ID: 1130139932

View in Genome Browser
Species Human (GRCh38)
Location 15:81216453-81216475
Sequence GCATCACTTCTACCCACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130139927_1130139932 9 Left 1130139927 15:81216421-81216443 CCCAGCTTCTTCCCTCTTCAGCC 0: 3
1: 31
2: 92
3: 218
4: 702
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139924_1130139932 22 Left 1130139924 15:81216408-81216430 CCCCTGCAGGGTTCCCAGCTTCT 0: 2
1: 10
2: 74
3: 191
4: 512
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139926_1130139932 20 Left 1130139926 15:81216410-81216432 CCTGCAGGGTTCCCAGCTTCTTC 0: 1
1: 1
2: 6
3: 24
4: 273
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139928_1130139932 8 Left 1130139928 15:81216422-81216444 CCAGCTTCTTCCCTCTTCAGCCT 0: 2
1: 26
2: 53
3: 218
4: 986
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139930_1130139932 -3 Left 1130139930 15:81216433-81216455 CCTCTTCAGCCTCAGCTTCAGCA 0: 1
1: 0
2: 9
3: 97
4: 677
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139929_1130139932 -2 Left 1130139929 15:81216432-81216454 CCCTCTTCAGCCTCAGCTTCAGC 0: 1
1: 2
2: 14
3: 126
4: 703
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139925_1130139932 21 Left 1130139925 15:81216409-81216431 CCCTGCAGGGTTCCCAGCTTCTT 0: 2
1: 35
2: 99
3: 152
4: 373
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130139932 Original CRISPR GCATCACTTCTACCCACCCC TGG Intronic