ID: 1130146956

View in Genome Browser
Species Human (GRCh38)
Location 15:81281656-81281678
Sequence ATGGAAGCCCAGGATTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130146956_1130146959 -6 Left 1130146956 15:81281656-81281678 CCCTCATAATCCTGGGCTTCCAT 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1130146959 15:81281673-81281695 TTCCATAGCCCTCCCTGCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130146956 Original CRISPR ATGGAAGCCCAGGATTATGA GGG (reversed) Intronic
901156521 1:7143240-7143262 CTGTTAGCCCAGGATTCTGAGGG - Intronic
906188437 1:43879841-43879863 ATGGAAGGACAGGAGTATGATGG - Intronic
906636825 1:47415866-47415888 ATGGAAGGCCAGGAGAAGGATGG + Intergenic
910494225 1:87808545-87808567 ATGCAAGCCCTGGATCATGAAGG + Intergenic
918632943 1:186740509-186740531 AGGAAAGCCCAAGATTATGAAGG - Intergenic
920663005 1:207934035-207934057 ATTGAAGCCAAGCATTGTGATGG + Intergenic
920740935 1:208580737-208580759 ATGGAAGAGCAGGGTTTTGAAGG - Intergenic
921296892 1:213712600-213712622 ATGGCAGCCCAGTTTTATGTTGG + Intergenic
922130071 1:222768968-222768990 ATCTAAGCCCTGAATTATGAGGG - Intergenic
923908946 1:238417835-238417857 AGAGAATCCCAGGATTATTAAGG + Intergenic
1063434830 10:6021347-6021369 ATGGAAGCCCAGGGAGATCAAGG + Intronic
1064003204 10:11680620-11680642 TAGGAAGCCCAGCATTATAAAGG - Intergenic
1067517393 10:46963419-46963441 ATGGAAGCCCAGAGATAGGAAGG + Intronic
1067644855 10:48088410-48088432 ATGGAAGCCCAGAGATAGGAAGG - Intergenic
1068587492 10:58815562-58815584 ATAGAAGTTCAGGATTAAGATGG + Intronic
1068667094 10:59688297-59688319 ATGGAAGCCCAGGCAAATGATGG - Intronic
1071487898 10:86114859-86114881 ATGGAAATGCAGGTTTATGATGG - Intronic
1071666176 10:87561014-87561036 ATGGAAGCCGAGAATTATAGAGG - Intergenic
1072909689 10:99488675-99488697 AAGGGAGCCCCTGATTATGAAGG + Intergenic
1073336079 10:102710291-102710313 ATGGGATCACAGGATTATCAGGG + Intronic
1074250072 10:111736202-111736224 ATGGAAGCCCAAGAAGATTAAGG - Intergenic
1074764887 10:116693178-116693200 ATGCAAGGCCAGCATTATCAGGG + Intronic
1080112485 11:28583745-28583767 AGGGAAACCCAGGATTTTGAGGG - Intergenic
1083433902 11:62629857-62629879 AAGGATGCCCAGCATTATGGGGG - Exonic
1084252070 11:67907579-67907601 AGGGGAGCCCAGGATTTTGAGGG - Intergenic
1084894842 11:72258558-72258580 ATGGAATCCTAGGGTTGTGAGGG + Intergenic
1085096481 11:73764685-73764707 ATTGAAGCCCAGGAGTATGTAGG + Intergenic
1085850731 11:80116706-80116728 ATTGGTGACCAGGATTATGATGG + Intergenic
1086547226 11:88012056-88012078 ATGGCAGGCCAGGATTAAGGTGG - Intergenic
1086766964 11:90707512-90707534 ATGGAATCCCAAGTTTATAATGG + Intergenic
1087275424 11:96156117-96156139 ATGGAAGCCCTGGGTTACGGAGG - Intronic
1088723641 11:112616091-112616113 CTGAAAGACCAGGATGATGAAGG - Intergenic
1090248865 11:125237100-125237122 ATCAAAGCCCAGAATGATGAGGG - Intronic
1090272083 11:125393881-125393903 ATGGACTCTCAGGATTATGTAGG - Intronic
1090354785 11:126132855-126132877 AGGGAAGGCCAGGATTCTCAGGG + Intergenic
1091114058 11:132997254-132997276 ATGGAAGCACAGGATTAGATAGG + Intronic
1092299760 12:7235680-7235702 ATGTAAGACCAGGATTTTGGAGG + Intergenic
1092651752 12:10642206-10642228 ATGGCAGCCCTGGAATCTGATGG + Intronic
1093089267 12:14903528-14903550 AGGGGAGCCCAGGAGCATGAGGG + Intronic
1093186321 12:16023248-16023270 AGGGAAGCCCAGAATAAAGAGGG + Intronic
1096038432 12:48493090-48493112 TTGGAAGCACAGGCTTCTGAAGG - Intronic
1097031869 12:56095623-56095645 ATGCAAACCCAGGATAATGTTGG + Intronic
1098308660 12:69126146-69126168 ATGGAAGCACAGAATTTTGCAGG + Intergenic
1101049548 12:100847050-100847072 ATGGAGGCCCAGGATGCTAAGGG - Intronic
1101747293 12:107552659-107552681 ATCGAAGCCCAGAGTGATGAGGG + Intronic
1102070187 12:110012488-110012510 ATGGGAGCCCAGGATGATGCAGG + Intronic
1103278454 12:119733797-119733819 AGGGAAGACCAGGATTAAAATGG + Intronic
1103946276 12:124528446-124528468 ATGGAAGCCCAGGAATGGGCTGG - Intronic
1105997543 13:25686796-25686818 CTGAATGCCCAGGATTCTGATGG + Intronic
1110889663 13:80682840-80682862 ATGAAAGCCCAGAATAATCAGGG + Intergenic
1111320670 13:86624335-86624357 CTGGCAGCCCAGGGTTAGGATGG + Intergenic
1112017861 13:95346275-95346297 AAGAAAACCAAGGATTATGAAGG - Intergenic
1119405000 14:74393010-74393032 AAGGGAGCTCAGGCTTATGAAGG - Intergenic
1122240717 14:100365036-100365058 GTGGGAGCCCAGGAGTTTGAGGG + Intronic
1124872014 15:33552813-33552835 ATGGAAGCCCAGGAAAATCAGGG - Intronic
1126918053 15:53487809-53487831 ATTGAAGCCCATTATTATTAAGG - Intergenic
1127359631 15:58233655-58233677 ATGGAATCCCAGTATTCTAATGG + Intronic
1130146956 15:81281656-81281678 ATGGAAGCCCAGGATTATGAGGG - Intronic
1138893990 16:61180799-61180821 AAGGAAGCCCTGGACTGTGAAGG - Intergenic
1139045610 16:63055626-63055648 ATGTAAGTCTAGGATTATAAGGG - Intergenic
1141279063 16:82614180-82614202 ATAGAAGCCCAGGAACAGGATGG - Intergenic
1145199071 17:20924100-20924122 AAGGAAGCCCATTCTTATGATGG - Intergenic
1147354066 17:39877566-39877588 AGTGAAGCACAGGATTTTGAGGG - Intronic
1148110454 17:45142010-45142032 AGGGAAACCCAAGATGATGAAGG - Intronic
1148748408 17:49931144-49931166 GTGCCAGCCCAGGATGATGATGG - Intergenic
1149439630 17:56663670-56663692 CTGGATGCCCAGGAGAATGACGG + Intergenic
1153092961 18:1369408-1369430 ATGAAAGCACAGGATTTTGGAGG + Intergenic
1154949663 18:21196815-21196837 CTGGAAGCATAGGATTGTGATGG - Intergenic
1155170264 18:23261893-23261915 ATGGAAGCCCCAGCTTATGATGG - Intronic
1155635695 18:27952590-27952612 AGGGAGGCCAAGGCTTATGAAGG + Intronic
1156985189 18:43342434-43342456 TTGGAATTCAAGGATTATGATGG - Intergenic
1157486388 18:48090325-48090347 TTGGAACCCCAGGATTAGGCAGG - Intronic
1158504395 18:58033277-58033299 ATGGTAGCCCAGGATAAACATGG + Intergenic
1158799732 18:60892235-60892257 AGGGAAGTCCAGGAGTCTGAAGG + Intergenic
1159629430 18:70732372-70732394 TTGGCAGCCCAGGATGAGGATGG + Intergenic
1159683794 18:71390713-71390735 ATGAAAGCCCTGGGTTATGCCGG + Intergenic
1160051683 18:75439650-75439672 ATTTGAGCCCAGGTTTATGATGG - Intergenic
1161657129 19:5523234-5523256 ATGGAAGCCTGGGAATAGGATGG - Intergenic
1164856360 19:31527652-31527674 AGGGAAGCCCAGGATGAGGCAGG + Intergenic
1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG + Intronic
1166346070 19:42166726-42166748 ATACAGGCCCAGGATGATGATGG + Intronic
925377936 2:3401394-3401416 AGGGAGGCCCAGGAGCATGAAGG - Intronic
925526192 2:4805024-4805046 ATGTAGGCCTAGGATTATAAAGG - Intergenic
927163024 2:20287584-20287606 ATTAAAGCACAGGACTATGAAGG + Intronic
927521421 2:23700956-23700978 ATGGAAGCTCAGGAGTGTGCTGG - Intronic
928424855 2:31169441-31169463 ATGCAAGCCCAGGCTTAAAATGG + Intergenic
929916636 2:46142191-46142213 AGGGAAGCCCAGGGCCATGATGG - Intronic
929934427 2:46284321-46284343 AAGGAAGCCCTGGATTGAGAAGG + Intergenic
932774936 2:74522708-74522730 CTGGCAGCCCTGGATGATGATGG - Exonic
933831354 2:86212205-86212227 ATGTCAGGCCAGGATTATTAGGG + Exonic
934713563 2:96530571-96530593 CTGGAAGCCCAGGCTTTTGGGGG - Intergenic
934742236 2:96732734-96732756 ATGAAAGCCCAGCATTTTGTTGG - Intronic
935185982 2:100733359-100733381 CTGCAAGCACAGGATTGTGAGGG + Intergenic
935509913 2:103958919-103958941 AAGGAAGTCCAGGATTATTTTGG + Intergenic
937811224 2:126201367-126201389 GTGCAAGCCCAGGGTTGTGATGG - Intergenic
937936412 2:127249194-127249216 CTGGAATGCCAGGATTCTGAGGG + Intergenic
938320220 2:130357257-130357279 GTGCAAGCCCAGCATTAGGAAGG + Intronic
939850340 2:147296731-147296753 ATTAAAGCTCAGGGTTATGAAGG - Intergenic
940566795 2:155374143-155374165 GTTGAATCCCAGGATGATGATGG + Intergenic
940645154 2:156384102-156384124 ATAGAATTCCAGGATCATGATGG + Intergenic
941464668 2:165812030-165812052 GTGAAAGCTCAGGATTATGAAGG + Intergenic
941658829 2:168173453-168173475 ATGGAAGAACAGGATTAACAAGG + Intronic
945289021 2:208109779-208109801 ATGGAAGTTCAAGATCATGAAGG + Intergenic
947374191 2:229479201-229479223 GAGGAAACCGAGGATTATGAAGG + Intronic
1169917168 20:10695170-10695192 ATGGAACAACAGGATTATGTGGG + Intergenic
1170238677 20:14137350-14137372 ATGGAAGTGCAGCATTATAAAGG + Intronic
1174313552 20:49678828-49678850 ATGGAAGCCAAGGATCTTCAAGG - Intronic
1177061959 21:16387000-16387022 AAGGTAGCACAGAATTATGAAGG - Intergenic
1178927270 21:36786490-36786512 ATTAAAGCCCAGGATTTTGATGG - Intronic
1180324901 22:11361576-11361598 ATGGAAGACCAGCATTGTGTCGG - Intergenic
1181349943 22:22247717-22247739 ATGGAATCCCAGAATCATGAAGG - Intergenic
1185133678 22:49056166-49056188 TGGGAAGCCCAGGATCATCACGG - Intergenic
949410647 3:3760237-3760259 ATGCCATCCCAGGATTATAAAGG - Intronic
952987325 3:38797869-38797891 ATGGTAGCCCAGAATAATTATGG - Intergenic
953033146 3:39190926-39190948 AGGGGAGCCCAGGCTAATGAAGG - Intronic
953425283 3:42791308-42791330 AAGTAATCCCAGGATCATGAAGG + Intronic
953683557 3:45058602-45058624 ATTGACTCCCATGATTATGAAGG + Intergenic
954632582 3:52055449-52055471 CTGGAAGGCCAGGATCAGGAAGG - Intronic
956005185 3:64771145-64771167 CTGCAAGCCCAGGAGTTTGAGGG - Intergenic
956430381 3:69180353-69180375 ATGCAAGCCTGGGATTATGCAGG - Intronic
956445352 3:69320833-69320855 ATGGAACCCCAGGAATTCGAAGG + Intronic
960870299 3:122241997-122242019 ATGTATGCCCAGGTTTTTGAGGG - Intronic
961241798 3:125417641-125417663 ATGAAACCCTAGGATTATGCAGG - Intergenic
964469422 3:157036664-157036686 AGGGAATCCCAGGATAATGGTGG + Intronic
964707034 3:159629981-159630003 AGGGAAGGCTGGGATTATGAGGG + Intronic
965322247 3:167264959-167264981 ATGGGAGCCCAGTATCCTGAAGG - Intronic
969687881 4:8686374-8686396 ATGGAGGCACAGGGTTGTGAAGG + Intergenic
970377989 4:15478623-15478645 ATAGAAGCCCAGGGTCAAGATGG + Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
978677439 4:111336836-111336858 ATAGAAGTCTAGGATTTTGAAGG + Intergenic
980480673 4:133383532-133383554 AGGGAAGTCTGGGATTATGAAGG + Intergenic
983479254 4:168253311-168253333 ATCCAAGCCCAGGGTCATGAAGG - Intronic
983525840 4:168759709-168759731 GTGCAGGTCCAGGATTATGAGGG + Intronic
983526112 4:168761852-168761874 GTGCAGGTCCAGGATTATGAGGG - Intronic
985689009 5:1296566-1296588 ATGGAAGCAGAAGATTATGCTGG + Intergenic
986048795 5:4067409-4067431 ATGGAAACATAGGATTTTGAGGG + Intergenic
986434404 5:7714370-7714392 ATGGAACCCCAGTATTACGTGGG + Intronic
986861109 5:11927658-11927680 ATGGAAGCCCAGGAGCACCAGGG + Intergenic
988601016 5:32639501-32639523 AGTGAAGCCCAGGAAGATGAAGG - Intergenic
989840927 5:46068049-46068071 ATTGAAGCCTAAGATAATGAAGG + Intergenic
991725824 5:69535014-69535036 TTGGAAGACCAGGATGAGGAGGG + Intronic
991869130 5:71092841-71092863 TTGGAAGACCAGGATGAGGAGGG - Intergenic
993530039 5:89013125-89013147 ATGGGAGCCCAGGCTTTTGTAGG + Intergenic
994332872 5:98527734-98527756 ATGGAATTCCAGGCTTAGGAAGG - Intergenic
995341793 5:111069383-111069405 CTGGAAGCCTAGGAAAATGAAGG + Intergenic
998867643 5:146521378-146521400 CTGGGAGCCCAGGATCATAAAGG + Intergenic
1001730205 5:173948254-173948276 ATGGATGCCAAGGCTCATGAAGG + Intronic
1002027459 5:176405138-176405160 ATGGGAGCCCAGGAAGGTGAGGG - Intronic
1003794075 6:9580491-9580513 ATGGAATCCCAGGGTTAGAAAGG + Intergenic
1005230541 6:23697041-23697063 ATGCAAGTCCAGGATTTTTAAGG - Intergenic
1007898735 6:45390154-45390176 ATGGAAGCCAAAGAATCTGAAGG - Intronic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1013626224 6:111940020-111940042 TGGGAAGCCCAGGACTCTGATGG - Intergenic
1013851675 6:114523495-114523517 ATGGAAGCATAGAATTATGAAGG + Intergenic
1014157902 6:118133297-118133319 ATGTAATCCCAGGGCTATGAAGG + Intronic
1015684661 6:135846597-135846619 ATGGAAGTCCAAGAATAAGATGG + Intergenic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1023727926 7:43163584-43163606 ATGGAAGACCAGGAGCATGAGGG - Intronic
1027593581 7:80144388-80144410 ATAGAACTCCAGGATTATAACGG + Intronic
1030216489 7:107048322-107048344 CTTGAAGCCCAGGATGATCAGGG + Intronic
1037452178 8:19026248-19026270 ATGAAAGCCTAAGAATATGACGG - Intronic
1037655340 8:20878379-20878401 ATGGAACCCTAGGATTAGAAAGG - Intergenic
1038902487 8:31859333-31859355 ATGGAAAAACAAGATTATGATGG - Intronic
1042431325 8:68710087-68710109 AAAGAAGCTCAGGATTAAGATGG + Intronic
1044218765 8:89645489-89645511 ATGGAAGCCCAGAGTGATGAAGG - Intergenic
1048265407 8:132981061-132981083 ATGGAAGCTGAGGATTCTCAGGG + Intronic
1049680163 8:143914644-143914666 ATGGAATCCCCGGAGTGTGATGG + Intergenic
1051534066 9:18137149-18137171 ATAGTAGCCCAGGTTTCTGAGGG + Intergenic
1051591871 9:18784411-18784433 TTGGATGCCCACGATTAGGAGGG + Intronic
1052680815 9:31690111-31690133 ATTGAAACCCAGTATTGTGAGGG + Intergenic
1053604541 9:39643714-39643736 ATGAAAGCCATAGATTATGATGG + Intergenic
1054249002 9:62698700-62698722 ATGAAAGCCATAGATTATGATGG - Intergenic
1054563112 9:66733233-66733255 ATGAAAGCCATAGATTATGATGG - Intergenic
1055637938 9:78296561-78296583 TTGGAAGCGCAGGATGAAGAAGG - Intergenic
1057528104 9:95820247-95820269 ATGCAAGCCCAGCCTTATAATGG + Intergenic
1058094710 9:100846558-100846580 ATGGAAGGCCAAGATTCTTAAGG + Intergenic
1060519946 9:124288622-124288644 ATACCAGCCCAGGATTATCAGGG - Intronic
1062255685 9:135619676-135619698 CTCGGAGCCCAGGATTCTGAAGG + Intergenic
1203631973 Un_KI270750v1:79100-79122 CTGGAAGCCCAGGAATGTAAGGG - Intergenic
1189604952 X:42667299-42667321 ATGGAAGCACATGATTCAGAGGG + Intergenic
1189667172 X:43367942-43367964 AGGGAAGCCCAAGGTTAAGAGGG + Intergenic
1190394226 X:49963558-49963580 ATGTAAGGCCAGAATTAAGAAGG - Intronic
1194906983 X:99589910-99589932 AAGGAAGCGGAGGGTTATGAAGG + Intergenic
1195302420 X:103543761-103543783 ATGTAAGCCCTGGATTTGGAGGG + Intergenic
1196619629 X:117807241-117807263 AGGGAAGCCCAGCACTATAAAGG + Intergenic
1197133838 X:123037830-123037852 AGGGAGGCGCAAGATTATGATGG - Intergenic
1198985265 X:142444418-142444440 ATAAAAGCCCTGGCTTATGATGG - Intergenic
1199777159 X:151022248-151022270 ATTGACTCACAGGATTATGAAGG - Intergenic
1200696751 Y:6367729-6367751 ATGAAATCCCAAGACTATGAAGG + Intergenic
1200701726 Y:6408177-6408199 ATGAAATCCCAGGATGATGGAGG + Intergenic
1200933536 Y:8718702-8718724 ATGAAATCCCAAGATGATGAAGG + Intergenic
1200981226 Y:9264847-9264869 ATGAAATCCCAAGATGATGAAGG + Intergenic
1201032385 Y:9756521-9756543 ATGAAATCCCAGGATGATGGAGG - Intergenic
1201037362 Y:9796970-9796992 ATGAAATCCCAAGACTATGAAGG - Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic