ID: 1130142873

View in Genome Browser
Species Human (GRCh38)
Location 15:81245594-81245616
Sequence CTGCTGGCATGGGTGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130142865_1130142873 2 Left 1130142865 15:81245569-81245591 CCTGGGAAAGATGGAAGTCTAGC 0: 1
1: 0
2: 2
3: 17
4: 149
Right 1130142873 15:81245594-81245616 CTGCTGGCATGGGTGGGACAGGG 0: 1
1: 0
2: 3
3: 39
4: 336
1130142861_1130142873 26 Left 1130142861 15:81245545-81245567 CCGGGTTGGAGTAAGTTGTTACT 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1130142873 15:81245594-81245616 CTGCTGGCATGGGTGGGACAGGG 0: 1
1: 0
2: 3
3: 39
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130142873 Original CRISPR CTGCTGGCATGGGTGGGACA GGG Intronic
900195015 1:1371680-1371702 CTACTGGCATGGGTGGGTGGAGG - Intergenic
900294113 1:1940106-1940128 CTGCTGGCCTGGATGGGCCTCGG + Intronic
900368978 1:2323125-2323147 CTCCTGGGATGGCTGGGACGCGG + Intronic
900426089 1:2579628-2579650 CTGCTGGCGGGAATGGGACATGG + Intergenic
900533729 1:3167215-3167237 CTGAAGGCCTGGGAGGGACAGGG - Intronic
900621742 1:3590719-3590741 CTGCTGGCAGGGGAGGGACAGGG - Intronic
901128696 1:6948584-6948606 ATGTTGGCATGGTGGGGACAGGG + Intronic
901647387 1:10723944-10723966 CTGCTGGCATGGTTTGGACTCGG - Intronic
902210435 1:14900843-14900865 ATGCTGGCATGGCTGGTCCAGGG + Intronic
902728476 1:18352790-18352812 CAGCTGGCAGGGGAGGGGCAAGG + Intronic
904290341 1:29481259-29481281 GTGCTGGTGTGGGTGGGGCATGG + Intergenic
904394952 1:30213870-30213892 CTGCTGAGATGGGTAGGAAAAGG - Intergenic
904599337 1:31665093-31665115 CTGATGCTAGGGGTGGGACAGGG + Intronic
904798025 1:33072099-33072121 CTGCTGGCACGGGCTGGGCACGG - Intronic
904963071 1:34349837-34349859 CTGCTGGGATGGGTCGTCCATGG + Intergenic
905653633 1:39672291-39672313 CTGCTGGCGTGGGTCGGTCGGGG - Intergenic
907475606 1:54703252-54703274 CTGGTGGCCTGGGTGGGAAATGG - Intronic
911496382 1:98637087-98637109 CTGCTGCCAGGGGTGGGAGAGGG - Intergenic
913284756 1:117216198-117216220 CTGCTGGCGAGAGTGGGGCAAGG - Intergenic
913330815 1:117665952-117665974 CAGCTGGGATGTGTGGGGCAGGG - Intergenic
914900785 1:151710057-151710079 CTGCTGTCCTGAGTGGGAGAAGG + Intronic
915488590 1:156239132-156239154 TAGCTGGAATGGGTGGGGCATGG - Intronic
915622243 1:157092851-157092873 CTCTTGGCAGGGCTGGGACAGGG - Exonic
916066460 1:161140041-161140063 CTGGTGGGATTGGTGAGACAGGG - Intergenic
916107359 1:161441491-161441513 CCGCTGGCATGGCTGGGACCCGG - Intergenic
916108944 1:161448909-161448931 CCGCTGGCATGGCTGGGACCCGG - Intergenic
916110532 1:161456290-161456312 CCGCTGGCATGGCTGGGACCCGG - Intergenic
916112117 1:161463700-161463722 CCGCTGGCATGGCTGGGACCCGG - Intergenic
916113704 1:161471081-161471103 CCGCTGGCATGGCTGGGACCCGG - Intergenic
918039185 1:180901835-180901857 TTGCTGGCATGGGTGGTTGATGG + Intergenic
918040903 1:180913192-180913214 CAGCTGGCCTGGGAGGGAGAAGG + Exonic
918294469 1:183143137-183143159 CTGCTGGTATCGATGAGACAGGG - Exonic
920061470 1:203229709-203229731 CTCCTGGCTGGGGTGGGACAGGG - Intronic
920744760 1:208616412-208616434 CTGCTGCCAGGGGTGGGAGAGGG - Intergenic
921042461 1:211447403-211447425 CTGCTGCCAGGGGTGGGGAAGGG - Intergenic
922729124 1:227940889-227940911 CTGCTGACCTGGGTGGCACTGGG - Intronic
1064418445 10:15169445-15169467 CTGCAAGCCTGGTTGGGACAGGG - Intergenic
1065029157 10:21567682-21567704 TTGCTGGTATGGGTGGGGCTAGG + Intronic
1066181923 10:32970932-32970954 CTGCTTGGAAGGGTGGGAAAAGG - Intronic
1066658047 10:37712991-37713013 CTCCTGGCAGGGGTGGGTCCAGG - Intergenic
1067828694 10:49597648-49597670 CTGCTGGCTGGAGTGGGGCAGGG - Intergenic
1070009613 10:72459456-72459478 CTGCTGGTATTGGTGAGATAAGG - Intronic
1070057882 10:72953047-72953069 CTGTTTGCACGGATGGGACAGGG - Intronic
1070398389 10:76032287-76032309 TGGCTGGCATGGGGGGGCCATGG - Intronic
1070814453 10:79313996-79314018 CTGCAGGCATGGGGGGGAGGGGG + Exonic
1071167297 10:82821949-82821971 CAGCTGGCATGTGGGGGGCAGGG - Intronic
1071525008 10:86353526-86353548 CTGCTGGAACGGGAGGAACATGG - Intronic
1072571162 10:96658536-96658558 CTGCTGGCCTGAGTAGGCCAGGG - Intronic
1072654699 10:97321508-97321530 CAGCTGGCATGGCTGGGGGAGGG - Exonic
1072717820 10:97763130-97763152 CTGCTGTCTGGGCTGGGACATGG + Intergenic
1072813414 10:98481503-98481525 CTGCTGACATAGGTAGGACCGGG + Intronic
1073479474 10:103777424-103777446 CAGCTGGCGTGCGTGGGCCAGGG + Intronic
1076600116 10:131651897-131651919 CTGCTGGCAAGGGGAGGGCAGGG + Intergenic
1077342272 11:2031414-2031436 GGGCTGGCATGGGGGGCACAGGG + Intergenic
1077441592 11:2571546-2571568 GTGCTGGGATGGGTGGAGCAGGG + Intronic
1078404231 11:11055259-11055281 TTGCTGGCATGGGTGGGGATCGG + Intergenic
1078464843 11:11542417-11542439 TTGCTGGAATGGGTGGTACAGGG - Intronic
1078519812 11:12053785-12053807 CTGCTGCCATGAGTGGGCCGTGG + Intergenic
1080688678 11:34537216-34537238 CTTCAGGCATGGCTGGGTCAAGG - Intergenic
1081722209 11:45298643-45298665 CTGCTGGTGTGGATGGGCCATGG + Intergenic
1081745478 11:45469795-45469817 TGGGTGGCATGGGTGGAACAGGG + Intergenic
1081874921 11:46401958-46401980 CTGCAGGAATGTGGGGGACAGGG - Intronic
1083159348 11:60845202-60845224 CTGCTGGAATGAGGGGGAGAAGG + Intronic
1083765598 11:64840059-64840081 CAGCTGGCAGGGGTTGGGCAGGG + Intronic
1084548863 11:69828866-69828888 TTGCAGGCAGGTGTGGGACAGGG - Intergenic
1084567668 11:69940544-69940566 CTGCTGTCATGGGGGCGACAGGG - Intergenic
1085402027 11:76241211-76241233 CAGCTGGGATGGGGAGGACAGGG - Intergenic
1085531667 11:77195407-77195429 CTGCCGGCATGTGAGGGCCAAGG - Intronic
1087423283 11:97959671-97959693 CTCCTGTCATGGGAGGGACCTGG - Intergenic
1087854043 11:103069411-103069433 TTGCTGGCATTGGTGGGAGTTGG - Intronic
1089295083 11:117462441-117462463 CTGCTGGCATCCGAGGGCCAGGG + Intronic
1089493574 11:118897875-118897897 CTGCAGGGAGGGGTGGGAGAGGG + Exonic
1089877562 11:121740265-121740287 TTGCTGGCATGAGTGGGATGGGG + Intergenic
1090165877 11:124546415-124546437 CAGCTGGAATGTGTGGGGCAAGG + Intergenic
1090359225 11:126161081-126161103 CTCCAGGCAAGGGTGGCACACGG + Intergenic
1202825258 11_KI270721v1_random:86603-86625 GGGCTGGCATGGGGGGCACAGGG + Intergenic
1092090430 12:5799324-5799346 CTGGGGACATGGGAGGGACATGG - Intronic
1092157687 12:6295106-6295128 CTCCTTGGAAGGGTGGGACAAGG - Intergenic
1092892081 12:12978562-12978584 CTGCTGGCAGTGGAGGGACAGGG + Intronic
1095902178 12:47339300-47339322 TTGCTGGCATAGGTGGGAATGGG + Intergenic
1096497616 12:52047543-52047565 ATGCTTGCAGGGGTGGGAGATGG - Intronic
1097270095 12:57768798-57768820 CTGTTGGCAGTGGAGGGACAAGG + Exonic
1098133830 12:67380666-67380688 CTGCTGGCAGGTGGGGGGCAAGG - Intergenic
1099668427 12:85659993-85660015 CGGCTGGAGTGGCTGGGACATGG - Intergenic
1101575645 12:105994045-105994067 CTTCTGGAATGGCTGTGACATGG - Intergenic
1103019258 12:117520720-117520742 CTGTAGGCAGGGGTGTGACATGG - Intronic
1103019763 12:117524785-117524807 CTTCTGGCATGGTTGAGAAATGG - Intronic
1104804088 12:131573957-131573979 CAGCAGGCATGGGTTGGTCAGGG - Intergenic
1104946463 12:132416972-132416994 GGGCTGGCAGGGGTGGGCCAAGG - Intergenic
1105898788 13:24739982-24740004 CCTCTGGCCTGGGTGGGACAGGG + Intergenic
1108770945 13:53699932-53699954 GAGCTGGGATGGCTGGGACATGG - Intergenic
1109771941 13:66986278-66986300 CCACTGTCATGGGAGGGACATGG - Intronic
1110501161 13:76230621-76230643 CTGCTGCTATGGGTGGGGGAGGG - Intergenic
1111332346 13:86776187-86776209 CTGTTGGAGGGGGTGGGACAAGG - Intergenic
1112371527 13:98798081-98798103 CTGCTTGCAAGGGTGGTGCAGGG - Intronic
1112567966 13:100567486-100567508 CTGATGCCAGGGCTGGGACAGGG - Intronic
1117904368 14:60569029-60569051 CTCCTGGCTTTTGTGGGACAGGG - Intergenic
1118598556 14:67454840-67454862 ATGCTGCCCTGGCTGGGACAGGG - Intronic
1118777425 14:68981609-68981631 CTGCTGGGCTGTGTGCGACAGGG - Intergenic
1119566905 14:75636505-75636527 ATGCTGGCTGGGCTGGGACATGG + Intronic
1120398733 14:84001517-84001539 CTGCTGGCAGAGGCAGGACAAGG + Intergenic
1120480662 14:85045545-85045567 CTTCTAGTAAGGGTGGGACATGG - Intergenic
1121033864 14:90682841-90682863 TTGGTGGCATGGCTGGGACGAGG - Intronic
1122174457 14:99906773-99906795 CTGCAAGCAGGGGTCGGACAGGG + Intronic
1122343743 14:101045385-101045407 CCTCTGGCAGGGGTGGGGCAAGG + Intergenic
1124381778 15:29173187-29173209 CTGCAGGAATGGGCGGGGCAGGG + Intronic
1124593551 15:31075506-31075528 CTGCTTACATGAGTGGGGCACGG + Intronic
1125767325 15:42144423-42144445 GTGCTGCCTTGGGTGGGAGATGG - Intronic
1129361293 15:75026207-75026229 CAGTTGGCTAGGGTGGGACAGGG + Intronic
1129851092 15:78794410-78794432 CTGCAGGGATGGCAGGGACATGG - Intronic
1130142873 15:81245594-81245616 CTGCTGGCATGGGTGGGACAGGG + Intronic
1132394110 15:101459658-101459680 TTGCTGGGATGGAGGGGACAGGG - Intronic
1132719102 16:1307279-1307301 CCGCTGGTCTTGGTGGGACAGGG + Intergenic
1132809862 16:1792356-1792378 CTGCTGTCCTGGGTGGCACTGGG - Exonic
1132866113 16:2093473-2093495 CTGCGTGCATGGGTGGGAGGTGG + Intronic
1133233049 16:4375296-4375318 CAGCTGGCAGGGCTGGGAGAGGG - Intronic
1133738434 16:8633076-8633098 GAGATGGCATGGGTGGGACTGGG + Intronic
1137310923 16:47257471-47257493 CTACTAGCATGGGTGGGAACTGG + Intronic
1137605326 16:49783243-49783265 AGGCTGGGATGGGTGGGAGAGGG + Intronic
1138143718 16:54589670-54589692 CTGCTGGGGAGGGTGGGGCAGGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138589329 16:57991042-57991064 CTGCGGGCAGGGGTGGGGTAGGG + Intergenic
1142565902 17:840178-840200 CTGCTGGCATGGGTGCTAAATGG - Intronic
1143171357 17:4932449-4932471 CTGCAGGCAAGGGTGGGAGATGG + Intronic
1143208064 17:5160146-5160168 TTGCTGGCCTGAGTTGGACATGG + Intronic
1146230710 17:31105862-31105884 CTGCTGGTGGGGGTGGGACACGG - Intronic
1146595576 17:34165559-34165581 CTGCTGGTGTGGGTGGGCCCAGG - Intronic
1146997625 17:37334754-37334776 CTACTGGCATGGACGGGGCATGG - Intronic
1147444533 17:40466778-40466800 CTGATGGGAGGGGTGGGACGGGG + Intergenic
1148156143 17:45426134-45426156 CTGCTGGCCAGGGTGGGGCTTGG + Intronic
1148189325 17:45667635-45667657 CCACTTGCATGGGTGTGACAAGG + Intergenic
1148608532 17:48948064-48948086 AGGGTGGCATGGGTGGGACAAGG + Intergenic
1148821899 17:50364677-50364699 CTGCAGGCAGGGAAGGGACAGGG + Intergenic
1150387812 17:64774753-64774775 CTGCTGGCCAGGGTGGGGCTTGG + Intergenic
1150564862 17:66329668-66329690 CTACTGCCATAGGTAGGACAAGG + Intronic
1151364730 17:73609861-73609883 TTGCTGGAATGGGAGGGACATGG - Intronic
1151887625 17:76932533-76932555 CTTTTGGCAGGGGTGGGAAAGGG - Intronic
1152142388 17:78544430-78544452 CTGCCGACAAGGGTGGGAAAGGG + Intronic
1153315286 18:3715232-3715254 CTGTTGGAATGGGTGAGAAATGG + Intronic
1156504049 18:37577796-37577818 CCCTTGGCATGGGTGTGACAGGG - Intergenic
1157308124 18:46531687-46531709 CGGGTGGCCTGGGTGGGACGGGG - Intronic
1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG + Intronic
1158999129 18:62955230-62955252 ACTCTGGCATGGGTGGAACATGG + Intronic
1159542892 18:69802055-69802077 CCCTTGGCATGGGTGGGCCATGG - Intronic
1160132307 18:76237091-76237113 GTGCTGGCAGGGGTGGGAGTGGG - Intergenic
1160373077 18:78390557-78390579 CTGCGGGCCTGGGGGTGACATGG + Intergenic
1160392286 18:78543251-78543273 CTACTGGCGTGTGTGGGAGAAGG - Intergenic
1160505954 18:79426976-79426998 CTGCCGGCATGGGTTGGGAATGG + Intronic
1160815732 19:1034828-1034850 CCGGGAGCATGGGTGGGACACGG + Intronic
1160992478 19:1865361-1865383 CTGCTGGGATGGTGGGGACCTGG - Intergenic
1161399937 19:4062749-4062771 CAGCTGACATGGGTGGCTCAGGG + Intronic
1161473979 19:4474281-4474303 CCGCTGGGATGGGTGGGCCTCGG + Intronic
1161959883 19:7517304-7517326 CTCCTCCCATGGCTGGGACATGG - Intronic
1163091191 19:15021539-15021561 CTGCGGGCCAGGGTGGGACAGGG + Intronic
1163242082 19:16070469-16070491 CTCCTGGCCTGGGTGGGGCTGGG - Intronic
1166745209 19:45138606-45138628 CTGCAGGTATGGGCGGGACAGGG + Exonic
1166750277 19:45161216-45161238 CTGCTGGTGTGGGGGGGACAGGG + Intronic
1166755327 19:45187233-45187255 CTGGGGCCATGGGAGGGACAGGG + Intronic
1166948260 19:46410444-46410466 CTGCTGGTTTGGAGGGGACAGGG - Exonic
1167420014 19:49397315-49397337 CTGCTGGACTGGGGGTGACAGGG + Intronic
1167509926 19:49890661-49890683 CTGCCGGGGTGGGTGGGGCAAGG - Intronic
1168226121 19:54996657-54996679 CAGCGGGCATGAGTGAGACAGGG - Intronic
925764556 2:7218633-7218655 CTGCTGGGAAGCGTGGGAGAGGG - Intergenic
925866471 2:8232377-8232399 ATGCTGGAACTGGTGGGACAGGG - Intergenic
925977583 2:9151869-9151891 AGGCTGGCATGTGAGGGACAAGG - Intergenic
927202104 2:20584252-20584274 CTGCCAGCATGGCTGGGCCATGG - Intronic
927599064 2:24424357-24424379 GTGCCGGCTTGGGTGGGCCATGG - Intergenic
927752138 2:25678843-25678865 ATGTTGGCAAGGGTGGGGCATGG + Intergenic
928228540 2:29476193-29476215 CTGCAGGCATGGGGAGGAGAGGG - Intronic
928396908 2:30949620-30949642 CTGATGGCAGGGGTGGTAGATGG - Intronic
929587087 2:43123332-43123354 TTGCTGGCCAGGGTGGAACATGG + Intergenic
931689078 2:64819955-64819977 GTGGTGGCAGGGGTGGGAGAGGG - Intergenic
931965588 2:67529921-67529943 GTGCTTGCATGGTTGGGAGATGG + Intergenic
932077760 2:68681067-68681089 GTGGTTGCAGGGGTGGGACAAGG + Intronic
932329665 2:70890902-70890924 CCACTGGCCTGGGTGGGACCAGG - Intergenic
932818804 2:74882202-74882224 CTGCTGGCAGGGGAAGGAGAAGG - Exonic
934527483 2:95060484-95060506 CTGCTGGAATGGAAGGGGCAGGG + Intergenic
934908650 2:98229559-98229581 GTGCTGGCATGGGAGGTCCAAGG + Intronic
937248205 2:120507349-120507371 TTGCTGCCATGGGTGTCACAGGG + Intergenic
938707583 2:133945690-133945712 CTGATGGCAGGAGTGGGCCAAGG - Intergenic
939091944 2:137790326-137790348 CTCTTGTCATGGGTGGGACCTGG - Intergenic
939117254 2:138074689-138074711 CTCCTGTCATGAGTGGGACCTGG - Intergenic
939800297 2:146699727-146699749 CTGCTGCCAGGGGTGGGGGAAGG - Intergenic
940318721 2:152351348-152351370 CTGCTGGGATTGGTGGGAAAGGG - Intronic
940450401 2:153828520-153828542 CGGCTGGAGTGGCTGGGACACGG + Intergenic
941372375 2:164681469-164681491 CTGCTCCTATGGGTGGGAGAGGG + Intronic
941978451 2:171430998-171431020 CTTCTGGCATGGCTGGGTCTGGG - Intronic
942461374 2:176171102-176171124 CTGCTGCCAGGGGTGGGGTATGG - Intronic
942904765 2:181167061-181167083 CAGCTGGAATGGCTGGGACAAGG + Intergenic
943360367 2:186911757-186911779 CTGCTGGCTGAGGAGGGACAAGG - Intergenic
944016421 2:195044749-195044771 CTCCTGGCAGGAGTGGGTCAAGG - Intergenic
945858577 2:215095043-215095065 TTGCTGTCATGAGGGGGACAGGG - Intronic
946239598 2:218345514-218345536 TTGCAGGGATGGGTGGGGCAGGG - Exonic
946410889 2:219514665-219514687 CTGCTGGCTAGGGAGGGACAGGG + Exonic
948155534 2:235778224-235778246 CTGATGGCAAGGGTCGTACAAGG - Intronic
948156784 2:235789750-235789772 CTGCTGGCTTGCTTGGGGCATGG + Intronic
948669448 2:239558659-239558681 GTTTTGGCGTGGGTGGGACAGGG + Intergenic
948738752 2:240028893-240028915 CTGCTGGGACAGGTGGGACAGGG + Intergenic
948784095 2:240342034-240342056 CTTCAGGCATGGGTTGTACAGGG + Intergenic
948791079 2:240377112-240377134 ATGCTGGCCCGGGTGGGAAACGG - Intergenic
1169112651 20:3043842-3043864 CCCCTGGCATGGGAGGGATAAGG + Intronic
1169797475 20:9479518-9479540 CTGATGGCATGGTAGAGACATGG - Exonic
1171457749 20:25281434-25281456 CCGCTGGCAGGGCTTGGACAGGG + Intronic
1172027616 20:31959892-31959914 TTGGTGGCAGGGGTGGGGCAGGG - Intergenic
1173354158 20:42271205-42271227 CTGTTGTCATGCTTGGGACAGGG - Intronic
1175033137 20:55974738-55974760 CTGAGGGCATTGCTGGGACATGG - Intergenic
1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG + Intergenic
1175181084 20:57148174-57148196 CTTATGGCATGGGGTGGACAGGG + Intergenic
1175268969 20:57720418-57720440 CTGCTGGCATGGGGAGACCAGGG - Intergenic
1175806026 20:61829879-61829901 CTGCTGGGGTGGGAGGGACGAGG + Intronic
1176101187 20:63365294-63365316 CTGTTGGCAGGTGGGGGACAGGG - Intronic
1177030116 21:15972407-15972429 CTGCTGGCAGGGGTTGGGCAGGG - Intergenic
1177840151 21:26227067-26227089 CTGTTTCCATGGGTGGGAAAGGG - Intergenic
1181151340 22:20885584-20885606 CTGCTGGCAGAAGTGGGAGAAGG + Intronic
1181403680 22:22667156-22667178 CTGCTGGACTGAGAGGGACAAGG - Intergenic
1181408691 22:22703140-22703162 CTGCTGGACAGGGAGGGACAAGG - Intergenic
1181474239 22:23158783-23158805 GTGCTGGGCTGGGAGGGACAAGG - Intronic
1181497018 22:23293016-23293038 CTGCTGGTGGGGCTGGGACAGGG + Intronic
1181969453 22:26679333-26679355 GACTTGGCATGGGTGGGACAAGG + Intergenic
1183021605 22:35031505-35031527 CTGCTGGCATTGCTGGGAGGAGG - Intergenic
1183031369 22:35108755-35108777 CTGCTGGCCTGGGTGGGGATTGG + Intergenic
1183084925 22:35480902-35480924 CAGCAGGCAGGGGTGGGCCAGGG - Intergenic
1183134866 22:35877505-35877527 CTGCTGGGATGGGTCTGAAACGG + Intronic
1183629351 22:39023905-39023927 CCGTAGGGATGGGTGGGACAAGG - Intronic
1183630607 22:39030276-39030298 CCGCAGGGTTGGGTGGGACACGG - Intronic
1183744262 22:39684336-39684358 CGGCTGGCATGGGCAGGAGAGGG - Exonic
1184644056 22:45886552-45886574 GTGCTGGGGTGGGTGGGGCAGGG - Intergenic
1185305396 22:50112617-50112639 CTGCTGGGGTGGGTGAGCCAGGG + Intronic
1185341310 22:50292506-50292528 CCGCGGGCATGGGTGGGGCTGGG + Intronic
1203273700 22_KI270734v1_random:73913-73935 ATGCTGGCATGGGAAGAACAAGG + Intergenic
949653190 3:6185142-6185164 GTGATTGGATGGGTGGGACAAGG - Intergenic
949928023 3:9057538-9057560 CTGCTGGGAGGGGAGGGGCAAGG - Intronic
951857260 3:27211611-27211633 AGGCTAACATGGGTGGGACAGGG - Intronic
953906264 3:46869742-46869764 CTGTTGGCATGGGTGGGGAAGGG + Intronic
954154802 3:48679450-48679472 CTGGTGGTCTGGGGGGGACAAGG + Exonic
954328003 3:49874036-49874058 CTGTCTGCATGGCTGGGACATGG + Intergenic
954612826 3:51955332-51955354 CGGCTGGCAAGGGAGGGGCAGGG - Exonic
956945275 3:74214750-74214772 TTTCTGTCATGGGTGGGAAAAGG - Intergenic
957138076 3:76315147-76315169 GTGCCAGAATGGGTGGGACATGG - Intronic
957191378 3:77014487-77014509 CTGCTGGGATCGGCGTGACATGG - Intronic
958962450 3:100523003-100523025 ATGCTGGCCTGGAGGGGACAGGG - Intronic
959943981 3:112108388-112108410 TTGCTGGGAGGGGTGGGAAAGGG + Intronic
960527029 3:118721465-118721487 TTGCTGGCATGGGTGGGGTTGGG + Intergenic
960970022 3:123132763-123132785 CTGCTGTCACGGCTGGGACAGGG - Intronic
961010685 3:123433768-123433790 CTGGTGGCATAAGTGGGACAGGG - Intronic
961650243 3:128413519-128413541 CTGCTGGCCTGGGTGGGCCAGGG - Intergenic
963072854 3:141319179-141319201 CAGCTGGAGTGGCTGGGACACGG + Intergenic
965674728 3:171182650-171182672 CTGCTGGAAAGGGTGGGAGTGGG + Intronic
966919839 3:184604280-184604302 CTGCTGCCGGGGGTCGGACAGGG + Intronic
967947780 3:194817880-194817902 CTGCTGGCTCTGGTGGGAAAGGG - Intergenic
969176021 4:5399702-5399724 CTGCTGGGAAGGCTGAGACACGG - Intronic
969375966 4:6763422-6763444 CAGCTGGCCTGGGAGGGGCAAGG - Intergenic
970449513 4:16152972-16152994 CTGATTCCTTGGGTGGGACAAGG + Intergenic
971346506 4:25816512-25816534 ATGCAGGCCTGAGTGGGACATGG - Intronic
971756179 4:30711437-30711459 CTCAGGGCATGGGTGGGACCTGG + Intergenic
973663431 4:53132786-53132808 CTGCTGGCTTGGTGGTGACAAGG - Intronic
975132358 4:70842099-70842121 CTGCTGGCATTGGTGGGTCCTGG - Intergenic
975690104 4:76954521-76954543 CAGCAGGCATGAGTGGGTCAGGG - Intronic
975909303 4:79248653-79248675 CTGGTGGCAATGGTGGCACAGGG - Intronic
976613694 4:87054652-87054674 CTGCTGCCATGGGTGGTGCCTGG + Intronic
976846775 4:89497666-89497688 CTGCTGGCATGGTTGGATCATGG + Intergenic
977860456 4:101952849-101952871 CTCCTGGCATGAAAGGGACATGG - Intronic
977952710 4:102993004-102993026 CACATGTCATGGGTGGGACAAGG - Intronic
982100167 4:151959576-151959598 CTGCTGATATGGCAGGGACAAGG - Intergenic
983911609 4:173245970-173245992 CTTCAGGCATGTGTGGTACAGGG - Intronic
983931694 4:173460237-173460259 CTGCTGCCTGGGGTGGGGCAGGG - Intergenic
984747785 4:183239724-183239746 CAGCTAGCATTGGAGGGACAGGG + Intronic
985689647 5:1300052-1300074 CTGCTTCCCTGGGTGGGTCAAGG - Intergenic
986192142 5:5507476-5507498 CTGCTGGCAGGGGTGGAAAATGG + Intergenic
986446447 5:7825510-7825532 CAGCTGGCATGGCTGCAACAAGG - Intronic
987008776 5:13738655-13738677 GTGGTGGCAGGGGTGGGAGAAGG + Intronic
988245346 5:28673777-28673799 CTGTAGGGATGGGTAGGACATGG - Intergenic
989647117 5:43646703-43646725 CTGCACACATGGGTAGGACAAGG + Intronic
990493080 5:56321035-56321057 CTGCTGGCTTGGATGGGAGTGGG - Intergenic
990786795 5:59430195-59430217 CTGCTGAAATGGGAGGGTCAGGG - Intronic
992454347 5:76902476-76902498 CTGCTGCCAGGGGTGGGGCAGGG + Intronic
992487125 5:77208608-77208630 TTACAGGCATGGATGGGACAAGG + Intergenic
993269113 5:85770484-85770506 TTGCTGGCAGGGATGGGCCAGGG + Intergenic
993520177 5:88890016-88890038 CGGCTGGCCAGAGTGGGACAGGG - Intronic
993876425 5:93312591-93312613 CTGCTGATATGGGAGTGACAAGG - Intergenic
994171341 5:96662421-96662443 CTTCTGGCCGGGCTGGGACATGG - Exonic
994832286 5:104800562-104800584 ATGCTGACATGGGTGGCAGAGGG - Intergenic
995892186 5:116967119-116967141 CTGCTGACTAGGGGGGGACATGG + Intergenic
997255901 5:132427744-132427766 CTGCAGGAATGGGAGGGGCAGGG + Intronic
997939436 5:138143540-138143562 CTTCTGGGTTGGGTGGGACTTGG + Intronic
1000282648 5:159795357-159795379 CTTCTGTCATGAGTGGCACAAGG + Intergenic
1001482230 5:172096345-172096367 CTGCTGGTGTGGGAGGGGCAGGG - Intronic
1002081444 5:176739937-176739959 CGGCTGGCATGTGGGGGAGAGGG - Intergenic
1003311701 6:4974562-4974584 CTGCTGGTCTGGCTGAGACAGGG + Intergenic
1003659279 6:8045155-8045177 CTGCTGGAGTGGCTGGGACATGG - Intronic
1003682492 6:8269698-8269720 CTGCTGTCATTGCTGGGAAAAGG + Intergenic
1004321826 6:14637801-14637823 CTGCTGGCATAGTAGGCACATGG - Intergenic
1006446174 6:34080999-34081021 CTGCTGGCCTCTGTGGGGCAGGG + Intronic
1007073572 6:39053166-39053188 CTGCTGCCTTGTGAGGGACAGGG + Intronic
1007177391 6:39906318-39906340 CTCCAGGCCTGGGTGGGCCATGG + Exonic
1010625204 6:78130656-78130678 TTGCTGGCTGGGGTGGGAGAGGG - Intergenic
1010906946 6:81502213-81502235 CACATGGCATGGGAGGGACAAGG + Intronic
1011713009 6:90073813-90073835 CTTCTGACATGGGTGGAGCATGG - Intronic
1013317346 6:108955346-108955368 CTGCGGGCATGTGAGTGACAAGG + Intronic
1014116029 6:117669863-117669885 GGGCTGGAATGGCTGGGACATGG - Intergenic
1014742682 6:125164686-125164708 CTGCTAGTATGGTTGGGAGATGG - Intronic
1014804614 6:125814672-125814694 CTGCTGGCAAGCGTGGGTGAGGG + Intronic
1017332598 6:153217199-153217221 CTGCTGATATGGGCTGGACAGGG + Intergenic
1017547572 6:155468422-155468444 AGGCTGGGATGGCTGGGACATGG + Intergenic
1017924863 6:158901887-158901909 CTGCTGCCGGGGGTGGGAGAGGG + Intronic
1018859859 6:167703813-167703835 AGGCTGGCGTGGCTGGGACATGG - Intergenic
1019612637 7:1944732-1944754 CAGCTGGCAGGAGTGGGAGAGGG - Intronic
1019613346 7:1947876-1947898 TTCCTGGAATAGGTGGGACACGG - Intronic
1022898511 7:34777432-34777454 CTGCTGCCATTGGTGGGGGATGG + Intronic
1023458702 7:40369700-40369722 CAGTTGACATGGGTGGGAAATGG + Intronic
1023864676 7:44233108-44233130 CTGCTGTCCAGGGTGGGAGATGG + Intronic
1023865792 7:44237801-44237823 CTGCAGGCCTCTGTGGGACAAGG + Intronic
1023871054 7:44263227-44263249 CTGGTGGCAAGGCTGGGGCAGGG + Intronic
1024016896 7:45325473-45325495 CTGCTGGCAGGGGTGGAGCCAGG + Intergenic
1024469697 7:49754884-49754906 CTGCAGGCATGGGAGAGGCATGG + Intergenic
1025028525 7:55537185-55537207 ATGCAGGCCTGGTTGGGACAGGG - Intronic
1025761812 7:64402911-64402933 CTGATGGCATGGGTTGGGAAGGG - Intergenic
1026772247 7:73209922-73209944 CTGATGGCCTGGGAGGGACGGGG - Intergenic
1026896055 7:74010682-74010704 CTACTGGCATGGGTGGCCCTCGG - Intergenic
1027013116 7:74763315-74763337 CTGATGGCCTGGGAGGGACGGGG - Intergenic
1027074925 7:75182719-75182741 CTGATGGCCTGGGAGGGACGGGG + Intergenic
1027789490 7:82620944-82620966 CTGCTCTCATGGGTGGGAGGTGG - Intergenic
1028114102 7:86978066-86978088 CACCTGTCAAGGGTGGGACAAGG + Intronic
1028307855 7:89289491-89289513 CTGCTGCTAGGGGTGGGAAAGGG - Intronic
1031528460 7:122849895-122849917 CTGATGCCATGGTTGGGGCAGGG - Intronic
1032119894 7:129148184-129148206 CTGCTGCCCTGAGTGGGAAAAGG - Intronic
1032884457 7:136123148-136123170 TTGCAGGGAGGGGTGGGACAGGG - Intergenic
1034959292 7:155355112-155355134 CTGCTGGGAAGGCAGGGACATGG + Intergenic
1036149401 8:6283779-6283801 CAGCAGGCAGGGATGGGACATGG - Intergenic
1036791598 8:11724964-11724986 CTGCGGGCATGAGGGGCACATGG - Intronic
1037802004 8:22040997-22041019 CTGGTGGCATGGCTGGGACAAGG - Intergenic
1038134285 8:24768838-24768860 CAGCTGTCAGAGGTGGGACAGGG + Intergenic
1038521416 8:28235650-28235672 TTGCTGGCATGGGTGGGGTTGGG - Intergenic
1039289329 8:36077187-36077209 CTGCTGGCATGTGTGTGTGAGGG + Intergenic
1039562921 8:38527545-38527567 CTCCTGACCTGGGTGGGGCAAGG + Intronic
1040700305 8:50055498-50055520 GTGCTGGAATGCGTGGGGCAGGG + Intronic
1041632431 8:60103250-60103272 CAGCTGGCCTGGGTGAGGCAGGG - Intergenic
1043320648 8:78981443-78981465 CTGTTGGCATGGTTGGCAAATGG - Intergenic
1046569564 8:115946408-115946430 ATGCTGGCATGGTTGGTTCAGGG + Intergenic
1046603873 8:116349408-116349430 CTTGTGGGATGGGTGGGTCATGG - Intergenic
1047744809 8:127836912-127836934 CACCTGGCATGGGTGTGAAATGG - Intergenic
1048404562 8:134106745-134106767 CGGCTGGAGTGGCTGGGACATGG - Intergenic
1048982993 8:139713162-139713184 CTGCTGGCCTCTGAGGGACAGGG + Intergenic
1049209509 8:141378999-141379021 GTGCTGGCATGGGTGGTCCTGGG - Intergenic
1049269185 8:141685100-141685122 CTGCTGGCCTGCATGGGACCAGG + Intergenic
1049720707 8:144114226-144114248 GGGCTGGCTTGGGTGTGACATGG + Intronic
1051159808 9:14194434-14194456 CAGGTAGAATGGGTGGGACAGGG + Intronic
1051279883 9:15431599-15431621 CTGCAGGGGTGGGTGGGAAAGGG + Intronic
1055580961 9:77705786-77705808 CTGCTGGCATGAGTGGGAGCTGG + Intergenic
1057081875 9:92179517-92179539 TTGGTGGCATGAGAGGGACAAGG + Intergenic
1057230896 9:93320731-93320753 CAGCTGGCATCGGGGGGACTTGG - Intronic
1057565962 9:96166564-96166586 CCCCTGGAAAGGGTGGGACAAGG + Intergenic
1057696058 9:97323761-97323783 CTTCTGGAGTGTGTGGGACAAGG - Exonic
1057912559 9:99031336-99031358 CTGGGGGCATGCGTGGGGCATGG - Intronic
1058915516 9:109560788-109560810 CTCCAGGCATGGCTGGGACCTGG + Intergenic
1059325714 9:113503086-113503108 GGGCTGGCATGGGTGAGACCTGG + Intronic
1061320433 9:129824693-129824715 TTGCAGGGATGGGTGGCACATGG - Intergenic
1061745956 9:132740605-132740627 CAGCTGGAATGGGTGGGACTTGG + Intronic
1061886320 9:133592755-133592777 CCGCCGGCCTGGGTGGGACTTGG - Intergenic
1062048269 9:134434313-134434335 CTGCTGGCATGGGCTGGGCCTGG - Intronic
1062061918 9:134501568-134501590 CGCCTGGCCTGGGTGGGCCAGGG - Intergenic
1062080395 9:134620536-134620558 CTGCGGGCAAGGGTGGGGCCTGG - Intergenic
1062572043 9:137190235-137190257 CTGCTGGCTGAGGAGGGACAAGG - Exonic
1187052348 X:15707503-15707525 CTGCTGGCATGTGCAGGCCAGGG - Intronic
1187647484 X:21364057-21364079 TTGCTGGCATGGGTGGGAGTAGG + Intergenic
1188835394 X:34948381-34948403 GTGCTGGCAGGGGTGGGGCTGGG - Intergenic
1189655530 X:43240679-43240701 CTGATGGCCTGGGTGGAAGAGGG - Intergenic
1192269180 X:69562637-69562659 CTGCTGGCATGGGAAAGAAAAGG + Intergenic
1192637799 X:72836395-72836417 TTGCTGGCATGAGTGGGGAAGGG - Intronic
1192643915 X:72884420-72884442 TTGCTGGCATGAGTGGGGAAGGG + Intronic
1193276102 X:79590034-79590056 CTGGTGGCAGTGGTGGCACAGGG + Intergenic
1193360294 X:80572784-80572806 CTGCTGGCAGGGGAAGGAGAAGG + Intergenic
1193392797 X:80948969-80948991 CTGCTGGCAGTGGTGGTACAGGG + Intergenic
1196556472 X:117090647-117090669 CATCTGTCATGGGAGGGACATGG - Intergenic
1197411665 X:126123789-126123811 CTACAGGCATGTGTGGGACTGGG - Intergenic
1199324966 X:146488598-146488620 CAGATGTCAAGGGTGGGACAAGG - Intergenic
1200055380 X:153457307-153457329 CTCCTGGCATGGGTGGCATGTGG - Intronic
1200127892 X:153825412-153825434 CTGGTGGCAGTGGAGGGACATGG + Intronic
1202049180 Y:20763140-20763162 ATGCTGGCTGGGGTGTGACAGGG - Intronic