ID: 1130141969

View in Genome Browser
Species Human (GRCh38)
Location 15:81235166-81235188
Sequence CAGAGAAAAGATAAGGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 447}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130141959_1130141969 27 Left 1130141959 15:81235116-81235138 CCTTGAACTGTGCATACCAGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
Right 1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG 0: 1
1: 0
2: 1
3: 37
4: 447
1130141962_1130141969 -5 Left 1130141962 15:81235148-81235170 CCATTGATAGCACAGACCCAGAG 0: 1
1: 0
2: 4
3: 10
4: 227
Right 1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG 0: 1
1: 0
2: 1
3: 37
4: 447
1130141961_1130141969 11 Left 1130141961 15:81235132-81235154 CCAGTGGTGTGATTCTCCATTGA 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG 0: 1
1: 0
2: 1
3: 37
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130141969 Original CRISPR CAGAGAAAAGATAAGGTTGG GGG Intronic
901905945 1:12411313-12411335 CAGAGAAAAGAAAAATTTGGAGG + Intronic
903893180 1:26583830-26583852 CTGAGAAAAGCTGAGGTGGGAGG + Intergenic
904991077 1:34593244-34593266 CAGAGAAAAGAAGGGCTTGGTGG - Intergenic
905323938 1:37137192-37137214 AAGAGAAAAGCTAAGGCAGGTGG + Intergenic
905504348 1:38465375-38465397 TAGAGAAAAGATGAGTTAGGAGG + Intergenic
905893758 1:41532406-41532428 CAGAGAGGAGATGAGGCTGGAGG + Intronic
907093692 1:51754112-51754134 CAGAGTGAAGATAAGCTAGGAGG + Intronic
907583726 1:55595532-55595554 CAAAGAAAAGAAAATGTTTGAGG - Intergenic
907912260 1:58836897-58836919 CAGTCCAAAGAGAAGGTTGGTGG - Intergenic
908071085 1:60460938-60460960 CAGAGAAAAGGTACTGTTGGTGG + Intergenic
908671708 1:66555352-66555374 CAGATATAAGATAAAGATGGTGG - Intronic
909564504 1:77039569-77039591 CAGAGGATAGATAAGGCAGGGGG + Intronic
910163335 1:84297911-84297933 CAGAGAAAAGCTAAAGATGCAGG - Intergenic
911062075 1:93757333-93757355 CAGAGAAAAGAGAAAATGGGGGG - Intronic
911251551 1:95582101-95582123 TAGAAAAAGGAAAAGGTTGGGGG + Intergenic
911418847 1:97613244-97613266 CAGTCAAAAGATAATTTTGGTGG + Intronic
911559915 1:99392298-99392320 CAGAGAAAAGATAAAATTACAGG + Intergenic
911895106 1:103423435-103423457 CAGAGAAAAGTGCAGTTTGGAGG + Intergenic
912245332 1:107956185-107956207 GAGAGAAAAGACAAAATTGGAGG - Intronic
912603907 1:110967944-110967966 GAGAGTAAAGAAAATGTTGGAGG + Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913275788 1:117136690-117136712 CAAAGAAAAAAAAAGGGTGGGGG + Intergenic
913582992 1:120245781-120245803 CAGAGAAATGAAAAGTCTGGAGG - Intergenic
913625180 1:120652579-120652601 CAGAGAAATGAAAAGTCTGGAGG + Intergenic
914745333 1:150497286-150497308 AAGAGAAAAAAAAAGGTGGGGGG + Intronic
915819046 1:159002016-159002038 CAAAGAAAAGAAAATGTTGAGGG + Intronic
915933705 1:160077494-160077516 CAGAGGAAAGATATGGTTGAAGG - Intergenic
916068732 1:161157426-161157448 GAGAGAAAAGCTGAGGTTTGAGG + Intronic
916101738 1:161399036-161399058 CACAGTAAAGACAAGTTTGGGGG + Intergenic
916277425 1:163009794-163009816 CAGTGAAAAGATCAGGTGTGAGG + Intergenic
916386598 1:164279950-164279972 CAGAGAAAAGGCAATGTTGGTGG + Intergenic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
917454481 1:175174289-175174311 CAGACAAATGATAAGGATGAGGG + Intronic
917683783 1:177395162-177395184 AACAGAGAAGAGAAGGTTGGGGG + Intergenic
917916289 1:179705659-179705681 AAGAACAAAGAGAAGGTTGGGGG - Intergenic
918440666 1:184563787-184563809 GAAAGAAAATACAAGGTTGGGGG + Intronic
918666863 1:187162217-187162239 CAAAGCAGAGATAAGCTTGGAGG - Intergenic
919557082 1:199071329-199071351 CAGAGCACAGACAAGGTTAGAGG - Intergenic
919750827 1:201037057-201037079 AAGAGAAAAGAGGAGATTGGAGG + Intergenic
919847711 1:201651944-201651966 CAGGGAAAAGCTTAGTTTGGAGG - Intronic
920076748 1:203342715-203342737 CAGAGTAAAGTTCAGGTTGGTGG - Intronic
920828024 1:209440249-209440271 CAGAGAAAAGAAAAGACAGGAGG + Intergenic
920895548 1:210045565-210045587 CAGAGATAAGAAATGGCTGGAGG - Intronic
922176093 1:223199098-223199120 AAGAACAAAGAGAAGGTTGGGGG + Intergenic
923693180 1:236217417-236217439 CAGTGAAAAGAAAAGGTGAGGGG + Exonic
923857060 1:237856590-237856612 AAGAACAAAGAGAAGGTTGGGGG + Intergenic
923943784 1:238859695-238859717 AAAAGAAAAGAGAAGGCTGGAGG + Intergenic
924040272 1:239977870-239977892 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
924453596 1:244200283-244200305 CCTAGAAAAGAATAGGTTGGGGG - Intergenic
1063036220 10:2289154-2289176 AGGAGAGAAGATCAGGTTGGGGG - Intergenic
1064246498 10:13671766-13671788 CAGAGACCAGAAAAGGCTGGGGG + Intronic
1064915887 10:20457896-20457918 GAAACAAAAGATGAGGTTGGAGG + Intergenic
1066546652 10:36507463-36507485 CAGAGGAAGAATGAGGTTGGGGG - Intergenic
1068140814 10:53004795-53004817 AAGAGCAAAGAGAAAGTTGGGGG + Intergenic
1068335022 10:55623695-55623717 AAGAGAAAAGATAGGAGTGGTGG + Intronic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1070393664 10:75992879-75992901 CAGACAAAGGATAAGCCTGGTGG - Intronic
1070676158 10:78412918-78412940 CAGAGAAAATAAAAGCTTAGAGG + Intergenic
1070727014 10:78799345-78799367 CAGAGGAAAGAAAAGGTAGAAGG - Intergenic
1070762119 10:79030351-79030373 CAAAGAGAAGAAAAGGATGGAGG - Intergenic
1071082771 10:81831990-81832012 GAGAGAAAAGATAAATTTGGAGG + Intergenic
1072314239 10:94186347-94186369 CAGAGAAATGATGAGCTTGATGG - Intronic
1072752308 10:97990591-97990613 CTGATAAAAGATTTGGTTGGAGG + Intronic
1073112684 10:101072018-101072040 CAGATAAAAGAGATGGATGGAGG - Intergenic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1074164579 10:110863853-110863875 CAGAGGAAAGGTAAGTCTGGTGG + Intergenic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076371096 10:129954414-129954436 CAGAGAAAAAAAAAGGGGGGGGG - Intronic
1076453257 10:130571608-130571630 AAGAACAAAGAGAAGGTTGGAGG - Intergenic
1077859883 11:6168412-6168434 CAGCGAAAAGACAAAGTAGGAGG - Intergenic
1078688111 11:13551532-13551554 TAGATAAAAGAGGAGGTTGGGGG + Intergenic
1080268834 11:30428938-30428960 TAGAGAAAAGGTAAACTTGGAGG - Intronic
1080497167 11:32831152-32831174 TTGAGAAAAGATTAGGTTTGGGG + Intronic
1080908355 11:36569525-36569547 GAAAGAAAAGCTAAGGGTGGTGG + Intronic
1083855909 11:65393013-65393035 GAGAGAGGAGATAAGGTGGGAGG + Intronic
1084463323 11:69308260-69308282 GAGAGGCAAGATGAGGTTGGAGG - Intronic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085146582 11:74204603-74204625 AAGAACAAAGAGAAGGTTGGAGG + Intronic
1085543386 11:77294232-77294254 CAGTGAAAGGATAATGCTGGGGG + Intronic
1085663795 11:78394523-78394545 AAAAGAAAAGAAAAGGTTTGGGG + Intronic
1086166373 11:83783819-83783841 CAGAGAAAGGATAAGCCTGAAGG - Intronic
1086227977 11:84535551-84535573 CAGAGAAAAAAAAAGGTTCAGGG + Intronic
1086949643 11:92878784-92878806 GAGAGAAAAAATAAAGTTAGAGG + Intronic
1087301332 11:96439685-96439707 GAGAGAAAGTATAGGGTTGGAGG - Intronic
1087610544 11:100429124-100429146 AAGAGAAAAAGTAAGTTTGGTGG - Intergenic
1088299776 11:108344701-108344723 CTGATTAAAAATAAGGTTGGGGG + Intronic
1088374238 11:109122504-109122526 CAAAGAAATGATAAAGTTTGAGG - Intergenic
1090303795 11:125672759-125672781 CAGATAAAGGCTAAGGTTGGAGG - Intronic
1090984037 11:131750128-131750150 GAGAGAAATGATAACGTTAGGGG - Intronic
1091037812 11:132249223-132249245 CAGAGACAGGATAAGGCTGAAGG + Intronic
1091560635 12:1610293-1610315 CACAGGCAAGAGAAGGTTGGAGG - Intronic
1091954319 12:4625741-4625763 GAGAGAGAAGAGAAGGTTGTAGG + Intronic
1092301942 12:7259554-7259576 CAGAGGGAAGAACAGGTTGGTGG + Intergenic
1092629343 12:10361671-10361693 AAGAGCAAAGAGAAGGTTAGAGG + Intergenic
1092650371 12:10628370-10628392 AAGAGAAGAGAGAAGTTTGGTGG + Intronic
1092768720 12:11877508-11877530 GAAAGAAAAGATAGGGTTGTGGG + Intronic
1095605313 12:44060486-44060508 CAGGAAACAGCTAAGGTTGGAGG + Intronic
1095720338 12:45393274-45393296 AAGAGAGAAGACAAGGTTAGAGG + Intronic
1095747907 12:45680428-45680450 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097347150 12:58506064-58506086 CAGAAAATAGATAAGATTTGGGG - Intergenic
1097716465 12:62971613-62971635 CTGAGAAATGAAAAGGTTGAGGG - Intergenic
1098524657 12:71472698-71472720 CTGAGAAAGGATAGGGCTGGGGG + Intronic
1099927129 12:89031993-89032015 CAGAGAAAAGTCAAGCCTGGTGG + Intergenic
1100673003 12:96836309-96836331 CAGGGAAAACATAAGGATTGAGG + Intronic
1100867293 12:98870471-98870493 CAAAGAAAAGAAAAGGGTGAGGG - Intronic
1101551372 12:105765409-105765431 CAGGGAAAAGTTCAGGTTGGTGG - Intergenic
1102465688 12:113129813-113129835 CTGGGAAAAGGTCAGGTTGGGGG - Intronic
1102577055 12:113862449-113862471 AAAAGAAAAAAAAAGGTTGGGGG + Intronic
1103675534 12:122652806-122652828 CTGAGAAAAGATAATGTAGCTGG - Intergenic
1103746790 12:123130392-123130414 CAAACAGAAGCTAAGGTTGGGGG + Intronic
1104588509 12:130066267-130066289 CAGGGACAGGATAAGGATGGGGG + Intergenic
1105459651 13:20571661-20571683 AAGAACAAAGAGAAGGTTGGAGG + Intronic
1105591927 13:21800216-21800238 CAGAGAGAAGCCAGGGTTGGGGG - Intergenic
1106769643 13:32949353-32949375 CAGAGAACAGAAAAGGGCGGGGG + Intergenic
1107423020 13:40267454-40267476 GAGAGAACAGATAATCTTGGAGG + Intergenic
1108207403 13:48104636-48104658 CAGAGTAAAGATGATGTTGCAGG + Intergenic
1108413958 13:50178662-50178684 CAAAGAAAAGATGAATTTGGTGG + Intronic
1108561147 13:51645523-51645545 GAGAGAAAAGGGAAGGCTGGGGG - Intronic
1109773520 13:67008596-67008618 CAGGGTAAAGATAATATTGGTGG - Intronic
1109968969 13:69739528-69739550 CAGACAAAATAAAAGGATGGAGG + Intronic
1109977643 13:69860370-69860392 CAGAAAAAAGAGAATGTTAGTGG + Intronic
1110287760 13:73769631-73769653 CAGAGAAGATCTAAGGCTGGAGG - Intronic
1111592831 13:90371774-90371796 CAGAGAAAACATCATTTTGGTGG - Intergenic
1111728862 13:92047106-92047128 CAGACAAAAGAAAAGGTAAGAGG - Intronic
1111734182 13:92116096-92116118 CAGAAAAAAAATAAGTGTGGTGG + Intronic
1113898873 13:113784750-113784772 GAGAGAAAAGACAAGGCAGGTGG + Intronic
1113904634 13:113813471-113813493 GAGAAAAAAGATAAGGTGGAGGG + Exonic
1114197157 14:20488756-20488778 CAGAGAGTAGTTAAGTTTGGTGG + Intergenic
1114708940 14:24757479-24757501 CAGAGAAAAGAAAGGGATAGAGG + Intergenic
1115772972 14:36685936-36685958 CAGGGAAAAGATAGGGTGGGGGG - Intronic
1115779563 14:36754395-36754417 GATAGAAAAAATAAGGTGGGTGG + Intronic
1115821366 14:37215597-37215619 CAGAGAACAAATAAAGTAGGTGG + Intronic
1117332824 14:54730452-54730474 CAAAGCAAAGATGTGGTTGGTGG - Intronic
1117340497 14:54787781-54787803 CTGAGGAAGGATAAGGCTGGTGG - Intronic
1117899523 14:60517334-60517356 CAGAGGAGAGAAAAGGTGGGAGG - Intergenic
1118130809 14:62961360-62961382 CAGACAAAAGAAACGGTTGGTGG - Intronic
1118225199 14:63892366-63892388 GAGGGAAAAAAAAAGGTTGGGGG - Intronic
1118961416 14:70537166-70537188 GAGAGACAAGATGAGGTAGGTGG - Intergenic
1119607322 14:76031839-76031861 CAGAGAAGAGAGAAGGTTAGAGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1119793091 14:77370948-77370970 CAGAAAAAAAAAAAGGTCGGGGG + Intronic
1119811551 14:77525012-77525034 CACAGAAATGATAATGTTTGCGG + Intronic
1120005054 14:79347120-79347142 CAGAATACAGATAAGGGTGGGGG - Intronic
1122213814 14:100190478-100190500 AAGAACAAAGAGAAGGTTGGAGG - Intergenic
1122230179 14:100303059-100303081 GAAAGAAAAGATAGGCTTGGTGG - Intronic
1125301788 15:38262520-38262542 CAGAAAGAAGAAAAAGTTGGAGG + Intronic
1127197967 15:56610569-56610591 AAGAGCAGAGAAAAGGTTGGGGG - Intergenic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1129330335 15:74823859-74823881 CAGAGAAAAGATGAGATGTGTGG - Intronic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1130303932 15:82700258-82700280 TAGAGATAAGAGAAGGTTGATGG - Intronic
1130374451 15:83315976-83315998 CAGAAAAAATATAAGGTAGCTGG - Intergenic
1132007280 15:98239757-98239779 CAGAGAACAGAGAATGTTGAGGG + Intergenic
1132158928 15:99518717-99518739 CATAGAAAAGGTAAAGTCGGAGG - Intergenic
1133344283 16:5059832-5059854 CAGAGATAGGATGGGGTTGGAGG + Intronic
1133942488 16:10321994-10322016 CAGAGAGAAGAGGACGTTGGAGG - Intergenic
1135166399 16:20142910-20142932 CAGAGCTAAGACAAGCTTGGAGG + Intergenic
1135229230 16:20690091-20690113 CAGAGAAAAGAAAAAGAAGGTGG + Intronic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1137380848 16:47998250-47998272 CAAAGAAAAAAAAAGTTTGGAGG + Intergenic
1137438760 16:48480944-48480966 CAGAACAAAGAAAAGGTTGGGGG - Intergenic
1138402477 16:56758070-56758092 CAGAAAAAAAAAAAAGTTGGGGG + Intronic
1138750724 16:59416997-59417019 CAGGGAAAAGACAAGTTAGGGGG - Intergenic
1138875617 16:60945192-60945214 CAGAGAATAAATAAGGTCAGTGG - Intergenic
1139122467 16:64037102-64037124 CATACAAAAGATTAGGGTGGGGG - Intergenic
1139295680 16:65898426-65898448 CACAGCAAAGATAAAGTTGGAGG + Intergenic
1139463924 16:67143786-67143808 GACAGAAAAGATAAGGTATGGGG + Intronic
1139752137 16:69115324-69115346 AAGAGAAAAGACAGGGTGGGAGG + Exonic
1140235908 16:73158449-73158471 AAGAGAAAAGAGAAGGGAGGGGG - Intergenic
1140358466 16:74325336-74325358 AGGAGAAAAGGTAAGGCTGGGGG + Intergenic
1140860456 16:79013371-79013393 CAGAGACAAGATAGGGATCGGGG - Intronic
1140974549 16:80046341-80046363 ACGTGAGAAGATAAGGTTGGTGG - Intergenic
1142019371 16:87771421-87771443 AAGAACAAAGAGAAGGTTGGGGG + Intergenic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1143142443 17:4748795-4748817 GAGAGAAAAGATGAGGAGGGAGG - Intergenic
1143191054 17:5040549-5040571 CAGGGAGAAGCTAAGGTTTGAGG - Intronic
1144479393 17:15616502-15616524 CTAAGAAAAGAGAAGGTTGTTGG + Intronic
1144918911 17:18747224-18747246 CTAAGAAAAGAGAAGGTTGTTGG - Intronic
1145191855 17:20848802-20848824 AAGAGAAAAGATAGGAGTGGTGG + Intronic
1146493867 17:33303204-33303226 AAGAGAAAAGACAAAGTGGGTGG + Intronic
1146519910 17:33518346-33518368 CTGAAAAAGGCTAAGGTTGGTGG + Intronic
1147742410 17:42676649-42676671 CAGGGGAAAGATGAGGTGGGAGG + Exonic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148087430 17:45002750-45002772 CAGTGAAAAGATGGTGTTGGTGG + Intergenic
1148489025 17:48011601-48011623 GAAAGAAAAGAAAAGGGTGGAGG + Intergenic
1148634853 17:49141015-49141037 CAGAAAAAAAAAAAGGTTAGAGG - Intronic
1149855126 17:60075855-60075877 AAAAGAAATTATAAGGTTGGGGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1151514849 17:74586664-74586686 CAGAGAACAGGTAACGTTAGTGG + Intronic
1153371360 18:4319992-4320014 AATAGCAAAGACAAGGTTGGAGG - Intronic
1153421138 18:4906661-4906683 AAGAACAAAGAGAAGGTTGGGGG - Intergenic
1153554115 18:6293001-6293023 AAGAACAAAGAGAAGGTTGGAGG - Intronic
1156572628 18:38276016-38276038 CAGAAAGAAAATAAGATTGGTGG - Intergenic
1157292170 18:46417596-46417618 CAGGAAGAAGAAAAGGTTGGGGG - Intronic
1157895206 18:51460082-51460104 AAGGGGAAAGATAAGGATGGAGG - Intergenic
1159777002 18:72614031-72614053 CAGAGAAAACATGATCTTGGAGG - Intronic
1160001878 18:75032496-75032518 GAGAGAAGAGAGAAGGTTGGTGG - Intronic
1160130767 18:76223033-76223055 GAGTGAAGAGATAAGGTTGGTGG + Intergenic
1160290977 18:77593325-77593347 CAGAGAAAATGGAAAGTTGGAGG - Intergenic
1162759538 19:12880664-12880686 CAAAGAAAAAAAAAAGTTGGGGG + Intronic
1162943516 19:14028462-14028484 CAGAGATAAGAGGAGGTTGCTGG + Intronic
1163326939 19:16610683-16610705 CATAGAAATTATAAGGATGGTGG - Intronic
1165977659 19:39691498-39691520 CAGAGAAAAGAAAAGGGTGTGGG + Intergenic
1166406831 19:42527593-42527615 CAGAGAAATGACAAGGTCAGAGG - Intronic
1167018718 19:46859073-46859095 CACAGGAAAGACAAGGTGGGGGG - Intergenic
925753885 2:7115117-7115139 GAGAGAAAAGATAAAGTATGAGG - Intergenic
925943313 2:8839599-8839621 CTGAGGAAAGATGGGGTTGGGGG - Intergenic
925970393 2:9102755-9102777 CAAAGAACAGAGAAGTTTGGAGG + Intergenic
926053373 2:9758671-9758693 AAGAGCAAAGAGAAGGTTGTAGG + Intergenic
927270629 2:21206116-21206138 CAAAGAAATGATAATGTTTGAGG - Intergenic
927652886 2:24922919-24922941 CAGAGGAGAGATAGGGATGGTGG - Intergenic
927907062 2:26866571-26866593 CAAAGAAAAGATAAAGTTTGAGG + Intronic
928008945 2:27589582-27589604 CAAAGAAAAGGTAAGGTAAGAGG - Intronic
928467236 2:31533460-31533482 TAGAGAAAAGATCAGGGTAGAGG + Intronic
928517314 2:32055778-32055800 AAATGAAAAGATATGGTTGGAGG - Intergenic
929449427 2:42026971-42026993 TAGAGAAACCATAAGGTTTGGGG - Intergenic
929561613 2:42959888-42959910 CAGAAAAAAGAAAAGGCTGGGGG - Intergenic
929630454 2:43455122-43455144 GAGAGAAAAAATAAGATTAGAGG - Intronic
929899045 2:45985768-45985790 AAGAGGGAGGATAAGGTTGGAGG + Intronic
929909489 2:46076954-46076976 CAGAGAGTAGAATAGGTTGGTGG + Intronic
931622681 2:64227007-64227029 GAAAAAAAAGAAAAGGTTGGGGG + Intergenic
931853795 2:66280652-66280674 CAGAGAAATGAAAAGACTGGAGG - Intergenic
931869065 2:66440146-66440168 GAGAGAAAATCTGAGGTTGGAGG - Intronic
931969809 2:67573495-67573517 CAGAAACTAGTTAAGGTTGGAGG + Intergenic
933335271 2:80950171-80950193 AAGAGAAAAGATGAGGTATGAGG - Intergenic
933649697 2:84840637-84840659 CAGAAAAAAGTTAATGTGGGCGG - Intronic
933730947 2:85455898-85455920 CACAGGTAAGATAAGGTAGGAGG + Intergenic
934480293 2:94633120-94633142 CAGATATAAGATTAGGTTGTGGG + Intergenic
935829768 2:106988880-106988902 TAGAGAAAAGTTAAAGTTGGAGG - Intergenic
937027450 2:118711265-118711287 CAGGGAGAAGAGGAGGTTGGTGG - Intergenic
937028793 2:118721014-118721036 CAGAAAAATGATGAGGGTGGAGG - Intergenic
937728662 2:125198714-125198736 CAGAGACAATGTGAGGTTGGAGG + Intergenic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
938937566 2:136140538-136140560 CATATAAGAGATAATGTTGGGGG - Intergenic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
939892921 2:147758852-147758874 CAGAGAAATGATGAGATTGTGGG + Intergenic
941001144 2:160204971-160204993 GAGAGAGCACATAAGGTTGGAGG + Intronic
941133944 2:161689936-161689958 CAGAGAACAGAAAAGTTTTGAGG - Intronic
941622626 2:167795522-167795544 CAGAGAAAAAAAATGGTTTGGGG - Intergenic
942710008 2:178823168-178823190 CAGAGAAAAAATAATCATGGTGG - Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944294221 2:198043721-198043743 CAGAGAACAGGTTTGGTTGGGGG + Intronic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
945282971 2:208054211-208054233 CTGAGATCAGATAAGATTGGGGG + Intergenic
945641480 2:212436881-212436903 CAGAGACAAGAATAGGTTGGAGG + Intronic
945809264 2:214528483-214528505 CAGAGAAAAGAAAAGTTAAGAGG - Intronic
1169475038 20:5923446-5923468 CAGAGAAGAGAAAAGGTTCTTGG + Exonic
1172263007 20:33585025-33585047 CAGAAAAAAAACAAGGTTTGAGG - Intronic
1172538767 20:35694984-35695006 CTGAGATAAAATAAGGTGGGTGG - Intronic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173174891 20:40756966-40756988 CACAGAAGAGGTAAGGTTTGAGG - Intergenic
1174376280 20:50128682-50128704 CAGAGCAAAGATGGGGTGGGTGG + Intronic
1174441844 20:50561919-50561941 GAGAAAAATGATGAGGTTGGCGG - Intronic
1174523365 20:51151773-51151795 CACAGAAAGGACAAAGTTGGAGG + Intergenic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1176172591 20:63702733-63702755 CAAAAAAAAGATAGGGTTTGGGG + Intronic
1176263589 20:64196770-64196792 CAGAGAATAGAGAGGGTTGCAGG - Intronic
1176302168 21:5103800-5103822 CACACAAAAGATAAGGTTATGGG + Intergenic
1177170015 21:17644667-17644689 CAGGGCAATGATGAGGTTGGGGG + Intergenic
1177462599 21:21432360-21432382 AAAAGAAAAGAAAATGTTGGAGG - Intronic
1177984530 21:27957416-27957438 AACAGAAAAGGTGAGGTTGGAGG + Intergenic
1177991832 21:28045048-28045070 CTGAAAAAACATAAAGTTGGAGG + Intergenic
1178452086 21:32711304-32711326 CAGAAAAAAGAAAAAGGTGGAGG - Intronic
1178481084 21:32979589-32979611 AAGAGAAATGAAAAGGATGGAGG + Intergenic
1179854860 21:44158122-44158144 CACACAAAAGATAAGGTTATGGG - Intergenic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1182011145 22:27001712-27001734 GAGAGAAAAAAAAAGGTGGGAGG - Intergenic
1183123602 22:35752737-35752759 CAAAGGAAAGAAAAGGCTGGTGG - Intronic
1183176974 22:36231477-36231499 AGAAGAAAGGATAAGGTTGGAGG + Intronic
1183181253 22:36261563-36261585 AGAAGAAAGGATAAGGTTGGAGG - Intronic
1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG + Intergenic
949294452 3:2504871-2504893 AAGAGACAATAAAAGGTTGGGGG + Intronic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
949844418 3:8355338-8355360 AAAAGAAAAGAAAAGGTTGCGGG + Intergenic
950216653 3:11164576-11164598 CAGAGAAAAAGTAAGCATGGAGG - Intronic
951110085 3:18792977-18792999 CAGATAAAATATAAGTTTGGAGG - Intergenic
951742695 3:25941827-25941849 AGGAGAAAAGATAAGGAGGGAGG - Intergenic
951955666 3:28250539-28250561 CAGAAAGAAGAAAAGGGTGGTGG - Intronic
952185531 3:30963822-30963844 GAGAGAAAGGATGAAGTTGGTGG - Intergenic
953395738 3:42568234-42568256 AAGAGAAAAGGTAAGGAGGGAGG - Intronic
953441838 3:42924961-42924983 CATAGAAAAGACTGGGTTGGAGG + Intronic
954689037 3:52386112-52386134 CAGAGAAGAGAAAAGGGGGGAGG + Intronic
955584460 3:60461772-60461794 CAGAGGCAGGATAAGGATGGGGG + Intronic
955806024 3:62735761-62735783 CAAAGAAAAGAAAAGGTGGTAGG - Intronic
957888721 3:86326741-86326763 CAAAGAAATGATAATGTTTGAGG + Intergenic
959192155 3:103128092-103128114 CAAAGAAAAAATTAGGTTTGTGG - Intergenic
959763110 3:109992351-109992373 GAGAGAAAAAATAAAATTGGAGG - Intergenic
960735665 3:120777043-120777065 AAGAGAAAACATAAAGTTTGGGG - Intronic
961171302 3:124799694-124799716 CAGAGAGAAAACAGGGTTGGCGG + Intronic
961719527 3:128883654-128883676 TAGAAAAAAAAAAAGGTTGGAGG - Intronic
963240165 3:142995101-142995123 TGGAGAAGAGATAAGGGTGGAGG + Intronic
963257015 3:143154878-143154900 CACAGATAAGAAAATGTTGGGGG - Intergenic
963428415 3:145162741-145162763 CAAACAAAAGATAAAATTGGAGG + Intergenic
963833662 3:150034842-150034864 CAGGGGAAAGCTAAGGGTGGGGG + Intronic
964993621 3:162845898-162845920 TTGAGGAAAGACAAGGTTGGAGG - Intergenic
965333839 3:167410524-167410546 CAGAGAGAAGACATGGCTGGAGG + Intergenic
966374948 3:179286852-179286874 CAGAGAAATGAGAAAGTTGGGGG + Intergenic
966879036 3:184339259-184339281 CAGAGAAAAGAAGAGGCTGTCGG + Intronic
967298482 3:187988580-187988602 CACAGAAATAATAATGTTGGTGG + Intergenic
967986286 3:195097886-195097908 CAAAGAAAAGATGAGACTGGTGG + Intronic
968740396 4:2326949-2326971 CACAGATAAGATAAGGTTGCCGG + Intronic
968810206 4:2796348-2796370 GGGAGAAGAGAGAAGGTTGGGGG - Intronic
969195700 4:5562135-5562157 AGGAGAAAGGATAAGGTTTGTGG + Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969923893 4:10567143-10567165 AAAAAAAAAGATAAAGTTGGAGG + Intronic
971636653 4:29068736-29068758 CAGAGACAAGATAAGGCTAAGGG - Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
973780520 4:54284283-54284305 CAGAGATAAGAAGAGTTTGGAGG - Intronic
973953616 4:56041197-56041219 AAGAGAAAGGATAAGGTCAGGGG - Intergenic
975589515 4:75986385-75986407 CAGGGAAAAAGTGAGGTTGGAGG - Intronic
975883273 4:78936939-78936961 CTTGGAAAAGATAAGGCTGGTGG + Intronic
975976750 4:80106017-80106039 CAGCTAAAATTTAAGGTTGGTGG + Intronic
976127348 4:81848263-81848285 CAGAGAGAAGATAATTTTGTTGG + Intronic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
976985374 4:91289126-91289148 TAGAGAAAATTTAAGCTTGGGGG + Intronic
977475332 4:97500128-97500150 CAGAGAAAAGATGATGATAGTGG + Intronic
977924722 4:102687042-102687064 CAGAAAGAAGAGAAGGTTTGGGG - Intronic
978377496 4:108090679-108090701 CAAAGGAAAGATAATGTTTGAGG - Intronic
979338665 4:119493465-119493487 TAGAGAAAATAAAAGGTAGGGGG - Intergenic
979554407 4:122028660-122028682 AAAAGAAAAGCAAAGGTTGGGGG - Intergenic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
980774982 4:137425936-137425958 CAGAGGTACGATAAGGATGGTGG - Intergenic
981054193 4:140343284-140343306 AAGCGTAAGGATAAGGTTGGGGG - Intronic
981148992 4:141359495-141359517 CAAGGAAAAGATAAGAATGGAGG - Intergenic
982644699 4:158009046-158009068 CAGTGAATAGATGGGGTTGGTGG - Intergenic
983440378 4:167775125-167775147 GAAAAAAAATATAAGGTTGGAGG + Intergenic
983568633 4:169180955-169180977 AAGAGAAAAGAAAGGGTTGCTGG - Intronic
984272750 4:177567661-177567683 CAGAGAAGAGAGATGGCTGGAGG + Intergenic
984441024 4:179770772-179770794 CAGAGGAAAAGTAAGGTTTGGGG + Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984631458 4:182065486-182065508 GAGAGCAAAGATAAGGGAGGAGG + Intergenic
985346625 4:189012168-189012190 GGGAGAAAATATAAGGGTGGCGG + Intergenic
987490768 5:18578047-18578069 GAGAGAAAAGAGAAGGTAGTAGG + Intergenic
988869266 5:35370871-35370893 CAGAGAAATACTAAAGTTGGAGG + Intergenic
989548350 5:42700828-42700850 TAGAGGAAAGTTAAGTTTGGAGG + Intronic
990875397 5:60478639-60478661 AAAAGAAAAGATAACCTTGGAGG - Intronic
991044289 5:62206852-62206874 CAGCAATAAGATGAGGTTGGTGG - Intergenic
991771956 5:70049024-70049046 CAAACAACAAATAAGGTTGGGGG + Intergenic
991851248 5:70924435-70924457 CAAACAACAAATAAGGTTGGGGG + Intergenic
992171069 5:74102656-74102678 CTGAGACTAGATAAGGCTGGTGG - Intergenic
992240157 5:74760665-74760687 CTGAGCAAAGGAAAGGTTGGTGG - Intronic
993453531 5:88101106-88101128 CAGAGGAGAGAAAAGGGTGGGGG - Intergenic
994153992 5:96481767-96481789 CACAGAAAAGATTAAGTTGGTGG + Intergenic
994234344 5:97343606-97343628 CAGAGAATGGAAAAGTTTGGAGG - Intergenic
994730763 5:103488072-103488094 CAAAGAAGAAATATGGTTGGTGG - Intergenic
995718666 5:115106013-115106035 AAAAGAAAAGAAAAGGTGGGAGG + Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996645264 5:125807031-125807053 AAGAGAAAAGATAAAGTTAAGGG - Intergenic
1002423309 5:179161701-179161723 CAAAGAAATGATAATGTTTGAGG + Intronic
1002521095 5:179793636-179793658 CAGGGAACAGATAAGGTGGGTGG + Intronic
1003375364 6:5572026-5572048 CAGGAAAAAGATAACTTTGGGGG - Intronic
1005923451 6:30419929-30419951 AACAGAAAAGGAAAGGTTGGGGG + Intergenic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1007274197 6:40661446-40661468 CAGGGAAAAAATAAGGTTCGAGG + Intergenic
1007403850 6:41621242-41621264 CAGAGAGAAAATGAGGGTGGGGG - Intergenic
1007642391 6:43352510-43352532 AATAGAAAAGAGAATGTTGGAGG - Intronic
1007735282 6:43978446-43978468 GAAAGAGAAGATAAGGATGGAGG - Intergenic
1008437308 6:51491691-51491713 TAGAGAAAAAATAAGGTAAGTGG - Intergenic
1008521691 6:52367729-52367751 TAGAGGAAAGATGAGGATGGAGG + Intronic
1008524747 6:52396896-52396918 CTCAGAAAAGATCTGGTTGGAGG + Intronic
1009055639 6:58331422-58331444 GAGAGAAAAGATATTGTTTGCGG + Intergenic
1009470153 6:64022847-64022869 AAGAACAAAGAGAAGGTTGGCGG - Intronic
1011113146 6:83860191-83860213 CAGGGAGAAGATGAGGTTGAGGG - Intronic
1011219018 6:85034655-85034677 CAGGGAAAGGATATGGTAGGTGG - Intergenic
1011405922 6:87015504-87015526 CAGAGAACAGATTAGGTAGTTGG - Exonic
1011532863 6:88343183-88343205 CAGGGAAAAGATATGAGTGGGGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013159797 6:107531983-107532005 CAGGGAAAAGATTTGGTTTGAGG - Intronic
1013302752 6:108819426-108819448 CAAAGAAAACATAGGGTTAGAGG - Intergenic
1013527163 6:110985260-110985282 TAGAGAAGAGCTAAAGTTGGGGG + Intronic
1013527757 6:110990568-110990590 CAAACAAAAGAAAAGGTGGGGGG - Intronic
1013706375 6:112839741-112839763 CATAGAAAAGATAAAGCTGCTGG - Intergenic
1014321697 6:119937613-119937635 CAGAGAAAAGGGAATGCTGGTGG - Intergenic
1014429742 6:121353948-121353970 CAGAGAGAAGAGAAGCTTTGGGG + Intergenic
1015035615 6:128650799-128650821 TAGATAAAAGATGAGGATGGTGG + Intergenic
1015918620 6:138244256-138244278 AAGAGAGAAAGTAAGGTTGGAGG - Intronic
1016359922 6:143256333-143256355 GAGAGAAAACAAGAGGTTGGAGG - Intronic
1016370310 6:143366636-143366658 CAGAAATAAGAGAATGTTGGAGG - Intergenic
1016739704 6:147514107-147514129 CAGAGAAAAGGAGATGTTGGGGG + Intronic
1018361582 6:163076179-163076201 CACAGAGAAGACAAGGTTTGGGG - Intronic
1020339755 7:7097122-7097144 AAGAAAAAAGAGAAGGTTGGAGG + Intergenic
1021258692 7:18427265-18427287 CACAAAAAAGATAAGGCTGTAGG - Intronic
1022315396 7:29240693-29240715 CAGACCAAAGATGAGGGTGGGGG + Intronic
1023040510 7:36168757-36168779 CAAAAAAAAAAAAAGGTTGGGGG + Intronic
1023612293 7:41983260-41983282 CAGAGAAAAGAAAAGGCAGTAGG + Intronic
1023722278 7:43108891-43108913 CAGAGAAATGCTAAGTTTGTGGG + Intergenic
1024374984 7:48626919-48626941 GAGAGAAAACTTAAAGTTGGGGG + Intronic
1024438789 7:49390422-49390444 AAGAGAAAAGGGAATGTTGGTGG - Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1025578434 7:62678422-62678444 CAAAGAAAAGTTGAAGTTGGTGG - Intergenic
1025995250 7:66523607-66523629 CAGTGAATAGATGAGGTTGGAGG + Intergenic
1026518756 7:71096522-71096544 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
1027518502 7:79172410-79172432 CAGACAAAAGATTAGGTTATTGG + Intronic
1027753968 7:82186475-82186497 CAGAGCAAAGTTAAGGTTGCAGG + Intronic
1028157383 7:87446963-87446985 CAAAGAAAAGAGAAGGTAGATGG + Intronic
1028361045 7:89966308-89966330 TGGAGAGAAGATATGGTTGGAGG + Intergenic
1028492512 7:91427974-91427996 GAGAGAAAACATAAGGTGGCTGG + Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1030665944 7:112278698-112278720 GAGAGAAAAGTCAAGGCTGGAGG - Intronic
1031221131 7:118966898-118966920 CATTTAAAAGATAAGCTTGGAGG - Intergenic
1031528872 7:122852855-122852877 TAGAGAACAGATAAGGGTTGGGG + Intronic
1031709466 7:125027041-125027063 CACAGATGAGCTAAGGTTGGCGG + Intergenic
1031942260 7:127801672-127801694 CAGAGCGAAGATAAGGTTTTTGG - Intronic
1032108326 7:129054007-129054029 CAGAGAAATAACAAGGTTAGAGG + Intronic
1032237212 7:130135794-130135816 CAGAGAAAAGCTGAGCCTGGTGG - Intergenic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1033551488 7:142451871-142451893 GAGAGAAAACATGAGGGTGGGGG - Intergenic
1033993864 7:147321168-147321190 CAGAGAGAAGAAAAGGAGGGAGG - Intronic
1034849723 7:154482239-154482261 CAGAGATAAGATCAGAGTGGAGG + Intronic
1035566641 8:645506-645528 CAGAAGAAAGATGAGGTTTGGGG - Intronic
1037596551 8:20359061-20359083 CAGGGAAGAGTTAAGGTTGCAGG - Intergenic
1037649224 8:20821715-20821737 CAGAGAAAAGACAAGGTCATTGG + Intergenic
1038445483 8:27601044-27601066 CAAAAAAAAGACAAGCTTGGAGG - Intronic
1038522182 8:28243182-28243204 CTAAGAAAAAAAAAGGTTGGGGG - Intergenic
1038922127 8:32096399-32096421 CAAAGAAATGATAATGTTTGAGG - Intronic
1038955334 8:32462157-32462179 AAGAACAAAGAGAAGGTTGGAGG + Intronic
1039770332 8:40680136-40680158 CCCAGAAAATATAAGTTTGGGGG - Intronic
1041964570 8:63660170-63660192 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
1042627605 8:70776037-70776059 AAAAGAAAAGACCAGGTTGGGGG - Intronic
1043332695 8:79137270-79137292 CAGAGAAAGCATAAAGCTGGTGG - Intergenic
1043508352 8:80924814-80924836 CAGAGAAATGGAAAGGTTGGTGG + Intergenic
1044396177 8:91715716-91715738 GAGAGTAAAGATCAAGTTGGCGG - Intergenic
1044458591 8:92417682-92417704 GAGAGAAATGATATGTTTGGAGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045687464 8:104726989-104727011 CAGAGGACAGAAAAGGGTGGAGG - Intronic
1047120983 8:121904601-121904623 GAGAGAAAAGTAAAGATTGGAGG + Intergenic
1047454456 8:124997012-124997034 CAGATAAAACATAATATTGGGGG + Intergenic
1047498959 8:125428075-125428097 CAGAGAAACTACAAGGGTGGTGG - Intergenic
1047538868 8:125744514-125744536 CAGACCAAAAATCAGGTTGGAGG + Intergenic
1047858038 8:128934287-128934309 CAAAGAAATGATAGGGTGGGGGG - Intergenic
1047957638 8:129987527-129987549 AAAAGAAAAGAAAAGGTGGGAGG - Intronic
1048203215 8:132394226-132394248 CACAGAAATGCAAAGGTTGGGGG + Intronic
1048533297 8:135270425-135270447 CTGGGAAAAGAGAAGGTTGGAGG + Intergenic
1050179838 9:2909479-2909501 CAGTGAAAAGCTGAGGTTTGTGG + Intergenic
1050732384 9:8724172-8724194 CTGAGTAAAGATAAATTTGGGGG + Intronic
1051226886 9:14908554-14908576 AAAAAAAAAGATGAGGTTGGTGG + Intronic
1051480534 9:17555379-17555401 CAGAGAAAAGATAACAAAGGAGG + Intergenic
1051991316 9:23155369-23155391 AAGTGAAAATATAAGGTTGTAGG + Intergenic
1052301640 9:26958837-26958859 GAGAGAAAAGAAAAAGATGGTGG + Intronic
1052632803 9:31062218-31062240 AAGAGATAAGAAAAGGTGGGGGG - Intergenic
1053189824 9:36054262-36054284 TAGGGAAAAGATATGGTTTGAGG + Intronic
1053567731 9:39270764-39270786 TAGAGGGAAGATAAGGGTGGGGG - Intronic
1053833742 9:42111711-42111733 TAGAGGGAAGATAAGGGTGGGGG - Intronic
1054129412 9:61348235-61348257 TAGAGGGAAGATAAGGGTGGGGG + Intergenic
1054791910 9:69264543-69264565 CAAAAAAAAGGTAAGTTTGGTGG + Intergenic
1054873189 9:70068118-70068140 CAGAGAAGAGTTAAGCTTGATGG + Intronic
1055384130 9:75742734-75742756 CAGAGGAATGATGAGCTTGGAGG + Intergenic
1055625691 9:78175302-78175324 CAGTCAAAAGATAATGTAGGAGG - Intergenic
1056214133 9:84392360-84392382 CAAATAAAAGAAAAGGCTGGGGG - Intergenic
1056874152 9:90311917-90311939 CATAGAAATGAGAAGGTTGTGGG - Intergenic
1059268448 9:113057489-113057511 AAGAAAAAAGAAAAGGTGGGAGG + Intergenic
1059363383 9:113765865-113765887 AAGAGAAAGGAAAAGGGTGGTGG - Intergenic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1059976684 9:119725189-119725211 CAGACAAAACAAAAGCTTGGAGG - Intergenic
1060298069 9:122356426-122356448 CAGAGAAGAGATAGAGATGGAGG + Intergenic
1061556652 9:131374089-131374111 CAAAGAAAAGGTAACGTTTGAGG + Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1186158907 X:6755817-6755839 CAGTGAGAAGATAAAGTTGATGG + Intergenic
1186209495 X:7234477-7234499 CAGAGCAAATAAAAGGGTGGTGG + Intronic
1187430326 X:19217769-19217791 GAGAGAAAAGATAAGCTTGTAGG - Intergenic
1187777853 X:22783948-22783970 AAGAGAAAAGAAAAGCTGGGAGG - Intergenic
1188014112 X:25089001-25089023 GAAAGAAAAAATAAAGTTGGAGG - Intergenic
1188253994 X:27936734-27936756 CATTTAAAAGATAAGGTAGGCGG - Intergenic
1189156355 X:38761212-38761234 CAGAGATAGCACAAGGTTGGTGG + Intergenic
1189546982 X:42051538-42051560 AAGAGAAAAGAAAAAGTTGGGGG - Intergenic
1191159071 X:57308254-57308276 CAGAGAAAAGGGAATGTTGATGG - Intronic
1191625946 X:63271688-63271710 CAGAAAAAAAAAAAGGGTGGGGG - Intergenic
1192980029 X:76329590-76329612 CAGAGACAACTTAAGATTGGAGG + Intergenic
1193226042 X:78985510-78985532 GAGGGAAAATATGAGGTTGGAGG - Intergenic
1193732496 X:85117587-85117609 GAGAGAAAAGGAAAGGTTAGGGG + Intergenic
1194643892 X:96434699-96434721 CAGAGGAAAGATAATGATGAGGG + Intergenic
1194792824 X:98172092-98172114 CAGACAAAAGAGAAGGTTCAAGG + Intergenic
1195455873 X:105069076-105069098 AAGAAAAAAGATAGGGGTGGTGG + Intronic
1195840257 X:109168260-109168282 CAGAGTAATGCTCAGGTTGGGGG + Intergenic
1196123711 X:112077849-112077871 AATAGAAAAGATAAGGCAGGTGG - Intronic
1196136492 X:112215236-112215258 CAAAGAAAAGATAATGTTTGAGG - Intergenic
1198437739 X:136633420-136633442 AAGAACAAAGAGAAGGTTGGAGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1198932155 X:141872881-141872903 GAGAGAAAAGATGGGGTGGGTGG + Intronic
1199056317 X:143299192-143299214 CAAAGAAAAGATAAAATTGGGGG + Intergenic