ID: 1130144528

View in Genome Browser
Species Human (GRCh38)
Location 15:81263785-81263807
Sequence AAGGGTGACCTGTGACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 159}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130144528_1130144533 5 Left 1130144528 15:81263785-81263807 CCTTCAAGTCACAGGTCACCCTT 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1130144533 15:81263813-81263835 GCTGTGGATGGAGAGAATGCAGG 0: 1
1: 0
2: 1
3: 44
4: 381
1130144528_1130144536 14 Left 1130144528 15:81263785-81263807 CCTTCAAGTCACAGGTCACCCTT 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1130144536 15:81263822-81263844 GGAGAGAATGCAGGGAGACTGGG 0: 1
1: 0
2: 3
3: 41
4: 566
1130144528_1130144535 13 Left 1130144528 15:81263785-81263807 CCTTCAAGTCACAGGTCACCCTT 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1130144535 15:81263821-81263843 TGGAGAGAATGCAGGGAGACTGG 0: 1
1: 0
2: 3
3: 174
4: 1027
1130144528_1130144538 24 Left 1130144528 15:81263785-81263807 CCTTCAAGTCACAGGTCACCCTT 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1130144538 15:81263832-81263854 CAGGGAGACTGGGATTCTGGAGG 0: 1
1: 0
2: 4
3: 38
4: 373
1130144528_1130144530 -7 Left 1130144528 15:81263785-81263807 CCTTCAAGTCACAGGTCACCCTT 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1130144530 15:81263801-81263823 CACCCTTGCACTGCTGTGGATGG 0: 1
1: 0
2: 1
3: 18
4: 151
1130144528_1130144534 6 Left 1130144528 15:81263785-81263807 CCTTCAAGTCACAGGTCACCCTT 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1130144534 15:81263814-81263836 CTGTGGATGGAGAGAATGCAGGG 0: 1
1: 0
2: 0
3: 26
4: 433
1130144528_1130144539 30 Left 1130144528 15:81263785-81263807 CCTTCAAGTCACAGGTCACCCTT 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1130144539 15:81263838-81263860 GACTGGGATTCTGGAGGCTGAGG 0: 1
1: 0
2: 2
3: 49
4: 502
1130144528_1130144537 21 Left 1130144528 15:81263785-81263807 CCTTCAAGTCACAGGTCACCCTT 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1130144537 15:81263829-81263851 ATGCAGGGAGACTGGGATTCTGG 0: 1
1: 0
2: 2
3: 24
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130144528 Original CRISPR AAGGGTGACCTGTGACTTGA AGG (reversed) Intronic
910432496 1:87172895-87172917 ATGGGGGACCTGTGAGATGAGGG + Intergenic
912510610 1:110187758-110187780 AAGGGTGACTTATGCCTGGAAGG - Intronic
917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG + Intergenic
917733322 1:177897857-177897879 AGGAGGGATCTGTGACTTGAAGG - Intergenic
918249110 1:182685753-182685775 AATGGTGACCTGTCCCCTGAGGG - Intergenic
923544589 1:234914871-234914893 ACGTGTGAGCTGAGACTTGAAGG + Intergenic
923746089 1:236701464-236701486 AAGTGAGCCCTGTGACTGGAGGG + Intronic
1063191271 10:3697050-3697072 AAGGGTGCCCTGTGCCTTCATGG + Intergenic
1066854468 10:40181843-40181865 AAGGTTAAACTGTGAGTTGAAGG - Intergenic
1066876380 10:40616860-40616882 AAGGTTAAACTGTGAGTTGAAGG - Intergenic
1066880122 10:40691558-40691580 AAGGTTAAACTGTGAGTTGAAGG - Intergenic
1066889797 10:40881709-40881731 AAGGTTAAACTGTGAGTTGAAGG - Intergenic
1066911073 10:41300605-41300627 AAGGTTAAACTGTGAGTTGAAGG - Intergenic
1066916766 10:41412023-41412045 AAGGTTAAACTGTGAGTTGAAGG - Intergenic
1066916817 10:41413042-41413064 AAGGTTAAACTGTGAGTTGAAGG - Intergenic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1074471770 10:113733737-113733759 AAAGGTGACCTATGGCTTGAGGG - Intergenic
1076576997 10:131475964-131475986 GAGGGTGACGTGTGACCTCAGGG + Intergenic
1076577008 10:131476018-131476040 GAGGGTGACGTGTGACCTCAGGG + Intergenic
1076947449 10:133660832-133660854 AATGGTGACCTGAGAGTTGAGGG - Intergenic
1080997868 11:37626317-37626339 AAGGGAGATATGTGACTAGAAGG - Intergenic
1085340100 11:75725796-75725818 AAGGCTGGCCTCTGACCTGAGGG + Intronic
1085760750 11:79239118-79239140 ATGTTTCACCTGTGACTTGATGG - Intronic
1091204281 11:133808965-133808987 AAGAGTGACTTTTGACCTGATGG + Intergenic
1091219384 11:133920983-133921005 AGGGGTGAGCTGGGACTTCAGGG + Exonic
1092080885 12:5715283-5715305 AAGGGTGAGCTGTGGCTTTATGG - Intronic
1095288871 12:40451308-40451330 AAGCATGGTCTGTGACTTGAAGG - Intronic
1097007662 12:55930997-55931019 AGGGGAGACCTCTGACTAGAAGG - Exonic
1101059465 12:100955771-100955793 AGAGGTGACCTGGGACTTAAAGG + Intronic
1101253313 12:102955827-102955849 CATGGTAACCTGTGGCTTGATGG - Intronic
1102704508 12:114869578-114869600 CAGGGTGTCCTGTGGCTTGAAGG - Intergenic
1102949491 12:117020760-117020782 GAGGGTGAGCTGCGACTTCAGGG - Intronic
1102966295 12:117130306-117130328 AAGGGTGTCCTGTCACAGGAAGG + Intergenic
1104503842 12:129311765-129311787 AGTGGTGGCCTGTGCCTTGAAGG - Intronic
1104781094 12:131421025-131421047 AAGGGTGACCAGGGACCTGGTGG + Intergenic
1105736216 13:23274334-23274356 AAGGCAGAACTGTGAGTTGAGGG - Intronic
1106337256 13:28795652-28795674 AAGGGTGAGATGTGCCTGGAGGG + Intergenic
1112377572 13:98857614-98857636 AAGGAAGACCTGTGACATCAAGG + Intronic
1113178070 13:107589513-107589535 AACAGTTATCTGTGACTTGAGGG + Intronic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1114188842 14:20425395-20425417 AGAGGAGACCTCTGACTTGAAGG - Intergenic
1116681832 14:47981563-47981585 CAGGATCACCTGTGACTTGGAGG + Intergenic
1116970244 14:51056854-51056876 AACAGTGACCTTTGATTTGAGGG - Intronic
1117308451 14:54498779-54498801 GAGGGTGACTTGTGAGGTGACGG - Intergenic
1118843724 14:69530437-69530459 AAGGATGAACTTTGAATTGAAGG + Exonic
1119049044 14:71348050-71348072 TAGGGTGACCTGTGGCTTGCAGG + Intronic
1121896014 14:97648536-97648558 AAGGGTGACCTGAGATGGGAGGG - Intergenic
1128096322 15:64959162-64959184 GAGGGGGAGCTGTGACCTGAGGG + Intergenic
1128762827 15:70229491-70229513 CAGTGTGACCTGTGCCTAGAGGG + Intergenic
1129115815 15:73364799-73364821 AAGGGTGGGCTGTGCTTTGAGGG - Intronic
1129546771 15:76404005-76404027 ATGGGTCACGTGTGACTTCAGGG + Intronic
1130144528 15:81263785-81263807 AAGGGTGACCTGTGACTTGAAGG - Intronic
1131731098 15:95282210-95282232 AAGGGTGAGTTGGGACTTAAGGG + Intergenic
1134450568 16:14360841-14360863 GAGGGTGAGATGTGACTTAAGGG + Intergenic
1138116092 16:54361857-54361879 AAGGGTGTCCTGTGTATTGTAGG + Intergenic
1138191475 16:55017292-55017314 AGCTCTGACCTGTGACTTGAGGG + Intergenic
1141036254 16:80628923-80628945 ATGGGTGAACTGAGACCTGAAGG + Intronic
1144238927 17:13290220-13290242 CAGGGTGACATGTGACTGGAGGG + Intergenic
1145875602 17:28316791-28316813 AAGGCTGACCTGAGACTTGGGGG + Intergenic
1147555173 17:41474160-41474182 AAGGATGACCAGATACTTGAAGG + Intergenic
1148825808 17:50393153-50393175 ATGGGGTACCTCTGACTTGAGGG - Intronic
1150386948 17:64769399-64769421 AGGGGTGACTTTTGAGTTGATGG + Intergenic
1152278916 17:79373743-79373765 CAGGGTGGCCCGTGACTTGCTGG - Intronic
1152876558 17:82789820-82789842 AGGTGTGACCTGGGACTTGCGGG - Intronic
1203171347 17_GL000205v2_random:149830-149852 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1157091814 18:44645090-44645112 CAGGGAGAGCTGAGACTTGATGG + Intergenic
1158756020 18:60326554-60326576 AAGGATGACAAGAGACTTGACGG - Intergenic
1161453180 19:4357844-4357866 AGGGCTGACCTCTGACTTCAGGG - Intronic
1161625368 19:5323497-5323519 AAAAGTGACCTGAGACGTGAAGG + Intronic
1163704456 19:18804221-18804243 AAGAGTGGCCTGTGACTTCCAGG + Intergenic
1164156672 19:22601565-22601587 AACGGTGACCTGGGAGTAGAGGG + Intergenic
1167780533 19:51595935-51595957 AAGTTTGAGCTGAGACTTGAAGG + Intergenic
925994137 2:9278196-9278218 AAGGGTGACTTGTGACTGGAGGG - Intronic
925998406 2:9310694-9310716 GAGGGTGACCTGTGAACTGAAGG + Intronic
928321088 2:30283427-30283449 AAGAGTGAGCTGTGATTTGTAGG + Intronic
932755779 2:74408324-74408346 AGTGTTGACCAGTGACTTGAGGG + Intergenic
934171486 2:89544274-89544296 AAGGGTGACATGAGACAGGAAGG + Intergenic
934281795 2:91618592-91618614 AAGGGTGACATGAGACAGGAAGG + Intergenic
936896612 2:117434835-117434857 AGAGATGACCTGTGACTTGTAGG + Intergenic
937049249 2:118875208-118875230 AAGGGTGAGCTGGGACTAAAGGG + Intergenic
937739454 2:125333188-125333210 AAGGGAAACCACTGACTTGAAGG + Intergenic
939589060 2:144041642-144041664 AAATGTGTCCTGTGACTTCAAGG + Intronic
942641110 2:178061357-178061379 TAGGGTGACCTGTGCATTGTAGG - Intronic
943734865 2:191343023-191343045 AAGGGTGTCCTGTGCATTGTAGG + Intronic
943753718 2:191536731-191536753 AAGGGTGATCTGTTACATGGTGG + Intergenic
943845077 2:192635033-192635055 AAGGGAAACCTGTGTCTTGAAGG + Intergenic
945845078 2:214934668-214934690 AAGGATGAGCTGTCATTTGAAGG - Intronic
945961235 2:216136958-216136980 TAGGGTGCCCCCTGACTTGAAGG - Intronic
947760502 2:232600376-232600398 CATGTTGACCTGTGTCTTGAGGG - Intergenic
1169975335 20:11319420-11319442 GAGGGTCAAGTGTGACTTGAAGG + Intergenic
1170951543 20:20940660-20940682 AATGGTTACCTTTGACTGGAAGG - Intergenic
1174128816 20:48327611-48327633 AAGGGTGATGTGTGGCTGGAGGG - Intergenic
1176327331 21:5511658-5511680 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176330378 21:5544573-5544595 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176397379 21:6276378-6276400 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176400426 21:6309293-6309315 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176436731 21:6679811-6679833 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176439778 21:6712726-6712748 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176460993 21:7006881-7006903 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176464040 21:7039795-7039817 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1176484554 21:7388659-7388681 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1176487601 21:7421574-7421596 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1178734148 21:35133716-35133738 AAGGATGACCTCTGACCTTAGGG - Intronic
1180559510 22:16603283-16603305 AAGGGTGCGCTGGGACGTGAAGG + Intergenic
1182090957 22:27594489-27594511 AAGGGGGACATGTTACTGGATGG + Intergenic
1183649380 22:39145455-39145477 AAGGGTGTCCTGGGACTTGCGGG - Intronic
1184731868 22:46375036-46375058 AAGGGTGACCTGCGAGGTGGGGG + Intronic
950347706 3:12313094-12313116 AAAGGAGACCTGTCACTTTAAGG + Intronic
952661664 3:35857699-35857721 AAGTTTGAACTTTGACTTGAGGG - Intergenic
953836666 3:46352074-46352096 AAGTAAGACCTGAGACTTGAAGG - Intergenic
953915674 3:46919359-46919381 AAGTCTGACCTTTGCCTTGAGGG - Intergenic
955991033 3:64627580-64627602 AAGGATGACCTTTGACAGGAAGG + Intronic
957260429 3:77895455-77895477 AAGAGTGACCTGTATCTTTAAGG + Intergenic
963485188 3:145927009-145927031 AAGGGAGACCTGAGAGTAGATGG + Intergenic
963882593 3:150545863-150545885 AGGGGAGACCTGTGAGGTGAGGG - Intronic
965856086 3:173089581-173089603 AAGGGGAGCCTGTGACTTGAGGG + Intronic
966749390 3:183307498-183307520 GTGGATGACCTGTGACTTGCAGG - Intronic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968878576 4:3286973-3286995 GATGGTGATCTGGGACTTGATGG + Intergenic
969489244 4:7489914-7489936 AAGGGTGTCCTGTGGCTAGGCGG + Intronic
969538017 4:7768627-7768649 AAAGGTGAACAGTGACTGGAAGG - Intronic
976016386 4:80560216-80560238 AAGGGAAACCTCTGCCTTGAAGG + Intronic
979963622 4:127050940-127050962 ATGGTTCACCTGAGACTTGAAGG - Intergenic
983406403 4:167336260-167336282 AAGGGAGACCAGTGAGTAGAAGG - Intergenic
985338043 4:188916926-188916948 AATGGTCACCTGAGACTTCAGGG + Intergenic
985414388 4:189721598-189721620 AAGGCTGTCCTGTGCCTTGTAGG - Intergenic
985450904 4:190061632-190061654 AATGGTGACCTGAGAGTTGAGGG - Intergenic
985864391 5:2502986-2503008 AAGGCATACCTGTGACTTGGGGG - Intergenic
985889707 5:2705934-2705956 AAGTGTGAGCTGTGACGGGAGGG + Intergenic
986466005 5:8025142-8025164 AAGGGTGCCGTGTGCCTTGTTGG - Intergenic
988157411 5:27473057-27473079 AAGTGTGACCTGTAACCTCATGG + Intergenic
997678187 5:135730825-135730847 AAAGGTGACATGTGCCTAGAAGG + Intergenic
997835618 5:137190734-137190756 AAATGTGACATGTGACCTGAAGG - Intronic
1000055031 5:157598182-157598204 AAGGGGGATTTGTGACTAGAAGG - Intergenic
1003375692 6:5575011-5575033 AAGGGTGAGCTGTGTGTTGTTGG + Intronic
1004800601 6:19142822-19142844 AAGGGGGAACTGTGACTTTGGGG + Intergenic
1005848509 6:29801265-29801287 GAGGGTTACCTGTGCCTTCAGGG - Intergenic
1005926336 6:30448573-30448595 AAGGGTGACCTGTGTCCTTGGGG + Intergenic
1006792747 6:36714466-36714488 AAGGCTGATCTGTGTCTTGCAGG - Intronic
1012179777 6:96138908-96138930 AAGGGTGATCTCTGCCTTGCTGG - Intronic
1013962234 6:115914234-115914256 AGGGGAGACTTGTGAGTTGAGGG - Intergenic
1014486638 6:122007352-122007374 AAGGCTGACTTCCGACTTGAAGG + Intergenic
1015253824 6:131155705-131155727 AAAGGTGACCTGTGAGTTTTTGG + Intronic
1018916959 6:168138939-168138961 AAGGGTGACCTCTCACTGGTTGG - Intergenic
1019447467 7:1078869-1078891 AAGGCTGAGCTGGGGCTTGAGGG - Intronic
1019783383 7:2958120-2958142 GATGGTGACCTGAGACTTGGCGG - Intronic
1021200418 7:17722877-17722899 GAGGGTGACCTGTGATTTTCAGG - Intergenic
1023742938 7:43296854-43296876 AAGTCTGACCTGTGCCTTCAAGG + Intronic
1024220835 7:47285172-47285194 CAGGGTGACTTGTGAGTTGCTGG + Intronic
1034617726 7:152434538-152434560 AAGGGTGCGCTGGGACGTGAAGG - Intronic
1035685436 8:1520453-1520475 AAGCGTGACCCCTGACGTGAAGG - Intronic
1036185156 8:6616251-6616273 AAGGGTGAGCTCTGCCTAGAGGG + Intronic
1037890355 8:22620897-22620919 AAGGGTGCCCTTTGTCTTGCTGG + Exonic
1039275129 8:35926699-35926721 TAGGGTGACTTGTATCTTGAAGG + Intergenic
1043388640 8:79770175-79770197 AAGGGTGGCCTGTCACTTTGGGG - Intergenic
1047880366 8:129186240-129186262 AAGGGTGGCCGGTGACTCAAGGG - Intergenic
1048830359 8:138470779-138470801 TAGTGTGACCAGTGTCTTGAGGG - Intronic
1049527682 8:143136607-143136629 AGGGGTGCCGTGTGACTTTATGG - Intergenic
1050334877 9:4581201-4581223 AAGGATGGCTTGTGACTTGGAGG - Intronic
1056742166 9:89266867-89266889 AATGGTAACCTGTGAGGTGATGG - Intergenic
1058098578 9:100891840-100891862 AAGCTTGACCTGTGATTTGGGGG - Intergenic
1059432818 9:114260155-114260177 AAGGGAGCCCAGTGAGTTGAAGG - Intronic
1061593822 9:131615796-131615818 GAGCTTGAACTGTGACTTGAAGG - Intronic
1061772945 9:132941073-132941095 GAGAGTGACCTGTGAGTTGTAGG + Intronic
1203431717 Un_GL000195v1:95753-95775 AATGGTGACCTGAGAGTTGCGGG - Intergenic
1203434782 Un_GL000195v1:128848-128870 AATGGTGACCTGAGAGTTGCGGG + Intergenic
1187963629 X:24589495-24589517 AAGGCTGACCTGTGACTTTCTGG + Intronic
1189250934 X:39600289-39600311 CAGGGTCCCCTGTGACTTGCAGG - Intergenic
1190861871 X:54353028-54353050 AATGGTCACCTGGGACTTGGAGG + Intronic
1193173009 X:78358291-78358313 AAGGGAGACCACTGACCTGAAGG - Intergenic
1196523811 X:116707539-116707561 AAGGGAGACCAGTGCCTTGAAGG - Intergenic
1199156112 X:144550922-144550944 AAGGGAGACCCATGCCTTGAAGG + Intergenic
1199260508 X:145768087-145768109 AAGGGAAACCTTTGACTTGGTGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1201562039 Y:15328138-15328160 AAGGGGACACTGTGACTTGATGG - Intergenic