + Exonic
998463348 5:142325044-142325066 TTTTTTATGAATGGGAGGGAAGG + Intronic
1000254131 5:159521563-159521585 TCCTTTATGCTGGGGAGAGATGG + Intergenic
1000769987 5:165340888-165340910 TGTTTTATTCAGGGAAGGGAAGG + Intergenic
1000952192 5:167498091-167498113 ACTCTTCTGCAGGGCAGGGAGGG + Intronic
1001024673 5:168214076-168214098 GCTTTTTTGCAGGGGCTGGAGGG - Intronic
1001566485 5:172702759-172702781 ACTTTTATGCAGGTCAGGCAAGG - Intergenic
1002879601 6:1239000-1239022 CCAGGTATTCAGGGGAGGGAGGG - Intergenic
1004840336 6:19576746-19576768 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
1004942899 6:20579892-20579914 TGTTTTTTGTAGGGGAGGGAAGG + Intronic
1009227369 6:61031661-61031683 CCTAATATGCAGGGGAGGAGAGG - Intergenic
1009330010 6:62406855-62406877 CCTTATGCCCAGGGGAGGGAGGG + Intergenic
1009853732 6:69232639-69232661 CCTGGTATCCAGGGGAGGGGTGG - Intronic
1012202213 6:96420613-96420635 CATTTTATGCATGTGTGGGAAGG - Intergenic
1012576485 6:100807296-100807318 CTTTTTTTTGAGGGGAGGGAGGG - Intronic
1012807917 6:103918329-103918351 TTTTGTATGCTGGGGAGGGATGG + Intergenic
1013594413 6:111647893-111647915 GCTTTTAAGAAGAGGAGGGAGGG + Intergenic
1015404124 6:132818264-132818286 CCTTTTGTGCAGGAGCGAGAGGG + Intergenic
1015498218 6:133902901-133902923 CCTTTTTTGGGGGGGGGGGACGG + Intergenic
1016750725 6:147628690-147628712 CCTTTTTTGGAGGGGAGGATGGG - Intronic
1018162127 6:161055186-161055208 ACTTTTAAGCAGGGTTGGGAAGG - Intronic
1019830081 7:3319262-3319284 CCTTTTCCACAGGAGAGGGATGG + Intronic
1020763048 7:12291073-12291095 CCTTAAATGCAGGGGAGGGAAGG - Intergenic
1022114220 7:27248470-27248492 CCACTTAAGCAGGGGAGAGATGG + Intergenic
1022401935 7:30046840-30046862 CCTTTTTTTCTGGGGTGGGATGG + Intronic
1023763950 7:43493417-43493439 CCATTGATGTAGGGGGGGGAAGG + Intronic
1024053429 7:45644586-45644608 CCTTTCAAGCCTGGGAGGGAGGG + Intronic
1024609220 7:51049335-51049357 TCTTTTATGAAGGAGAAGGAGGG + Intronic
1026050276 7:66940750-66940772 GCTTTTAAGCAGGGCTGGGATGG + Intronic
1026762071 7:73134364-73134386 CCTGTTGTGCGGTGGAGGGAGGG + Intergenic
1028295516 7:89124990-89125012 CCTTTTCTTCAGGAGAGTGACGG - Intronic
1031071431 7:117166558-117166580 CCTTTTAAGCAGGAGTGTGATGG + Intronic
1031404204 7:121363987-121364009 GATTTTTTGCAGGGCAGGGATGG + Intronic
1033429380 7:141274949-141274971 GTTTTTAGGCAGCGGAGGGAAGG - Intronic
1037978951 8:23236818-23236840 GCTTTTATTCATGGGGGGGAAGG + Intergenic
1038790256 8:30662215-30662237 CCTCTTATTCACGGGAGGGTCGG + Intergenic
1039247818 8:35629003-35629025 TCTTTGATGCAGAGGAGGGGAGG + Intronic
1040876323 8:52156071-52156093 CCTTTCATCCAGGGCAGGCATGG - Intronic
1043635364 8:82376851-82376873 CGTAATATTCAGGGGAGGGAAGG + Intergenic
1044668341 8:94653731-94653753 CCTTTACAGCAGGGCAGGGAAGG - Intronic
1045366105 8:101477624-101477646 CACCTTATGCAGGGGAGGGAGGG + Intergenic
1045924776 8:107571223-107571245 CCTAATATCCAGGGGAGGGGAGG + Intergenic
1049456645 8:142695237-142695259 TCTTTTTTGATGGGGAGGGATGG - Intergenic
1051063585 9:13074379-13074401 TTTTTTTTGGAGGGGAGGGAAGG - Intergenic
1051712277 9:19944103-19944125 ACTACTAGGCAGGGGAGGGAGGG + Intergenic
1054810563 9:69430704-69430726 CCTTTTATCCTGGGGTGAGAAGG + Exonic
1055693183 9:78856230-78856252 CTGTTTATGCTGGGGTGGGAGGG - Intergenic
1055984042 9:82037392-82037414 CCATTTATGCAGAAGTGGGAAGG - Intergenic
1056243165 9:84669218-84669240 CCTTTTAGGCAGGGTGGGAAAGG + Intronic
1056773406 9:89495803-89495825 CCATTTCTGTTGGGGAGGGAGGG - Intronic
1058259453 9:102811175-102811197 CCTTGAATGCAGGGGAGGCCAGG - Intergenic
1058881036 9:109286127-109286149 TATTATATGCAGGGGAGGGTAGG + Intronic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1059689642 9:116672669-116672691 CCCATTTTGCAGAGGAGGGAAGG + Intronic
1060156318 9:121322259-121322281 CCTTTTGTGTAAGGAAGGGAGGG - Intronic
1061048887 9:128182562-128182584 CCGTTTGTGCAGGGAAGGGGTGG - Intronic
1061499021 9:130991707-130991729 GCTTTTAAGCGGGGGAGTGAAGG - Intergenic
1186067231 X:5778964-5778986 CCTTTTAAGAAGGGGAGAGTTGG + Intergenic
1188403254 X:29774145-29774167 CTTTTTATGCGGGGGTGGGGAGG - Intronic
1189490901 X:41471113-41471135 CTTTTTTTGGAGGGGGGGGATGG + Intronic
1193452593 X:81688992-81689014 ACTGTTGTGCAGTGGAGGGAGGG - Intergenic
1194108788 X:89804631-89804653 CCATTCATGCAGGGGTGGAAAGG + Intergenic
1195065953 X:101238476-101238498 CCTTTGTGGGAGGGGAGGGAGGG + Intronic
1195706671 X:107742630-107742652 CCTTTTATGAAGGAGGGTGAAGG - Intronic
1197805400 X:130393915-130393937 TCTATTCTGCAGGGGACGGAAGG - Intergenic
1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG + Intergenic
1199674737 X:150178467-150178489 CCTTTTAGAGAGGGGAGGGTGGG + Intergenic
1199952711 X:152718005-152718027 CCGTTCATGCAGGGGTGGGTAGG - Exonic
1199955310 X:152737060-152737082 CCATTCATGCAGGGGTGGGTAGG - Exonic
1199956972 X:152750443-152750465 CCGTTCATGCAGGGGTGGGTAGG + Intronic
1200252582 X:154561583-154561605 CCTGTGATGCGAGGGAGGGAAGG + Intronic
1200265185 X:154642833-154642855 CCTGTGATGCGAGGGAGGGAAGG - Intergenic
1201916313 Y:19185276-19185298 CCTGTTGTGCAGTGGGGGGAAGG - Intergenic