ID: 1130144071

View in Genome Browser
Species Human (GRCh38)
Location 15:81259304-81259326
Sequence ATGTGGATAGGGAGCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130144071 Original CRISPR ATGTGGATAGGGAGCCTGGA AGG (reversed) Intronic
900013226 1:133279-133301 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
900043291 1:489266-489288 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
900064728 1:724263-724285 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
900471687 1:2858134-2858156 GTGAGCAAAGGGAGCCTGGATGG - Intergenic
900971522 1:5994672-5994694 GTCTGGATTTGGAGCCTGGATGG + Intronic
902234568 1:15049182-15049204 ATGTGACTAGGGAGGCTGGTGGG - Intronic
902280989 1:15374251-15374273 ACGTGGAGAGGGAACGTGGAGGG + Intronic
904964548 1:34361298-34361320 ATGGGGAAAGAGAGCCAGGATGG + Intergenic
906580279 1:46930203-46930225 ATGGGGATGGGGATCCTGGTGGG + Exonic
906603447 1:47148687-47148709 ATGGGGATGGGGATCCTGGTGGG - Exonic
907038883 1:51240248-51240270 ATGAGGACAGGGAAGCTGGAGGG - Intronic
907337981 1:53712907-53712929 ATGTGAATACGGACCCAGGAAGG + Intronic
907460672 1:54603728-54603750 GTCTGGGTAGGGAGGCTGGATGG - Intronic
908690628 1:66775596-66775618 AAGTGGATTAGGAGCCAGGATGG + Intronic
910869841 1:91823118-91823140 AGGTGTTAAGGGAGCCTGGAGGG + Intronic
911039253 1:93579107-93579129 AGCAGGACAGGGAGCCTGGAGGG + Intronic
914826879 1:151143410-151143432 AGGGGGCTAGAGAGCCTGGAGGG - Intronic
914830180 1:151165431-151165453 TTGTGGATAAGTAGCTTGGAGGG - Exonic
914876213 1:151514147-151514169 ATGTGGATCAGGGGCCAGGAGGG - Intronic
915624301 1:157105542-157105564 CAGTCGAGAGGGAGCCTGGAGGG - Intergenic
915897986 1:159826254-159826276 CTGTGGTCAGGAAGCCTGGAAGG + Intergenic
916520676 1:165561026-165561048 ATGGAGATAGGGAGCCCGGGAGG + Intronic
917710589 1:177680284-177680306 ATTTGTAGAGGGAGTCTGGATGG - Intergenic
920003596 1:202816085-202816107 ATGTGGATGAGGAACCTGGGTGG + Intergenic
921114721 1:212078387-212078409 ATGTGAATATAGATCCTGGATGG - Intronic
921363638 1:214353516-214353538 ATGGGGAAAGGGAGACTAGAAGG + Exonic
921457398 1:215388972-215388994 ATGTTGAGAAGGAGCCTGGTGGG - Intergenic
922000259 1:221470140-221470162 AGGTGGGTAGGGAGCAAGGAGGG + Intergenic
922099625 1:222470283-222470305 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
922180773 1:223231221-223231243 TTGTCCAGAGGGAGCCTGGAGGG - Intronic
922261663 1:223949777-223949799 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
923160776 1:231312783-231312805 AACTGCATAAGGAGCCTGGAGGG + Intergenic
923459704 1:234197585-234197607 ATGTGGAGAGGGAGCAAGAAGGG + Intronic
924342827 1:243051951-243051973 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
1065072685 10:22042675-22042697 GTGTGGATAGGCAGCCCAGAAGG + Intergenic
1065511753 10:26486272-26486294 ATATTGATGGGGAGTCTGGAAGG + Intronic
1066733652 10:38453603-38453625 GTGTGCATAGTGGGCCTGGAGGG + Intergenic
1069719575 10:70541026-70541048 ATGTGGATGGGGACCCTGTTGGG + Intronic
1069862561 10:71480744-71480766 ATGAGTGTAGGGAGACTGGATGG + Intronic
1070380722 10:75878355-75878377 AGGTGGATGGGGAGCCAGAAGGG + Intronic
1072787850 10:98296347-98296369 ATGGAGATTGGGAGCCTGGAGGG - Intergenic
1074822634 10:117192471-117192493 ATCTGGAAAGGGAGCTGGGAGGG - Intergenic
1075700175 10:124464205-124464227 GTGTTGATAGGCAGCCGGGAAGG + Intronic
1076969562 11:125483-125505 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
1077676958 11:4203795-4203817 ATGAGAAGAGGGAGCCTGAAAGG + Intergenic
1078426142 11:11252854-11252876 ACAGGGATGGGGAGCCTGGATGG + Intergenic
1079188035 11:18254594-18254616 TTGTGGAGTGGGAGACTGGATGG + Intergenic
1079312227 11:19377230-19377252 ATGTTGTCAGGGAGCATGGAAGG + Intronic
1079753857 11:24231003-24231025 AAGTGAATAGAGAGACTGGATGG + Intergenic
1080277292 11:30516932-30516954 ATGTGGAAAGAGACCCTGTATGG + Intronic
1080742811 11:35081856-35081878 AGGTGAAAAGGGAGCCTTGAGGG - Intergenic
1081540639 11:44032239-44032261 ATGTAGAGAGAGACCCTGGAAGG - Intergenic
1084160195 11:67344352-67344374 ATGTGGAGAGGTGGGCTGGATGG + Intronic
1084689324 11:70715963-70715985 CTGTGGACAGGGCGTCTGGAGGG + Intronic
1085748737 11:79140308-79140330 TTGGGGGTAGGGAGCCCGGAGGG - Intronic
1087652535 11:100884825-100884847 AAGTAGATAGAGAGCCTGGGTGG + Intronic
1088358263 11:108965789-108965811 ATGTGGAAAGAGAGTATGGAGGG + Intergenic
1089112243 11:116065894-116065916 ATGTGTAGAGGGACCCTGGGAGG - Intergenic
1089289059 11:117426863-117426885 CTGTGGATCAGGAACCTGGAAGG - Intergenic
1092138451 12:6166418-6166440 CTGTGGAGAGGGAGCATGGAAGG - Intergenic
1095551954 12:43452883-43452905 ACGTGGACAGTGAGCCTAGAGGG + Intronic
1095945000 12:47748788-47748810 GTGTGGAGAGGGAGCATGGCAGG + Intronic
1096240989 12:49960310-49960332 ATGTGGAGAACGAGGCTGGAGGG - Intergenic
1096752763 12:53772654-53772676 ATCTGGAGAGGGAGGCTGGTGGG + Intergenic
1096870140 12:54587957-54587979 TAATGGAGAGGGAGCCTGGAAGG - Intronic
1098814072 12:75135133-75135155 CTGTGGATAGGGATTCTGAAAGG - Intronic
1100001496 12:89842467-89842489 ATGTGGGTAAGAAGGCTGGAGGG + Intergenic
1101191049 12:102332930-102332952 CTGGGGACAGGGTGCCTGGAAGG + Intergenic
1102486286 12:113259798-113259820 ATGTGGACAGAGAGCAAGGAGGG + Intronic
1104802762 12:131565866-131565888 ATGGGGAGAGGGATCCTGAATGG + Intergenic
1105744023 13:23360067-23360089 ATGAGGAAATGGAGCCTTGATGG - Intronic
1105851681 13:24340753-24340775 AGGTGGCTCGGGAGCCTGGTGGG - Intergenic
1106847846 13:33755942-33755964 ATGTGGTTAGGGAGGCAGGCAGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1109930389 13:69208593-69208615 AGGTGTGAAGGGAGCCTGGAAGG + Intergenic
1111184860 13:84720428-84720450 AGGTGGATGGGGAGCCAGGAGGG - Intergenic
1112406311 13:99123711-99123733 ATGAGTGTAGGGAGCCTGGCAGG - Intergenic
1112464929 13:99635474-99635496 ATGTGGAAGGGGAGGCTGAATGG - Intronic
1118022688 14:61735068-61735090 ATGTGGACAGGTAGACTAGATGG - Intronic
1119666488 14:76488766-76488788 TTGTGGAAGGGGAGCCTTGAGGG - Intronic
1120294437 14:82622529-82622551 AGGTGGATGGGGAGGCTGAAAGG + Intergenic
1121268794 14:92623866-92623888 ATCTGGAGATGGAGGCTGGATGG + Intronic
1121695042 14:95905299-95905321 ATCTGGAACGGGATCCTGGATGG - Intergenic
1121885104 14:97535631-97535653 TTGTGAACAAGGAGCCTGGAGGG + Intergenic
1122338029 14:101006629-101006651 ATGAGGATCAGAAGCCTGGAAGG - Intergenic
1122368969 14:101217170-101217192 CGGTGGCTAGGGAGCATGGAAGG - Intergenic
1125975667 15:43949289-43949311 ATGTGGACAGTGAGCATAGATGG - Intronic
1128080584 15:64854707-64854729 ATCTGGATGGGGAGCCTTGTGGG + Intronic
1128260784 15:66231464-66231486 ATGTAATTTGGGAGCCTGGAGGG - Intronic
1128408247 15:67366193-67366215 ATGTGGACAGGAAGCCTGACAGG - Intronic
1128638297 15:69317309-69317331 ATGGGGTGAGGGAGCCTGGGTGG - Intronic
1129462068 15:75704519-75704541 ATGTGGGTGGGGGGCCTGGCCGG + Intronic
1130144071 15:81259304-81259326 ATGTGGATAGGGAGCCTGGAAGG - Intronic
1130937394 15:88481921-88481943 GACTGGATAGGGAGACTGGATGG + Intergenic
1132012707 15:98290196-98290218 AGGTGGACACGGACCCTGGATGG - Intergenic
1132356538 15:101174921-101174943 TTCTGGAAACGGAGCCTGGAAGG + Intergenic
1132403896 15:101530731-101530753 ATGTGGATTACAAGCCTGGAAGG + Intergenic
1132517491 16:372594-372616 ATGTGGGTAAGGAGCCGGGCTGG - Exonic
1135543023 16:23346696-23346718 AAGTGGGGAGGGAGCCTGCAGGG - Intronic
1136465298 16:30438928-30438950 CACTGGACAGGGAGCCTGGAAGG - Intergenic
1137426941 16:48387617-48387639 ATCTGGATAGGGAGCCTTCCTGG + Intronic
1138426949 16:56941097-56941119 TTGTGGTTTGTGAGCCTGGAAGG - Intronic
1138945720 16:61847250-61847272 ATATGGACAGGGATCTTGGATGG - Intronic
1141426933 16:83950120-83950142 ATGTGCACAGAGAGCCTGGAGGG - Intronic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1142451115 16:90173639-90173661 GTGTGCATAGTGGGCCTGGAGGG + Intergenic
1142456446 17:60056-60078 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
1146640905 17:34540680-34540702 ATGGTGATAGGGAAGCTGGATGG - Intergenic
1151044739 17:70905923-70905945 ATGTGGCTAGACAGGCTGGAAGG + Intergenic
1151382566 17:73735792-73735814 AGGTGGAGAGGGTGCCTGGAGGG - Intergenic
1151547705 17:74803369-74803391 ATGTGGATGGGGAGAGGGGAAGG - Intronic
1154141306 18:11826664-11826686 ATGAGGAAAGGGATCCAGGAGGG + Intronic
1155711803 18:28889951-28889973 ATTTGCATAGGGAGCCTACAAGG - Intergenic
1156301353 18:35839087-35839109 ATCTGGAGATGGAGGCTGGATGG - Intergenic
1156351136 18:36302161-36302183 ATGTGGACAGGCTGCCTGGAAGG - Intronic
1157443197 18:47725720-47725742 ATGTGTATAAGGAGGCTGGAGGG - Intergenic
1157595019 18:48859182-48859204 ATGAGGACAGGGAGAGTGGAAGG - Intronic
1157695873 18:49723194-49723216 TTGTGTACAGGGAGCCAGGAAGG - Intergenic
1160424251 18:78769451-78769473 ATGTGGGTGGGGGGACTGGATGG - Intergenic
1160646367 19:195409-195431 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
1160812338 19:1018214-1018236 AGGTGGATACTGAGGCTGGATGG + Intronic
1161004828 19:1929982-1930004 GGGTGGAGGGGGAGCCTGGAGGG - Intergenic
1161563306 19:4985684-4985706 ATGTGCAGTGGAAGCCTGGATGG + Intronic
1161821703 19:6534022-6534044 AGGTGGACAGGGAGCTAGGAGGG - Intronic
1164697076 19:30253162-30253184 ATGTGGAGAGGGATCCTAGCTGG + Intronic
1165586709 19:36923109-36923131 ATGGGGACAGGGAACCAGGATGG - Intronic
1165866580 19:38943042-38943064 AGGAGGAGAGGGAGCCGGGAGGG + Intronic
1165911051 19:39227799-39227821 TTGTGGATTGGAAGACTGGACGG + Intergenic
1166226491 19:41398975-41398997 ATGTTGATAGTGAGGGTGGAGGG + Intronic
1166437883 19:42785148-42785170 ATGTGGATAAGGTGCCTGGGTGG - Intronic
1166456832 19:42948940-42948962 ATGTGGATAAGGTGCCTCGGTGG - Intronic
1166466784 19:43039809-43039831 ATGTGGATAAGGTGCCTGGGTGG - Intronic
1166472921 19:43095887-43095909 ATGTGGATAAGGTGCCTGGGTGG - Intronic
1166486584 19:43219438-43219460 ATGTGGATAAGGTGCCTGGGTGG - Intronic
1166493701 19:43282873-43282895 ATGTGGATAAGGTGCCTGGGTGG - Intergenic
1168108949 19:54181197-54181219 AGGAGGACAGGGAGCTTGGAAGG + Intronic
926146510 2:10399805-10399827 ACGTGGAGAGGGAGGCTGGTAGG - Intronic
926154163 2:10442376-10442398 AAGGAGATAGGGTGCCTGGAGGG - Intronic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
927863302 2:26573764-26573786 ATGTGAGTAGTGAGGCTGGAGGG + Intronic
927992458 2:27457784-27457806 ATGGGGAGATGGAGCCTGGTTGG + Intronic
928084676 2:28338537-28338559 ATGTGGACAGGCAGTCTGGCTGG - Exonic
928539850 2:32274543-32274565 ATGAGGCTAGGGAGGCTGGCAGG + Intergenic
930011638 2:46941902-46941924 ATGTGGTTTGGGGGCTTGGAGGG + Intronic
932416904 2:71579072-71579094 GGGTGGAGAGGGAGGCTGGATGG - Intronic
932433414 2:71688816-71688838 CTGGGGAGAGTGAGCCTGGAGGG + Intergenic
932583449 2:73007613-73007635 ATGTGGGGAGGCAGCGTGGAGGG - Intronic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
935785424 2:106544495-106544517 GTCTGGAAAGGTAGCCTGGAAGG - Intergenic
936053933 2:109246597-109246619 GTGTGGAAAGGAAGGCTGGAGGG - Intronic
936508602 2:113127930-113127952 ATGTGGATAGTGCGACCGGAGGG + Intronic
937985852 2:127637763-127637785 AGGTGGACAGGGGGCCTGGGAGG + Intergenic
938072669 2:128316877-128316899 GTGTGCCTGGGGAGCCTGGAAGG - Intronic
939090973 2:137780023-137780045 CTGTGGATAGGCACCCAGGAGGG - Intergenic
939637260 2:144597493-144597515 ATGTAGACAGGGAGGCAGGATGG + Intergenic
942177879 2:173352366-173352388 ATGAGGATAGAGAGACAGGATGG + Intergenic
942324609 2:174765417-174765439 ATGTGGGAAGGAGGCCTGGAAGG - Intergenic
944474778 2:200092488-200092510 GTGGGGATAGGGAGGATGGAGGG + Intergenic
946104999 2:217361295-217361317 ACTTGGCTGGGGAGCCTGGAGGG + Intronic
946239814 2:218346579-218346601 AAGTGCAGAGGTAGCCTGGAGGG - Exonic
946920365 2:224574635-224574657 ACGTTTACAGGGAGCCTGGAGGG - Intronic
948292897 2:236840620-236840642 AAGTGGAGTTGGAGCCTGGATGG + Intergenic
948906732 2:240983213-240983235 ATGGGGAAACTGAGCCTGGAGGG + Intronic
1170803876 20:19612941-19612963 AGGTGGCCAGGGAGACTGGAGGG - Intronic
1172425253 20:34851532-34851554 AAATGGGTAGGGTGCCTGGATGG + Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1175300529 20:57939803-57939825 ATGTGGACAGGGAAAGTGGAGGG - Intergenic
1176161140 20:63649449-63649471 CTGTGGAGAGGTGGCCTGGATGG - Intronic
1176279145 20:64290807-64290829 GTGTGCATAGTGGGCCTGGAGGG + Intergenic
1179282356 21:39944810-39944832 AAGTGCATAGGGAGCTTGGAGGG + Intergenic
1179314308 21:40227915-40227937 ATGTAGAATGGGATCCTGGATGG - Intronic
1180810591 22:18758249-18758271 ATGTGGAAAGGGATCCAGTAAGG - Intergenic
1181669668 22:24420284-24420306 CTGAGGATCTGGAGCCTGGATGG + Intronic
1182277534 22:29200170-29200192 AGGGGGACAGGGAGACTGGAAGG + Intergenic
1183899029 22:40991275-40991297 TTTGGGACAGGGAGCCTGGAAGG - Intergenic
1184251184 22:43261240-43261262 GTGTGGAGACGGGGCCTGGATGG + Intronic
1184438453 22:44494694-44494716 GTGTGGACAGGGAGCGTGGCCGG + Exonic
1184445106 22:44542515-44542537 ATGGGGAGATGGAGCCTGGCAGG + Intergenic
949276645 3:2291181-2291203 ATGTAGTTAGGTAGGCTGGAAGG - Intronic
949996146 3:9618973-9618995 ATGTAGAGAGGAAGCCTTGATGG - Intergenic
952002983 3:28808605-28808627 ATGTGGATAGGGAGCCAGAAGGG + Intergenic
952003335 3:28810853-28810875 AGGTGGATAGGGAGCCAGGAGGG + Intergenic
952757057 3:36878886-36878908 ATCTGGATAGGGAGGCTGCTGGG + Intronic
954699818 3:52445357-52445379 AAGTGGGGAGAGAGCCTGGAAGG + Intergenic
955760724 3:62278939-62278961 ATTTGTATGGGGAGGCTGGAGGG + Intronic
955769160 3:62372167-62372189 ATGGGGATAGGGAGCCGGGTGGG + Exonic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
963530662 3:146469820-146469842 ATGGGGAGAGGGAGACGGGACGG - Intronic
963839723 3:150093103-150093125 AAGTGGGGAGGGAGCGTGGAAGG + Intergenic
964746732 3:160019581-160019603 AACTGCATAAGGAGCCTGGAAGG - Intronic
968371314 3:198224117-198224139 GTGTGCATAGTGGGCCTGGAGGG + Intergenic
968612142 4:1562150-1562172 AGGTGGAGAGGGAGCGCGGAAGG - Intergenic
969204040 4:5629030-5629052 AGGTGGAAAGGGAGCGTGCATGG - Intronic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
971968630 4:33593990-33594012 ATGTGGATTGGGGGCCAGGAAGG - Intergenic
973044505 4:45519332-45519354 AGATGGATAGGGAGCCAGAAGGG + Intergenic
974023102 4:56709050-56709072 ATGTGGATTGTGAGCCAGGGTGG + Intergenic
974186522 4:58454455-58454477 AGATGGATAGGGAGCTGGGAGGG + Intergenic
976300306 4:83509920-83509942 ATTTGGAGAGGCAGCCTAGAGGG + Intronic
977564112 4:98564156-98564178 ATTTGGATTGGGAGTCTAGAAGG - Intronic
977959381 4:103068478-103068500 ATGTAGATACAGTGCCTGGAAGG + Intronic
977993460 4:103473816-103473838 ATGGGGATTGGAAGCCTGTAGGG - Intergenic
978137455 4:105280269-105280291 ATGGGGAGAGGAGGCCTGGAAGG + Intergenic
978607198 4:110493696-110493718 AAGTGGGTAGGGAGCCAGGAGGG - Intronic
979328377 4:119404037-119404059 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
980731640 4:136832053-136832075 AGGTGGATGGGGAGCCAGAAGGG + Intergenic
981988921 4:150892330-150892352 ATTTGGAGAGGGAGCCTCTAAGG + Intronic
985854855 5:2416800-2416822 AGGTGGATAGGGAACCAGAAGGG - Intergenic
987005708 5:13707259-13707281 AGGTGGATGGGGAGCCAGAAGGG - Intronic
987594678 5:19981835-19981857 ATTTGGCTAGGAAGCCTGGGAGG - Intronic
988528251 5:32005043-32005065 ATGTGGATGAGGACCTTGGATGG - Intronic
992386791 5:76292334-76292356 AAGGGGATAGGGAGTGTGGAGGG - Intronic
993143911 5:84070112-84070134 AGGTGGATGGGGAGCCAGGAGGG - Intronic
995555541 5:113324497-113324519 ATGGGCATAGGGATACTGGAAGG - Intronic
996611459 5:125385375-125385397 ATGTGGAAAGGGGGCCTCAAAGG + Intergenic
997136330 5:131330143-131330165 ATTTGGCTAGGAAGGCTGGAAGG + Intronic
997453333 5:134000696-134000718 ATGGAGAAAGAGAGCCTGGATGG + Intronic
997633750 5:135389710-135389732 ATGGGGATTGGGAGCAAGGAAGG - Intronic
998825084 5:146093274-146093296 AGGTGGATAGAGAGCAAGGATGG + Intronic
1000752460 5:165113876-165113898 AGGTGGAAGGGGAGCCTGGAGGG - Intergenic
1001949499 5:175806307-175806329 AAGTGGATAGTGAGGCAGGAAGG - Intronic
1002602211 5:180360501-180360523 AGGTGGGTAGGAAGCCTGTAAGG + Intergenic
1002730552 5:181329663-181329685 GTGTGCATAGTGGGCCTGGAGGG + Intergenic
1002753976 6:144441-144463 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
1006260943 6:32869944-32869966 AAGTGAATAGGGAGTCAGGATGG + Intergenic
1006321881 6:33323975-33323997 TTGTGTTTAGGGAGGCTGGAGGG + Intronic
1006425573 6:33960879-33960901 ATGTGGGGAGGGAGACAGGAGGG - Intergenic
1007122193 6:39391566-39391588 TTCTGGATTGGGGGCCTGGAGGG + Intronic
1007582179 6:42966221-42966243 AGGTGGCCAGGGGGCCTGGAAGG - Exonic
1007614537 6:43172218-43172240 ATGTGCAAAGGGAGCCCGGGAGG + Intronic
1007743214 6:44025321-44025343 TTGTGGATACGCAGCCTGGGAGG + Intergenic
1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG + Intronic
1012017624 6:93871765-93871787 ATGTGGAGAAGGAGCCAAGATGG - Intergenic
1012398282 6:98824505-98824527 AAGTGGAGAGGGAGCGTGGGAGG + Intergenic
1014009557 6:116460510-116460532 ATCTGGATATGGAGCTTGGGTGG - Intergenic
1014281779 6:119449477-119449499 ATGTAGAGAGGCAGCCTAGAAGG + Intergenic
1018026246 6:159808618-159808640 AAGTGGAAAGGGAGCTTGAAGGG - Intronic
1018430286 6:163716611-163716633 AGGAGGGTGGGGAGCCTGGACGG - Intergenic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057965 6:169236476-169236498 ATGTGGAGAGTGAGTGTGGATGG - Intronic
1021088422 7:16451701-16451723 ATGTTGAAAGGGACCTTGGAGGG + Intergenic
1022992763 7:35724916-35724938 AGGTGGATGGGGAGCCAGAAGGG - Intergenic
1023635792 7:42208853-42208875 ATGAGTATAGGAAGCCTGGTGGG + Intronic
1024075700 7:45816835-45816857 GTGTGCATAGTGGGCCTGGAGGG + Intergenic
1024512659 7:50215759-50215781 ATGTGAATGGGGAGTCTGGGAGG - Intergenic
1024647899 7:51384471-51384493 GTGTGTATAGTGGGCCTGGAGGG - Intergenic
1025051747 7:55738962-55738984 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
1025128706 7:56364629-56364651 GTGTGCATAGTGGGCCTGGAGGG - Intergenic
1026580633 7:71613546-71613568 ATGAGCATAGAGAGCTTGGAGGG + Intronic
1028154196 7:87410797-87410819 CAGAGGATAGGGAGGCTGGAAGG + Intronic
1028173662 7:87628695-87628717 ATGTAGGAAAGGAGCCTGGAGGG - Exonic
1028851522 7:95543339-95543361 GTGTAGGTAGGGAGCCAGGAAGG - Intergenic
1029614915 7:101650233-101650255 ACCTGGCTAGGGAGCCAGGAGGG + Intergenic
1031223761 7:119007828-119007850 ATCTGGATAGGGTGCAGGGATGG + Intergenic
1031765643 7:125773364-125773386 AGATGGATAGGGAGCCAGCAGGG - Intergenic
1032052228 7:128656583-128656605 GTGTGCATAGTGGGCCTGGAGGG + Intergenic
1034630069 7:152523951-152523973 ACGTGGCGAGGGAGCCTGGGGGG - Intergenic
1035589291 8:800958-800980 AGGTGGATGGGGACCCAGGAAGG - Intergenic
1037741454 8:21612357-21612379 ATGCAGAAAGGAAGCCTGGAGGG - Intergenic
1037799285 8:22023852-22023874 CTGGGGATAGGGAGCCTAGGGGG + Intergenic
1037856204 8:22372231-22372253 ATGTGAATACGGAGCCTAGTAGG - Intronic
1040926625 8:52690835-52690857 ATGTGGAGAGAGAGCATGTATGG - Intronic
1041600431 8:59711295-59711317 ATGTGGAGATGGAGCCTTTAAGG + Intergenic
1042526360 8:69768742-69768764 ATGTGGAGAGGGAGCCCTTAGGG - Intronic
1043996063 8:86817972-86817994 ATGTGGATAAGAAGCAGGGAAGG + Intergenic
1045477923 8:102569059-102569081 AGATGTAAAGGGAGCCTGGAAGG - Intergenic
1045942501 8:107755347-107755369 ATGTGGCCAGGGCGGCTGGAGGG + Intergenic
1047586522 8:126279696-126279718 AGGTGGATGGGGAGCCAGAAGGG - Intergenic
1049002948 8:139837737-139837759 ATCTGGGTTGGGTGCCTGGAAGG - Intronic
1049440040 8:142605218-142605240 ATGGGGAGAGGGAGTCTGGCTGG + Intergenic
1050231460 9:3529926-3529948 GTGGGGATAGGGAGGCTTGAGGG - Intergenic
1050491956 9:6197665-6197687 AGGTGGAGAGTGGGCCTGGAGGG - Intergenic
1052075804 9:24138602-24138624 ATGGGGAAGGGTAGCCTGGAAGG + Intergenic
1054956091 9:70911980-70912002 ATGAGGATTGAGGGCCTGGAAGG + Intronic
1055505084 9:76939794-76939816 ATGTGGGTGGGGAGCCTGATGGG + Intergenic
1056871908 9:90289632-90289654 AGGTGGATGGGGAGCCAGAAGGG - Intergenic
1058699991 9:107591990-107592012 ATGTAGATAGGGGCCCTGGACGG + Intergenic
1059093659 9:111389258-111389280 ATGTGGATAGGGACTGTTGATGG - Intronic
1059867537 9:118532953-118532975 ATGTGGGTAAGGTGCCTGGTGGG + Intergenic
1062109524 9:134774296-134774318 ATGTGGAAAGGGGGCTGGGAGGG + Intronic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1062754963 9:138282173-138282195 GTGTGCATAGTGGGCCTGGAGGG + Intergenic
1203578871 Un_KI270745v1:26342-26364 GTGTGCATAGTGGGCCTGGAGGG + Intergenic
1185746614 X:2578441-2578463 ATGTGGATTTGGAGCTAGGAGGG - Intergenic
1186173185 X:6899055-6899077 ATGTGGTTAAAGAGACTGGAGGG - Intergenic
1186641781 X:11463247-11463269 GTGTGGAGAGGGAGGATGGAGGG + Intronic
1186941299 X:14510481-14510503 AGGTGGAGAGGGAATCTGGAGGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187261218 X:17686786-17686808 ATCTGGATAGTGTGTCTGGAGGG + Intronic
1187371938 X:18716592-18716614 ATGGGGATGGAGAGCCGGGAGGG - Intronic
1187483404 X:19679124-19679146 AAGTTGTTAGGGAGGCTGGAAGG - Intronic
1188348686 X:29100333-29100355 ATGTGGACAGGCAGCCTTTATGG + Intronic
1189469619 X:41303585-41303607 AATTGGATGGGGAGGCTGGAGGG - Intergenic
1190766671 X:53480965-53480987 AGGTGGATAGGGAGGCCAGAAGG - Intergenic
1191075163 X:56445144-56445166 ATGTGTCTAGGGAGGATGGAAGG + Intergenic
1193808483 X:86022710-86022732 ATGTGTATAAGGAGCCTGAGTGG - Intronic
1194501017 X:94680823-94680845 ATGTGGAGGTGGAGCCTGGTGGG + Intergenic
1194834396 X:98663339-98663361 AAGTGGAAAGGGACACTGGAAGG + Intergenic
1194956691 X:100189521-100189543 ATGTTGGCAGGGAGCCAGGATGG - Intergenic
1195235696 X:102896056-102896078 CTTTGGAAAGGGAACCTGGATGG - Intergenic
1196998216 X:121407500-121407522 AGGTGGATAGGGAGCCAGAAGGG - Intergenic
1198541442 X:137644255-137644277 GTGTGGCCAGGCAGCCTGGATGG - Intergenic
1198883410 X:141306534-141306556 AGGTGGATGGGGAGCCAGAAAGG - Intergenic
1200710124 Y:6475867-6475889 ATATGGATGGGGAGCCAGAATGG + Intergenic
1201023991 Y:9688841-9688863 ATATGGATGGGGAGCCAGAATGG - Intergenic
1201339819 Y:12922720-12922742 AGATGGATAGGGAGCCAGAAAGG + Intergenic