ID: 1130139932

View in Genome Browser
Species Human (GRCh38)
Location 15:81216453-81216475
Sequence GCATCACTTCTACCCACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130139928_1130139932 8 Left 1130139928 15:81216422-81216444 CCAGCTTCTTCCCTCTTCAGCCT 0: 2
1: 26
2: 53
3: 218
4: 986
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139925_1130139932 21 Left 1130139925 15:81216409-81216431 CCCTGCAGGGTTCCCAGCTTCTT 0: 2
1: 35
2: 99
3: 152
4: 373
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139929_1130139932 -2 Left 1130139929 15:81216432-81216454 CCCTCTTCAGCCTCAGCTTCAGC 0: 1
1: 2
2: 14
3: 126
4: 703
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139927_1130139932 9 Left 1130139927 15:81216421-81216443 CCCAGCTTCTTCCCTCTTCAGCC 0: 3
1: 31
2: 92
3: 218
4: 702
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139926_1130139932 20 Left 1130139926 15:81216410-81216432 CCTGCAGGGTTCCCAGCTTCTTC 0: 1
1: 1
2: 6
3: 24
4: 273
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139924_1130139932 22 Left 1130139924 15:81216408-81216430 CCCCTGCAGGGTTCCCAGCTTCT 0: 2
1: 10
2: 74
3: 191
4: 512
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1130139930_1130139932 -3 Left 1130139930 15:81216433-81216455 CCTCTTCAGCCTCAGCTTCAGCA 0: 1
1: 0
2: 9
3: 97
4: 677
Right 1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130139932 Original CRISPR GCATCACTTCTACCCACCCC TGG Intronic
900604063 1:3516068-3516090 GCACAGCTCCTACCCACCCCAGG + Intronic
903126976 1:21254944-21254966 CCCTGACTTCTCCCCACCCCTGG + Intronic
903132512 1:21289436-21289458 GCATCCCATCTGCCCACTCCTGG - Intronic
903296229 1:22344910-22344932 GCATCAGCTCCATCCACCCCTGG + Intergenic
903296241 1:22344958-22344980 GCATCAGCTCCATCCACCCCAGG + Intergenic
903296293 1:22345223-22345245 GCATCAGCTCCATCCACCCCTGG + Intergenic
903296301 1:22345271-22345293 GCATCAGCTCCATCCACCCCCGG + Intergenic
903851416 1:26308817-26308839 CCATCCCTTCTTCCCACCCAGGG + Intronic
903930026 1:26856742-26856764 GCAGCACCTCTCCCCACCACCGG + Exonic
904498713 1:30902101-30902123 GCCTGCCTTCTCCCCACCCCTGG - Intronic
905912192 1:41662523-41662545 GCCTCACTGCTGGCCACCCCGGG + Intronic
912881175 1:113416593-113416615 GCATCAGTTCTACCTATCCTGGG - Intronic
916685841 1:167145042-167145064 TCATCACCACTACCCATCCCTGG + Intergenic
920815241 1:209325163-209325185 GCAACACTTCAACCCAGGCCCGG + Intergenic
923640170 1:235749473-235749495 GCACCACATCTACTCATCCCAGG - Intronic
923790720 1:237108718-237108740 GCATCTCTTTTACACACCCCAGG + Intronic
1063298105 10:4826440-4826462 GCCGCACTTCTCCCCAGCCCCGG - Intronic
1064033637 10:11898863-11898885 ACATCACCTCTGCCCGCCCCTGG + Intergenic
1066372499 10:34829359-34829381 CCATCACTGCTGCCCAGCCCAGG - Intergenic
1068661978 10:59632097-59632119 TCATCACTTCAGCCTACCCCTGG + Intergenic
1068739925 10:60457230-60457252 CCATCATTTCTACCCATTCCTGG - Intronic
1069943989 10:71973507-71973529 AGAACAGTTCTACCCACCCCTGG - Intronic
1070616814 10:77975731-77975753 GATTCAATTCTACCCTCCCCTGG + Exonic
1070658205 10:78285716-78285738 GCTTCACCTCTCCCCACCCCTGG - Intergenic
1070681865 10:78454339-78454361 GCAGCACATCCACCCTCCCCTGG - Intergenic
1074069860 10:110056137-110056159 GCATCACTGCTACCCTTCCTTGG + Intronic
1075682297 10:124341551-124341573 GCATTACTTCCACCAACGCCCGG - Intergenic
1078194162 11:9121119-9121141 GCCTCACTTCTGCCCCCTCCAGG + Intronic
1078462117 11:11522076-11522098 GGATGACTTCTACCCACCCTAGG + Intronic
1082000522 11:47391563-47391585 GTAACACCTCTCCCCACCCCAGG + Intergenic
1084549915 11:69835073-69835095 GCATCACAGCCACCCACCCTGGG + Intergenic
1086975766 11:93131019-93131041 ACATCACTTCTACCCACTTCCGG - Intergenic
1087507064 11:99037621-99037643 GCATCACTGCAATCCACCCTGGG - Intronic
1088598020 11:111454375-111454397 GCAACACTTCTACCCAAGACTGG + Intronic
1089989741 11:122848087-122848109 GCATCAGTTCTTCTGACCCCAGG - Intronic
1093159039 12:15723099-15723121 GCATCACTTGAACCCAGCCTGGG + Intronic
1096241201 12:49961362-49961384 GCATCACTCCGACCCAGCCGGGG + Intergenic
1103720149 12:122969525-122969547 GGATCACTTGAACCCAGCCCGGG + Intronic
1104809297 12:131610900-131610922 CCCTCACTTTTACCCTCCCCTGG - Intergenic
1105830251 13:24157764-24157786 GCATTGCTTCTCCCCAACCCTGG + Intronic
1112090936 13:96083398-96083420 CCATCACTTCTTTCCACCTCTGG + Intergenic
1113481913 13:110627506-110627528 GCATCATCTCTACCCAAGCCAGG - Exonic
1114551173 14:23533650-23533672 GCATCACTCCCACCCTCCGCGGG - Exonic
1115013844 14:28585859-28585881 GCTTCACTTCTAACCACCTCTGG + Intergenic
1119771404 14:77222353-77222375 CCATCACTCCTACCATCCCCTGG + Intronic
1125238190 15:37540644-37540666 TTATCACTTCCCCCCACCCCAGG - Intergenic
1125864722 15:43034807-43034829 CCATAACCTCTGCCCACCCCGGG - Intronic
1126250907 15:46566516-46566538 CCCTCACTCATACCCACCCCTGG - Intergenic
1128641451 15:69341168-69341190 CCATCCCCTCTACCCGCCCCCGG + Intronic
1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG + Intronic
1131210131 15:90487863-90487885 GCACCCATTCTCCCCACCCCCGG + Intronic
1131294715 15:91136811-91136833 TCATCACTGCCACCCACCTCTGG - Intronic
1132529158 16:436395-436417 GAATCCCTTGAACCCACCCCAGG - Intronic
1132663300 16:1070996-1071018 GCCTCAGTCCCACCCACCCCAGG - Intergenic
1134299651 16:12978278-12978300 GCATGACTTCTAGTCTCCCCTGG + Intronic
1134479499 16:14605932-14605954 GCATCACTTCCACTTACCCACGG + Intronic
1135138564 16:19902834-19902856 GCAATACTCCTTCCCACCCCAGG - Intergenic
1135779301 16:25285695-25285717 CCAGCAATTGTACCCACCCCTGG - Intergenic
1138853656 16:60660666-60660688 GCATCAATTCTACTCACTACAGG + Intergenic
1141763232 16:86042897-86042919 GCCTCACTGCCCCCCACCCCAGG + Intergenic
1141773664 16:86107238-86107260 GCATCGATTCTACCCTCCCAGGG + Intergenic
1203118261 16_KI270728v1_random:1513340-1513362 GCATCACTCCTCCCTAGCCCTGG + Intergenic
1147449897 17:40497714-40497736 CCATCTCCTCCACCCACCCCAGG - Intronic
1148605638 17:48927178-48927200 GAATCCCTTCCCCCCACCCCAGG + Exonic
1149638324 17:58187225-58187247 GCATACCTTGTACCCACCACAGG - Intergenic
1151046931 17:70931455-70931477 GCATCACTTCTACCAATCCTAGG - Intergenic
1151280667 17:73071896-73071918 CCATCACTTCTTCAAACCCCTGG + Intronic
1151477544 17:74352538-74352560 GCATCACTTGCTCCCACCCAGGG + Intronic
1152308231 17:79533565-79533587 GCATCAGTTCTGCCCAGCCCAGG + Intergenic
1161791767 19:6364359-6364381 GCATCTGTTCCACCCTCCCCAGG + Intronic
1161894331 19:7069270-7069292 CCAGAACTTCTCCCCACCCCCGG + Intergenic
1162954825 19:14091836-14091858 TCATAACTTCTCCCCATCCCAGG - Exonic
1165453364 19:35897689-35897711 TCCTGACTTCTACCCACCCTCGG - Exonic
1165901090 19:39169726-39169748 GCATCACCTCCATCCAGCCCGGG + Exonic
925082851 2:1083448-1083470 GCGTCACCTATCCCCACCCCTGG + Intronic
925856803 2:8136887-8136909 CCATGAATTCTACCCACCCTAGG - Intergenic
926676733 2:15630545-15630567 CCAACACCTCTACCCACCCTTGG - Intronic
928240131 2:29578864-29578886 CCAGCTCTTCTCCCCACCCCTGG + Intronic
929135024 2:38615593-38615615 CCATCACTGCTACCCAACACTGG + Intergenic
929938722 2:46314421-46314443 GCCCCATTTCTACCCAGCCCTGG + Intronic
932528739 2:72502503-72502525 GCACCACTGCACCCCACCCCGGG + Intronic
932583762 2:73009366-73009388 TCACCACTCCTCCCCACCCCTGG - Intronic
932615759 2:73230381-73230403 GCATCAACTCTATCCTCCCCAGG - Intronic
932644646 2:73488067-73488089 GCAGCCCTTCAACCCATCCCTGG + Intronic
937082682 2:119151630-119151652 GCTTCTCTTCTCCCCACCCTGGG - Intergenic
938210258 2:129460908-129460930 ACATCACATCTGCCCACCCAGGG + Intergenic
939024419 2:136995132-136995154 GGATCAATCCTACCCAACCCAGG + Intronic
940009913 2:149041644-149041666 GCATCACCTGTCCCCACCTCTGG - Intronic
943032607 2:182703482-182703504 GCATAAATTTTACCCAACCCGGG - Intergenic
943178775 2:184514410-184514432 GCCTCACTTCTCCCCACAGCAGG - Intergenic
943741104 2:191410197-191410219 GCACCACCTCTGCCCTCCCCTGG + Intronic
944847954 2:203687711-203687733 GCATCTCATCTACCCACACATGG - Intergenic
945181473 2:207096231-207096253 GAATCTCTCCTCCCCACCCCTGG + Intronic
946020726 2:216638143-216638165 GCATCACTGCTCTCCAGCCCGGG + Intronic
946545534 2:220738148-220738170 GCATCCCTCCTTCCCTCCCCTGG + Intergenic
1172485117 20:35293178-35293200 TCATCACCTCTCACCACCCCTGG - Intergenic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1172895774 20:38299056-38299078 CCCTCCCTTCCACCCACCCCTGG + Intronic
1175651413 20:60727779-60727801 GCATAACTGCTCCCCACCCCTGG - Intergenic
1176087731 20:63305660-63305682 GCTTCACACATACCCACCCCTGG - Intronic
1179126887 21:38598927-38598949 GCAGCACCTCTCTCCACCCCAGG + Intronic
1180016660 21:45090700-45090722 TCAGCACTCCTACCCTCCCCAGG + Intronic
1180178192 21:46100557-46100579 GCATCACCCCTTCCCTCCCCTGG + Intronic
1181424855 22:22828169-22828191 GCATCACTGCACCCCAGCCCAGG + Intronic
1181619831 22:24083206-24083228 CCATCTCTTCTGCCCACCACAGG + Exonic
1184198786 22:42950837-42950859 TTGTCACTTCTACCCATCCCGGG - Intronic
1184277463 22:43418287-43418309 GCATCACTTCCAGCCAACACAGG - Intronic
949503718 3:4706358-4706380 GCATCACTTCTCTCAACACCAGG - Intronic
950453119 3:13076622-13076644 GGTTCACTTCTGCCCAGCCCTGG - Intergenic
950865047 3:16182102-16182124 ACATCAATTCCTCCCACCCCAGG - Intronic
953128350 3:40113049-40113071 GCATTGCTTCTATGCACCCCTGG - Intronic
953930399 3:47003032-47003054 CCATCACTTCGACCCTCACCTGG + Exonic
954593666 3:51805703-51805725 TCATCACTTTTACCCATGCCTGG + Intergenic
954964261 3:54596634-54596656 GTATGACCTCTTCCCACCCCTGG + Intronic
955496914 3:59542965-59542987 GCAACACTTCTTCCCATTCCAGG + Intergenic
957305786 3:78456909-78456931 GCCTCTCTTTTCCCCACCCCTGG - Intergenic
960259526 3:115550551-115550573 GCTAAACTGCTACCCACCCCTGG + Intergenic
960964370 3:123094647-123094669 GCACCACTTCTGCCCATCCCTGG - Intronic
964199100 3:154098066-154098088 TAAACACTACTACCCACCCCAGG + Intergenic
969406740 4:6998315-6998337 GCATCACTGCACCCCACCCTGGG + Intronic
969487546 4:7480744-7480766 GCATCCCCTCCACCCGCCCCAGG + Intronic
973548849 4:52011032-52011054 CCATCCCTTCTCCCCAACCCAGG - Intronic
978863902 4:113484203-113484225 TCATCCCTTCTACCCAGCCATGG + Intronic
983565281 4:169144107-169144129 ACATCAATTTTACACACCCCAGG + Intronic
984781513 4:183530450-183530472 GCATCTCTTCTGCCCACTCAGGG + Intergenic
985998823 5:3613962-3613984 GCATCCCATTTACCCACCCATGG - Intergenic
990371101 5:55119198-55119220 GTATCTCCTCTACCCAGCCCAGG - Intronic
992748949 5:79844388-79844410 TCATCACTTCTAGTTACCCCCGG - Intergenic
993409541 5:87556290-87556312 GCATCACTTCAACCCCACCCAGG - Intergenic
995246761 5:109944150-109944172 GCAAGACTTCCTCCCACCCCAGG - Intergenic
997374081 5:133384512-133384534 CCATCACACCTGCCCACCCCAGG - Intronic
998371283 5:141663338-141663360 GCACCACTTCACTCCACCCCGGG - Intronic
1004209223 6:13621070-13621092 GCACCTCTTCTACTCTCCCCGGG + Exonic
1004234485 6:13861790-13861812 GCATCACTGCAGCCCACCCCGGG + Intergenic
1006773947 6:36577487-36577509 GCTTATCTTCCACCCACCCCCGG + Intergenic
1007752450 6:44078627-44078649 ACCTTACTTCTACCCACCCCAGG + Intergenic
1013332818 6:109122712-109122734 GAATCACTTGAACCCAACCCGGG + Intronic
1014095203 6:117452611-117452633 GCATCACTTCTCTCCAGCCTGGG - Intronic
1017076433 6:150623127-150623149 GTTTCACTTCTCCCTACCCCAGG + Intronic
1017860186 6:158389966-158389988 GAATCACTTGAACCCACACCCGG - Intronic
1018935083 6:168269060-168269082 GCATCAGCTCTACCTCCCCCTGG - Intergenic
1018989449 6:168662469-168662491 GCCCGACTTCTCCCCACCCCTGG - Intronic
1019573961 7:1727280-1727302 TCATCATTTCTAGCTACCCCAGG - Intronic
1021842404 7:24731566-24731588 GCATCACACCTTCCCTCCCCGGG + Intronic
1026427541 7:70311597-70311619 GCATCACTGCACTCCACCCCGGG - Intronic
1032676594 7:134135311-134135333 GAATGACTTTTACCCACCCAGGG - Intronic
1034263063 7:149769057-149769079 CCATCACTTCATCCCACCACGGG - Intronic
1034276681 7:149826835-149826857 TCATCCCTGCTCCCCACCCCAGG - Intergenic
1034639288 7:152589813-152589835 GCATCATTGCTTTCCACCCCGGG - Intergenic
1034860168 7:154588010-154588032 GCATCGCATCTGCTCACCCCGGG + Intronic
1037313107 8:17577010-17577032 GCAGCACTTCTTCCCAGCGCGGG - Intronic
1043753510 8:83970925-83970947 TCATAACTTCTCCCCATCCCAGG + Intergenic
1048872402 8:138810453-138810475 GCAGCTCCTCCACCCACCCCCGG - Intronic
1051391744 9:16572643-16572665 GCACCACCACTCCCCACCCCCGG - Intronic
1052367415 9:27628475-27628497 TCACCACTTCCACCCACTCCTGG + Intergenic
1053126595 9:35585874-35585896 GCATGACTTCTTCCCACTCATGG - Intergenic
1054761802 9:69011478-69011500 TCATCACTTCTCCCCATCCCAGG - Intergenic
1055422477 9:76159084-76159106 GCATCACCATCACCCACCCCAGG + Exonic
1059418516 9:114176663-114176685 ACAACCCCTCTACCCACCCCTGG + Intronic
1061789650 9:133052307-133052329 CCATCCTTCCTACCCACCCCTGG + Intronic
1061851602 9:133419138-133419160 ACATCAAATCTACCCACTCCCGG - Intronic
1062140044 9:134951034-134951056 GCATCACCTCCACCCATCCGTGG + Intergenic
1186515408 X:10163224-10163246 GCATCTCTTCTACCAACCTGGGG + Intronic
1187017563 X:15345272-15345294 GCATTTCTTCTAGCCACCTCTGG - Intergenic
1190558450 X:51662573-51662595 TCATCCCTTCTTCCCACCCTGGG - Intergenic
1196921986 X:120594340-120594362 ACACCACCTCTCCCCACCCCCGG + Intronic
1201984930 Y:19955535-19955557 TCATAACCTCTACCCACACCTGG + Intergenic