ID: 1130148212

View in Genome Browser
Species Human (GRCh38)
Location 15:81291730-81291752
Sequence TAATGGGGAGGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4605
Summary {0: 1, 1: 2, 2: 45, 3: 505, 4: 4052}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130148194_1130148212 25 Left 1130148194 15:81291682-81291704 CCCTAGTGCTGGAAACTAGGGTA 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG 0: 1
1: 2
2: 45
3: 505
4: 4052
1130148195_1130148212 24 Left 1130148195 15:81291683-81291705 CCTAGTGCTGGAAACTAGGGTAG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG 0: 1
1: 2
2: 45
3: 505
4: 4052

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130148212 Original CRISPR TAATGGGGAGGGAGGGAGGA AGG Intronic
Too many off-targets to display for this crispr