ID: 1130148256

View in Genome Browser
Species Human (GRCh38)
Location 15:81292028-81292050
Sequence CAGGGTAGACAGAGGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1520
Summary {0: 1, 1: 0, 2: 18, 3: 164, 4: 1337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130148243_1130148256 14 Left 1130148243 15:81291991-81292013 CCTGGGGTTCACTACCTGTGGCA 0: 1
1: 0
2: 0
3: 4
4: 128
Right 1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG 0: 1
1: 0
2: 18
3: 164
4: 1337
1130148249_1130148256 0 Left 1130148249 15:81292005-81292027 CCTGTGGCAGGGAGGGGAGCAGG 0: 1
1: 0
2: 9
3: 109
4: 809
Right 1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG 0: 1
1: 0
2: 18
3: 164
4: 1337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130148256 Original CRISPR CAGGGTAGACAGAGGGAGGA CGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900167114 1:1248237-1248259 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167197 1:1248500-1248522 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167580 1:1249622-1249644 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900293917 1:1939229-1939251 GGGGGGAGAGAGAGGGAGGATGG + Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900658277 1:3770834-3770856 GAGGGAAGACAGAGGATGGAGGG + Intronic
900701238 1:4049781-4049803 AGGGGGAGAAAGAGGGAGGAAGG + Intergenic
900863044 1:5246367-5246389 AAGGATAGAGGGAGGGAGGAAGG - Intergenic
901078428 1:6569996-6570018 CAGGGAGGAGAGAGGGAGGGAGG + Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901144098 1:7053625-7053647 CAGAGTGGAGTGAGGGAGGAAGG - Intronic
901175909 1:7298900-7298922 AAGGGAAGAGAGAGGAAGGAAGG - Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902210234 1:14899702-14899724 AGTGGTGGACAGAGGGAGGAGGG - Intronic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902513088 1:16976640-16976662 CAGGGTTGACAGGGTGGGGAGGG + Intronic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
903004779 1:20291536-20291558 GAAGGTTGAGAGAGGGAGGAAGG - Intronic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
903562444 1:24238033-24238055 CAGGGTAGAAATTGGGAGGCTGG - Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905797509 1:40823934-40823956 CAGGGTGGACAGTGGGAGACTGG - Intronic
905875218 1:41427881-41427903 GCGGGGAGAGAGAGGGAGGAGGG - Intergenic
905937864 1:41839172-41839194 CAGGGTCCACAGAGGAGGGAAGG + Intronic
906449644 1:45934061-45934083 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906916594 1:50017732-50017754 TAGGGTAGAGAGGGGCAGGAGGG + Intronic
907949317 1:59166003-59166025 GAGGGTAGAGGGTGGGAGGAAGG - Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908013716 1:59810119-59810141 GAGGGAAGAAAGAGGGAGAAAGG - Intergenic
908114171 1:60924918-60924940 AAGGGCAGAGAGAGAGAGGACGG - Intronic
908267593 1:62394637-62394659 TAGTGTAGACAATGGGAGGAAGG + Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908434928 1:64096380-64096402 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
908811762 1:67988639-67988661 GAGGGTAGAGTGTGGGAGGAGGG - Intergenic
909005056 1:70265911-70265933 AAGGAAAGAGAGAGGGAGGAAGG + Intronic
909156402 1:72083301-72083323 AAGGGAGGAGAGAGGGAGGATGG - Intronic
909169154 1:72272253-72272275 CAGAGTAGAGATGGGGAGGAAGG - Intronic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
909216479 1:72897242-72897264 CAAAGTAGATAGTGGGAGGAGGG - Intergenic
909296364 1:73954286-73954308 GACGGGAGACAGAGGAAGGAAGG - Intergenic
909469299 1:76008822-76008844 GTGGGAAGAGAGAGGGAGGAAGG - Intergenic
910108964 1:83661581-83661603 GAGGGCAGAGAGAGTGAGGACGG - Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910634800 1:89395189-89395211 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
910736295 1:90461592-90461614 GAGGGCAGAGGGAGGGAGGAGGG - Intergenic
910741041 1:90516846-90516868 CATGATAGAGAAAGGGAGGACGG + Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911121283 1:94299742-94299764 TAAGGGAGCCAGAGGGAGGAAGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911571531 1:99523351-99523373 CAGGGTGGAGGGTGGGAGGAAGG - Intergenic
911990214 1:104686653-104686675 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
912084867 1:105987022-105987044 GAGGGTACACGGTGGGAGGAGGG - Intergenic
912248793 1:107989771-107989793 AAGGGTAGACAGTGGGAGAAGGG + Intergenic
912274110 1:108238705-108238727 CAGCCTAGACAGAGCTAGGAGGG + Intronic
912287157 1:108381157-108381179 CAGCCTAGACAGAGCTAGGAGGG - Intronic
912294109 1:108455618-108455640 CAGCCTAGACAGAGCTAGGAGGG - Intronic
912326077 1:108764027-108764049 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
912374837 1:109201589-109201611 GAGGGCGGAAAGAGGGAGGAGGG + Intronic
912890978 1:113530446-113530468 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914381140 1:147117544-147117566 CAGCCTAGACAGAGGTATGAGGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
915049490 1:153052895-153052917 CAGGGAAGACAAAGAGAGAAAGG + Intergenic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915507115 1:156364855-156364877 CAGGGTAGGAAGAGACAGGATGG - Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915737416 1:158093854-158093876 CAGGGAAGACCGACTGAGGAAGG - Intronic
915818302 1:158993675-158993697 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
916276081 1:162994753-162994775 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
916303492 1:163302598-163302620 CAAGGGAGCCAGAGGTAGGAGGG - Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
916720768 1:167483409-167483431 CAGGGTAGGGAGGGGGAGGGAGG - Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917041242 1:170808474-170808496 CAGAGGAGAGACAGGGAGGAGGG + Intergenic
917051077 1:170924222-170924244 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917258237 1:173139631-173139653 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
917306076 1:173626936-173626958 AAGGAAAGAAAGAGGGAGGAGGG + Intronic
917539566 1:175899694-175899716 TAAAGGAGACAGAGGGAGGATGG + Intergenic
917585214 1:176419266-176419288 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918204341 1:182295900-182295922 CAAGAGAGACAGAGGAAGGAAGG - Intergenic
918256540 1:182753785-182753807 GAGGGTAGAGGGTGGGAGGAAGG + Intergenic
918290150 1:183099587-183099609 GGGGGCAGCCAGAGGGAGGAAGG - Intronic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
918735755 1:188061020-188061042 GAGGGAAGAGAGAGGGAAGACGG - Intergenic
919015222 1:192024894-192024916 GAGGGTGGAGAGAGGAAGGAGGG - Intergenic
919327431 1:196126432-196126454 GAGGGTAGAGAGTGGAAGGAGGG - Intergenic
919424915 1:197417837-197417859 AAGGATAGAAAGAGGGAAGAAGG + Intronic
920116364 1:203624502-203624524 GAGGGAAGAGGGAGGGAGGAAGG + Intergenic
920440761 1:205979092-205979114 GAGGGGAGACACAGGGAAGAAGG - Intronic
920775834 1:208936227-208936249 GGGGGTAGACAGCGGGGGGAGGG + Intergenic
921012362 1:211155102-211155124 GAGGGTAGAGAGCGGGAGGAGGG - Intergenic
921589546 1:216987617-216987639 TAGGGTAGACAGTGGTAGAAAGG - Intronic
921598744 1:217084155-217084177 CAGGAAAGAAAGAGGAAGGAAGG + Intronic
922071532 1:222199308-222199330 GAGGGTAGAGAGTCGGAGGAGGG - Intergenic
922163535 1:223096320-223096342 GAGGGTAGAAGGTGGGAGGAAGG - Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922527913 1:226320264-226320286 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
922661642 1:227435498-227435520 CACGATAGAAAGAGGGTGGATGG + Intergenic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
1063269961 10:4497292-4497314 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1063561807 10:7135191-7135213 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1063691884 10:8295568-8295590 AAGGGGAGAGAGAGGAAGGAAGG - Intergenic
1063732049 10:8708795-8708817 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1063736853 10:8766782-8766804 AAGTGAAGACGGAGGGAGGAAGG - Intergenic
1064102361 10:12474739-12474761 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064504703 10:16015825-16015847 GAAGGGAGAGAGAGGGAGGATGG + Intergenic
1065221584 10:23501431-23501453 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1065275050 10:24077330-24077352 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1065726149 10:28669394-28669416 CAGCGAAGAGAGTGGGAGGAGGG - Intergenic
1065827688 10:29586891-29586913 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1068054183 10:51990710-51990732 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1068101380 10:52558526-52558548 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1068573683 10:58659558-58659580 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1068830720 10:61491584-61491606 GAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1068832603 10:61514530-61514552 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069845743 10:71369966-71369988 CTGGGTAGACAGGGTAAGGAGGG + Intergenic
1069934153 10:71903738-71903760 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1069964381 10:72101985-72102007 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1070109334 10:73467804-73467826 CAGGGCTGGTAGAGGGAGGAAGG + Intronic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071040384 10:81301811-81301833 GAGGGTAGAGAGTGAGAGGAGGG - Intergenic
1071099172 10:82014830-82014852 CAGGCTAGAAAGAGGAAGGGAGG + Intronic
1071160687 10:82742109-82742131 CAGACGAGAGAGAGGGAGGAAGG - Intronic
1071268965 10:83989755-83989777 GAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1071418981 10:85470065-85470087 CAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072815773 10:98507657-98507679 AAGGATAGAGAGGGGGAGGACGG - Intronic
1072839796 10:98759184-98759206 GAGGGTAGAGTGTGGGAGGAGGG + Intronic
1073223999 10:101901016-101901038 CATGCTAGACTGAGGAAGGAGGG + Intronic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073319022 10:102602763-102602785 CCGGGAAGGCAGTGGGAGGAGGG - Intronic
1073624204 10:105079714-105079736 GAGGGTGGAGAGTGGGAGGAAGG - Intronic
1073876343 10:107926451-107926473 GAGGGTGGACGGTGGGAGGAGGG + Intergenic
1073989239 10:109244036-109244058 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1074979369 10:118607588-118607610 GAGGGTGGACAGGGAGAGGAGGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075344213 10:121670414-121670436 GAGGGAGGACAGTGGGAGGATGG + Intergenic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075840549 10:125498717-125498739 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1075962426 10:126580880-126580902 ATGGGTAGAGGGAGGGAGGATGG - Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077159513 11:1106311-1106333 GATGGTAGACAGATGGTGGATGG - Intergenic
1077159524 11:1106357-1106379 GATGGTAGACAGATGGTGGATGG - Intergenic
1077163264 11:1123143-1123165 AAGGAAAGACGGAGGGAGGAAGG - Intergenic
1077274622 11:1698287-1698309 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077344059 11:2038315-2038337 GAGGGTAGAGAGTGGGAGGGAGG + Intergenic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1077756177 11:5030190-5030212 AAAGGTAGAGTGAGGGAGGAGGG - Intergenic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1078385737 11:10890923-10890945 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079601425 11:22316346-22316368 CAGGGGAGAGAGAGAGAGGCGGG - Intergenic
1079601533 11:22316748-22316770 CAGGGGAGAGAGAGAGAGGCAGG - Intergenic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080050224 11:27851919-27851941 GAGGGAAGAAAGAGGGAGGGAGG - Intergenic
1080257022 11:30301886-30301908 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1080414860 11:32060213-32060235 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1080721410 11:34852764-34852786 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1080765149 11:35289164-35289186 CAGGGAGGACAGAGGGAGTGGGG - Intronic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1081024677 11:37996151-37996173 GAGGGTGGAGAGTGGGAGGAAGG - Intergenic
1081190153 11:40094207-40094229 CAGTGTAGCCAGTGGAAGGAAGG + Intergenic
1081489488 11:43556550-43556572 GAGGGTAGAGGGAGGGAGGGAGG - Intronic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081896063 11:46587657-46587679 AAGGGCTGACAGAGGGAAGAAGG - Intronic
1082257614 11:50049911-50049933 GAGGGTAGAGAGTGGAAGGAGGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082677877 11:56130909-56130931 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083370853 11:62179288-62179310 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1084345356 11:68543606-68543628 CAGGGAAGACTGGGGCAGGAGGG - Intronic
1084627968 11:70323426-70323448 GAGGCTGGACAGAGGTAGGAAGG + Intronic
1084958971 11:72706269-72706291 CTGGGTAGAAAGATGAAGGAGGG - Intronic
1085806692 11:79643157-79643179 TAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1085914227 11:80865509-80865531 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1086017741 11:82187443-82187465 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1086114239 11:83230387-83230409 TAGGGGAGTCAGAGGGAGGTAGG - Intronic
1086510309 11:87550171-87550193 GAGGGTGGACAGTGGGAGAAGGG - Intergenic
1086537246 11:87862508-87862530 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1087095591 11:94314459-94314481 CCGGGTAGAAAGAGGATGGAAGG + Intergenic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087815033 11:102648921-102648943 GAGGGTAGAAAGTGGGAGAAGGG - Intergenic
1087978092 11:104575408-104575430 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1088182905 11:107132285-107132307 CAGGGAAGAAAGAGGAGGGAGGG + Intergenic
1088339984 11:108753520-108753542 CACGATGGACAGAGGGAGAACGG - Intronic
1088341427 11:108772371-108772393 CAGGGAAGACAGAGACAGAAGGG + Intronic
1088424552 11:109688287-109688309 TAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1088539657 11:110900693-110900715 CAAAGTAGACAGAGGAAAGAAGG - Intergenic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1089282631 11:117385115-117385137 CAGGGAAGAAAGAGAGCGGAGGG - Intronic
1089420435 11:118329107-118329129 CAGGGTGGAGGGTGGGAGGAGGG + Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090465230 11:126927672-126927694 GGTGGAAGACAGAGGGAGGAGGG - Intronic
1090591428 11:128274352-128274374 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1090742674 11:129679737-129679759 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1202827045 11_KI270721v1_random:93504-93526 GAGGGTAGAGAGTGGGAGGGAGG + Intergenic
1091729668 12:2871048-2871070 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1092265628 12:6978285-6978307 CTGGGAAGACAGTGGAAGGAAGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092692684 12:11131186-11131208 CATGGAAGAGAGAGAGAGGAGGG - Intronic
1092724391 12:11470798-11470820 GAGGGTGGACGGTGGGAGGAGGG + Intronic
1093142323 12:15523665-15523687 CTTGGTAGACTGAGGCAGGAGGG + Intronic
1093167175 12:15817503-15817525 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1093263096 12:16965173-16965195 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1093447632 12:19278796-19278818 CGGGGTGGAGAGAGGGAGAAAGG - Intronic
1093686026 12:22054869-22054891 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1094615134 12:32029577-32029599 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1095136392 12:38609619-38609641 GAGGGTTGAGAGTGGGAGGAGGG + Intergenic
1095836386 12:46643882-46643904 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1096216118 12:49798341-49798363 CTGGGCAGAGAGAGGTAGGAGGG - Exonic
1096252379 12:50041363-50041385 CAGGCCTGACAGAGTGAGGAGGG + Intergenic
1096406438 12:51347313-51347335 GAGGGTAGATGGAGGGTGGAGGG + Intergenic
1096445229 12:51683993-51684015 CAGGGCAGAGGGAGGGAGGTGGG + Intronic
1096800127 12:54105055-54105077 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1096924541 12:55128958-55128980 CAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1097338140 12:58407650-58407672 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1097583486 12:61486892-61486914 GAGGGTAGAGAGTGGGGGGAGGG + Intergenic
1097974531 12:65670424-65670446 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098327138 12:69314991-69315013 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1098562432 12:71889782-71889804 GAGGGTGGAAAGTGGGAGGAGGG - Intronic
1098981223 12:76958396-76958418 TAGGGTCCACAGAGTGAGGAAGG - Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099617170 12:84950802-84950824 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1099680112 12:85816154-85816176 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1099805723 12:87516496-87516518 GAGGGTGGATAGTGGGAGGAAGG + Intergenic
1099991658 12:89728882-89728904 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1100103428 12:91138639-91138661 AATGGGAGACAGAGGGAGTAAGG + Intergenic
1100337941 12:93650168-93650190 CAGGGTAGCGGGAGGGAGGGAGG - Intergenic
1100563130 12:95769074-95769096 CAGGGAAGAAAGAGAGCGGAAGG + Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101177877 12:102174967-102174989 GAGGGAAGAGACAGGGAGGAAGG - Intronic
1101327554 12:103729198-103729220 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1102133439 12:110552452-110552474 CAGGGTAGAAGGAGAGGGGATGG - Intronic
1102312547 12:111858004-111858026 CTGGGTAGGCTGAGGTAGGAGGG - Intronic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1102537890 12:113594960-113594982 GAAGGTGGACAGTGGGAGGAGGG - Intergenic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1102796741 12:115695495-115695517 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103047927 12:117753662-117753684 GAGGGTAGACGGTGGGAGGAGGG + Intronic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103389577 12:120562139-120562161 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1103572779 12:121856289-121856311 CTGGGTGGACTGAGAGAGGAAGG - Intronic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1103741868 12:123096566-123096588 GAAGGAAGAAAGAGGGAGGAAGG + Intronic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104547658 12:129726654-129726676 GACGGTAGACAGAGGGGTGAGGG + Intronic
1104814476 12:131637830-131637852 TGGGGCAGTCAGAGGGAGGAGGG + Intergenic
1105273948 13:18904052-18904074 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1105683345 13:22752267-22752289 GAGGGTAGAGAGGGGAAGGAGGG - Intergenic
1105707450 13:22977066-22977088 TGGGGTAGACGGAGGGAAGATGG + Intergenic
1105887713 13:24656452-24656474 GAGGGGAGAGAGAGGAAGGAGGG - Intergenic
1106115771 13:26816316-26816338 CAGAGTAGCCAGAGGCAGAAGGG + Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106363578 13:29055511-29055533 GAGGGTAGAAGGTGGGAGGAGGG - Intronic
1106442063 13:29784226-29784248 CGGGAAAGAAAGAGGGAGGATGG + Intronic
1106602485 13:31199944-31199966 CGGCGGAGACGGAGGGAGGAGGG + Exonic
1106728865 13:32517848-32517870 CAGGGGAGACAGAGGTGGGGAGG - Exonic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107573439 13:41688822-41688844 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1107655417 13:42588282-42588304 CAGGGGAGACCCAGGGAAGAAGG + Intronic
1107892930 13:44930196-44930218 CAGGTTAGAAAGTGGGAGGAGGG - Intergenic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108946861 13:56037346-56037368 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109200057 13:59420379-59420401 CAGAGTTGACAGAGGTAGAAGGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1109642862 13:65213098-65213120 AAGGATGGAAAGAGGGAGGAAGG + Intergenic
1109716166 13:66225359-66225381 CAAGGCAGAGAGAGGGTGGAGGG - Intergenic
1109901607 13:68780208-68780230 GAGGGTGGACAGTGGGAGCAGGG + Intergenic
1110442721 13:75543175-75543197 GAGGGTAGAGAGTGGGAGGAAGG + Intronic
1110523324 13:76506240-76506262 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1110811548 13:79816799-79816821 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111359608 13:87158756-87158778 TGGGGTAGAGAGTGGGAGGAGGG + Intergenic
1111394437 13:87646739-87646761 CAGGGAAGACAGTGGGTGAAGGG + Intergenic
1111446196 13:88348129-88348151 GAGGGAAGAAGGAGGGAGGAAGG + Intergenic
1111524525 13:89451571-89451593 TGGGGTAGACAGTGGGAGAAAGG + Intergenic
1111892380 13:94099960-94099982 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112446763 13:99471581-99471603 GAGGGAAGGAAGAGGGAGGAAGG + Intergenic
1113107731 13:106789565-106789587 CAGGGTAGAGAGTGACAGGAAGG - Intergenic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114698055 14:24645884-24645906 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1114791912 14:25669051-25669073 AATGGTTGAAAGAGGGAGGAAGG - Intergenic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115708168 14:36019567-36019589 TATGGTACTCAGAGGGAGGATGG + Intergenic
1115713629 14:36077409-36077431 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1115940556 14:38603746-38603768 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1116252937 14:42509987-42510009 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1116412982 14:44647599-44647621 CAGGGTAGTCATAGGGGAGATGG - Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116648348 14:47559231-47559253 GATGGTAGAGGGAGGGAGGAGGG - Intronic
1116816613 14:49590035-49590057 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117019764 14:51557806-51557828 GAAGGTCGAGAGAGGGAGGAGGG + Intronic
1117043105 14:51785959-51785981 GAGGGTAGAAGGTGGGAGGATGG - Intergenic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118073398 14:62271120-62271142 GAGGATGGAGAGAGGGAGGATGG - Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1118355249 14:65008402-65008424 CAGGGAAGCCAGAGTGAGCAAGG + Intronic
1118426196 14:65665930-65665952 GAGGGTGGACAATGGGAGGAGGG + Intronic
1118536037 14:66765610-66765632 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1118665915 14:68069428-68069450 AAGGGTGGAGAGTGGGAGGATGG - Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1119611347 14:76065493-76065515 CAAGGGAGAGAGAGGAAGGATGG - Intronic
1119714261 14:76847537-76847559 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1119858739 14:77921597-77921619 CAGCATAGACAGAGACAGGAGGG - Intronic
1120517857 14:85491420-85491442 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1120543741 14:85783988-85784010 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1120677908 14:87443410-87443432 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120960458 14:90120057-90120079 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121620512 14:95344580-95344602 CAGGGTGGAAACAGGAAGGAGGG + Intergenic
1121729165 14:96174334-96174356 GGTTGTAGACAGAGGGAGGAAGG + Intergenic
1121837816 14:97107679-97107701 GAGGGTGGAGTGAGGGAGGAGGG + Intergenic
1121933563 14:97995771-97995793 TGGAGTAGAGAGAGGGAGGATGG - Intergenic
1121991871 14:98565826-98565848 CATGGAAGACAGTGGAAGGAAGG - Intergenic
1122171051 14:99876130-99876152 CAGAGGAGACAGAGAGGGGAAGG + Intronic
1122221007 14:100239139-100239161 GAAGGAAGGCAGAGGGAGGAAGG - Exonic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1123419237 15:20118056-20118078 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1123446628 15:20335443-20335465 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1123528459 15:21124599-21124621 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1123814007 15:23958093-23958115 CAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1124012793 15:25852206-25852228 GAGGGAGGATAGAGGGAGGATGG - Intronic
1125135532 15:36336957-36336979 CAGGGGAGAAAGAGGTAGGCTGG - Intergenic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125210728 15:37212316-37212338 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1126233924 15:46359742-46359764 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1126371952 15:47956641-47956663 GAGGGTGGAAAGTGGGAGGAAGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127404385 15:58625974-58625996 CAGGGTAGCAGGGGGGAGGAAGG + Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128690534 15:69721436-69721458 AAGGGGAGACAGAGAGAGGGAGG - Intergenic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1128827683 15:70735193-70735215 GAGGGCAGACAGAGGGATGGGGG + Intronic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129604452 15:77018030-77018052 CAGGGGAGATGGAGGCAGGAGGG + Intronic
1129681796 15:77662342-77662364 AAGGGCGGTCAGAGGGAGGAAGG + Intronic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1129901669 15:79156361-79156383 GAGGGGAGACAGAGAGATGAGGG - Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130029374 15:80297777-80297799 GAGGGAAGACAGAGAGAGGGAGG + Intergenic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130170682 15:81509818-81509840 CAAGTTAGACAGAGGGTGGGAGG - Intergenic
1130800333 15:87255932-87255954 CAGGGTAGAAAGAGGGGAAAAGG + Intergenic
1130909170 15:88259141-88259163 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1130939851 15:88498315-88498337 CAGGGTTGAAGGAGTGAGGAGGG + Intergenic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131692129 15:94838586-94838608 CAGGGTAGAGAGAGAGAGGTGGG + Intergenic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133087125 16:3373545-3373567 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1133103942 16:3494881-3494903 CAGAGGAGACAGCGGGAGGGTGG + Intronic
1133342714 16:5047137-5047159 AGGGGGAGACAGAGAGAGGAAGG - Intronic
1133589574 16:7229640-7229662 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589602 16:7229747-7229769 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589611 16:7229783-7229805 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589620 16:7229819-7229841 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589625 16:7229837-7229859 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589634 16:7229873-7229895 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589639 16:7229891-7229913 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589644 16:7229909-7229931 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589649 16:7229927-7229949 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589654 16:7229945-7229967 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589659 16:7229963-7229985 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589664 16:7229981-7230003 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133856331 16:9552606-9552628 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1134285823 16:12861340-12861362 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135180079 16:20265279-20265301 GAGGGTGGAGAGGGGGAGGAGGG - Intergenic
1135186057 16:20316902-20316924 AAGGGAAGAGAGAGGGAGAAAGG - Intronic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1135940317 16:26816731-26816753 CAGGATGGACAGAGGGAGAGGGG - Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1138653127 16:58473139-58473161 AAGGGAAGAGAAAGGGAGGAAGG - Intronic
1138687736 16:58740462-58740484 CTGGGTTGATAGAGGTAGGAAGG - Intergenic
1138941265 16:61793402-61793424 GAGGGTAGAGGGAGGGAGGAGGG - Intronic
1138988513 16:62361525-62361547 AAGGGGAGAGAGAGGGAGGGAGG + Intergenic
1139255111 16:65533669-65533691 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1139283810 16:65792794-65792816 CAGGGAAGACAGAGCAAGCAAGG + Intergenic
1139758973 16:69168957-69168979 CAGGGTAGACAGTTCAAGGAAGG - Exonic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140152036 16:72377342-72377364 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140328236 16:74026885-74026907 AAAGGGAGAGAGAGGGAGGAAGG + Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140710385 16:77672107-77672129 CAGGGTAGAAAGATGAAGGCTGG - Intergenic
1140833451 16:78772184-78772206 GAGGGTAGAGGGAGAGAGGAAGG - Intronic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141271007 16:82541289-82541311 TAGGCTAGACAGAGCCAGGAAGG + Intergenic
1141279857 16:82621545-82621567 CAAGGTAGCCAGAGGTATGAAGG - Intergenic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141881713 16:86864575-86864597 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1142251370 16:88993562-88993584 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1142251404 16:88993652-88993674 GAGGGAAGAGGGAGGGAGGAGGG - Intergenic
1142280921 16:89147167-89147189 GAGGGTCCACAGAGGGAGGGAGG + Intronic
1142693576 17:1621250-1621272 CCGGGGAGACAAAGGGAGGGGGG + Intronic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1142980303 17:3667771-3667793 TAGACTAGGCAGAGGGAGGAAGG - Intronic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143710544 17:8731750-8731772 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1143771681 17:9173141-9173163 CAGGGCAGACAGAGAGACCAGGG - Intronic
1143938259 17:10510027-10510049 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144695668 17:17302434-17302456 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1145063042 17:19744448-19744470 GAGGGTAGTCGGTGGGAGGATGG + Intronic
1145201111 17:20945580-20945602 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1145404199 17:22571229-22571251 GAGGGTAGCAAGAGGGAGCAGGG + Intergenic
1145866715 17:28246553-28246575 CCAGGGAGACAGTGGGAGGAGGG + Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146532177 17:33617498-33617520 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147050143 17:37788239-37788261 AAGGGGAGAGGGAGGGAGGAGGG - Intergenic
1147122573 17:38344175-38344197 AAGGGCAGGCAGAGGGAGGGAGG - Intergenic
1147167621 17:38601868-38601890 AGGGGTGGTCAGAGGGAGGAAGG + Intronic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1147418665 17:40311223-40311245 GAGGGAAGCCAGTGGGAGGATGG + Intronic
1147542653 17:41373680-41373702 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1147697709 17:42368890-42368912 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1148467559 17:47874005-47874027 GAGGGAAGAAGGAGGGAGGAAGG - Intergenic
1148551235 17:48551832-48551854 GAGGGCAGCTAGAGGGAGGAGGG + Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1148942649 17:51228219-51228241 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149090457 17:52772119-52772141 GAGAGTAGATGGAGGGAGGAAGG + Intergenic
1149325329 17:55524066-55524088 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1149362117 17:55906351-55906373 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151103369 17:71581788-71581810 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1151142469 17:72007049-72007071 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1151194926 17:72424636-72424658 CAGGGCGGCCAGTGGGAGGAGGG - Intergenic
1151615363 17:75206673-75206695 CAGGGTAGGTAGAGGGATTATGG + Intronic
1151762322 17:76112290-76112312 GGAGGGAGACAGAGGGAGGAAGG + Intronic
1152149223 17:78588711-78588733 CCCAGTAGACAGAGGGAGGTGGG - Intergenic
1152340455 17:79721328-79721350 GATGGTGGACAGAGGGAGAAAGG + Intergenic
1152372085 17:79894993-79895015 GAAGGAAGAAAGAGGGAGGAAGG - Intergenic
1152482553 17:80564738-80564760 GAGGGTAGACGGTGGGAGGAGGG - Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152811827 17:82386042-82386064 AGGGGAAGACGGAGGGAGGATGG - Intergenic
1153064167 18:1026187-1026209 GAGGGTAGAGAGTGGGAGGTGGG + Intergenic
1153068733 18:1079573-1079595 GAGGGTAGAGAATGGGAGGAGGG + Intergenic
1153162005 18:2216914-2216936 CAGGGCAGAAGGTGGGAGGAGGG + Intergenic
1153273754 18:3348592-3348614 CAGGGTATAATGAGGTAGGAAGG - Intergenic
1153329152 18:3855280-3855302 GAGGGTGGAGGGAGGGAGGAAGG + Intronic
1153359511 18:4177608-4177630 GAGGGTGGATGGAGGGAGGAAGG - Intronic
1153447096 18:5186221-5186243 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1153571680 18:6479453-6479475 TAGGGTGGAAAGAGGTAGGAGGG + Intergenic
1153589366 18:6657150-6657172 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1153760378 18:8325306-8325328 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1153987791 18:10368595-10368617 GAGAGCAGAGAGAGGGAGGAAGG + Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1154465614 18:14641105-14641127 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155733431 18:29191195-29191217 CAGGGTGGAAAGAGGGTGAAGGG - Intergenic
1155959226 18:31979685-31979707 TAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1156076459 18:33284254-33284276 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1156199871 18:34818461-34818483 TAGGGTGGAGAGTGGGAGGAAGG - Intronic
1156341581 18:36214509-36214531 CAGGGAAGAGACAGGGAGGGTGG - Intronic
1156454106 18:37283201-37283223 CAGGGTAGAAGGAGGAGGGATGG - Intronic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1156908683 18:42385064-42385086 GAGGGAAGAAAGAGGAAGGAAGG - Intergenic
1157054718 18:44212938-44212960 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157784698 18:50471057-50471079 CAGGGTAGCTGGAGTGAGGATGG - Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158861916 18:61600881-61600903 CAGGTTAGAGAGGGGGTGGAAGG + Intergenic
1159465426 18:68776660-68776682 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1159489896 18:69118693-69118715 GAGGGTGGACAGTGAGAGGAGGG - Intergenic
1159532207 18:69669244-69669266 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1159664432 18:71140809-71140831 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
1160138887 18:76301008-76301030 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161642325 19:5432071-5432093 CAGGGAAGAAAGGGGTAGGATGG + Intergenic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161664214 19:5565143-5565165 CAAGGGGGAGAGAGGGAGGAAGG - Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161849581 19:6731549-6731571 CAGGGGAGACTGAGGGTGGGAGG + Intronic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1162085614 19:8247254-8247276 CAAGGGGGAGAGAGGGAGGAGGG - Intronic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162717043 19:12640726-12640748 GAGGGTGGAAGGAGGGAGGAAGG + Intergenic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1162861009 19:13505870-13505892 GAGGGGAGGCGGAGGGAGGAGGG + Intronic
1163045983 19:14642573-14642595 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1163059436 19:14748121-14748143 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1165344959 19:35239592-35239614 GAGGGTAGAGTGTGGGAGGAGGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165824220 19:38696472-38696494 CCGGGTAGGGAGAGGAAGGATGG + Intronic
1165940023 19:39410281-39410303 GAGGGAAGTGAGAGGGAGGAGGG - Intergenic
1166546750 19:43638884-43638906 AGGGATAGAGAGAGGGAGGAAGG + Intronic
1166699176 19:44872272-44872294 CAGTGTAGACAATGGCAGGAAGG - Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1166990536 19:46690078-46690100 CAGGGTTGCAGGAGGGAGGAGGG + Intronic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167691308 19:50985104-50985126 GAGGGTGGAGAGTGGGAGGAAGG - Intergenic
1167842552 19:52133866-52133888 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
1167918080 19:52758619-52758641 GAGGGTAGAGAGTGGGAGGAAGG + Intergenic
1167984411 19:53302233-53302255 TTGGGTAGACAGGGGTAGGAGGG - Intergenic
1168189203 19:54725775-54725797 CAAGGTAGACACAGGATGGAGGG - Intronic
1168191216 19:54739987-54740009 CAGGGTAGACATGAGGTGGAGGG - Intronic
1168193476 19:54756592-54756614 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168195539 19:54771330-54771352 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168362660 19:55755430-55755452 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1168660642 19:58163162-58163184 CAGGGTCGGGAGAGGGGGGAGGG + Intergenic
924989071 2:295666-295688 CATGGAAGAAAGAGGGAAGAAGG + Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925079932 2:1056040-1056062 CAGAGTGGACACAGGGAGAAGGG + Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926001405 2:9336290-9336312 CAGGGGAGAGAAAGGGAGGGAGG - Intronic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926714509 2:15913573-15913595 GAGGCTAGGCAGAGGGAGGGAGG + Intergenic
926783610 2:16498545-16498567 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
927128231 2:20033475-20033497 GAGGGTGGAGAGAGGGAGGTGGG + Intronic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927165616 2:20317697-20317719 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
927203544 2:20593039-20593061 TGGGGTAGACAGCGGGAGGTTGG - Intronic
927333461 2:21892890-21892912 CAGGGTAGAAAGTGAGAGGAGGG - Intergenic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
927800177 2:26091523-26091545 CAGGGTAGAGAGGGGTAGGTGGG + Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
929100584 2:38308458-38308480 AAAGGTAGTCAGAGGGTGGAGGG + Intronic
929336664 2:40756438-40756460 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
929412143 2:41708846-41708868 GAGGGTAGAGTGTGGGAGGAGGG - Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
930118720 2:47742268-47742290 CAGGGGAGACAGTGGTGGGAGGG - Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930572725 2:53107422-53107444 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
930669881 2:54137424-54137446 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
931212254 2:60208354-60208376 CAGTGGAGACAGAGGCAGGTTGG - Intergenic
931663761 2:64595227-64595249 CAGGGTAGAAAGAGTGAAGAAGG + Intergenic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
932937257 2:76118730-76118752 TAGGGTAGAGAGTGGGAGGAGGG + Intergenic
933101577 2:78265644-78265666 AAGGGTGGAGAGTGGGAGGAGGG + Intergenic
933319489 2:80755926-80755948 AAGGGTGGAGTGAGGGAGGAGGG - Intergenic
933593072 2:84254527-84254549 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934150121 2:89138434-89138456 GAGGATAGACAGAGTGAGGCTGG - Intergenic
934217175 2:90043595-90043617 GAGGATAGACAGAGTGAGGCTGG + Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
934699054 2:96423908-96423930 GGGGGTGGACAGAGGCAGGAGGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935653250 2:105399417-105399439 CGGGGGAGGCGGAGGGAGGAGGG + Intronic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936514695 2:113174259-113174281 AGGGGTAGGCTGAGGGAGGAGGG - Intronic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937538116 2:122915964-122915986 GAGGGTAGGAAGTGGGAGGAGGG + Intergenic
938181606 2:129189747-129189769 CAGGGAAGACTGTGGCAGGAAGG + Intergenic
938248919 2:129798809-129798831 CAGGGAGGACACAGGGAGTAAGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938866701 2:135429383-135429405 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
938969814 2:136421793-136421815 CAGGGAAGTCAGAGGGAAAAAGG - Intergenic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
939223862 2:139339892-139339914 GAGGGGAGAGAGAGAGAGGAGGG + Intergenic
939671244 2:145015367-145015389 CAGGGTAGAGGGAGGGAGAGGGG - Intergenic
939707404 2:145471969-145471991 TAGGGTAGTGAGTGGGAGGAGGG - Intergenic
939801355 2:146714045-146714067 CGGGGTGGACAGTGAGAGGAGGG + Intergenic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941539791 2:166768053-166768075 CAGGGTGGAGTGTGGGAGGAGGG - Intergenic
941566000 2:167109012-167109034 GAGGGTAGAGGGTGGGAGGAAGG - Intronic
941794221 2:169582553-169582575 GAGTGTAGACAGTGGGAGGAGGG - Intergenic
942397759 2:175569527-175569549 CAGGCTAGAAAGAGGCAGAATGG - Intergenic
942406061 2:175656559-175656581 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
942523982 2:176833354-176833376 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
943482493 2:188437920-188437942 GAGGGTAGAGAGTGGGAAGAGGG + Intronic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943658458 2:190533700-190533722 CAGGGTAGCCAAAGCAAGGAAGG + Intronic
943828019 2:192420804-192420826 CAGGCAAGACAGAGTGAAGATGG - Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944398635 2:199299549-199299571 CAAGGTAGCCAGAGGGAAAATGG + Intronic
944619386 2:201498447-201498469 CAAAGCAGACAGAGGAAGGAGGG - Intronic
944825032 2:203474157-203474179 CAGGGTAGAAAGAGGGCAAAGGG + Intronic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
945604112 2:211906695-211906717 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
945608968 2:211974080-211974102 GAGGGTGGACGGTGGGAGGAGGG + Intronic
945653298 2:212591842-212591864 CAGGGTACCTTGAGGGAGGAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945996717 2:216443257-216443279 TATGGGAGACTGAGGGAGGAGGG + Intronic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
946884845 2:224212822-224212844 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
946971627 2:225099290-225099312 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947077353 2:226359778-226359800 CAGGCAGGAGAGAGGGAGGAAGG + Intergenic
947393119 2:229660266-229660288 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948305416 2:236943799-236943821 CAGGGTAGACTGAGGATGGATGG + Intergenic
948343699 2:237277531-237277553 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1168970882 20:1929991-1930013 GAGGGCAGACTGTGGGAGGAGGG - Intronic
1169209729 20:3759318-3759340 TGGGCTAGACAGAGGAAGGAAGG - Intronic
1169922899 20:10754444-10754466 TTGCGTAGAGAGAGGGAGGAGGG + Intergenic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171151431 20:22829501-22829523 GAGGGGAGAGAGCGGGAGGAGGG - Intergenic
1171298040 20:24035947-24035969 CAGGGTAGTGAGACAGAGGAGGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171370872 20:24661321-24661343 GAGGGAAGAGAGGGGGAGGAAGG + Intronic
1171851916 20:30314881-30314903 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1171985615 20:31658906-31658928 CAAGGAAGAGAGAGGAAGGAAGG - Intergenic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172185699 20:33029800-33029822 CCAGGCAGAAAGAGGGAGGAAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172283915 20:33727788-33727810 CATGTTAGAGACAGGGAGGAAGG + Intergenic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173380487 20:42535322-42535344 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1174556588 20:51399982-51400004 CAGGTGAGACACGGGGAGGAGGG - Intronic
1174793697 20:53503811-53503833 CAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175059670 20:56230508-56230530 CAGGGAAGAAAGAGGGAGAGAGG + Intergenic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1175171378 20:57083884-57083906 CAGAGCAGCCAGAGTGAGGATGG - Intergenic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175601572 20:60278394-60278416 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1175790319 20:61736592-61736614 AAGGGGAGAGGGAGGGAGGAAGG + Intronic
1175817832 20:61892895-61892917 AAAGGTAGAAAGAGGGAGGGAGG + Intronic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176305234 21:5119696-5119718 GACTGTAGACAGCGGGAGGAGGG - Intronic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1176808943 21:13517377-13517399 GAGGGTGGCGAGAGGGAGGAGGG + Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1177251700 21:18599873-18599895 TAGGATAGAAAGAGGAAGGAAGG - Intergenic
1177708593 21:24740916-24740938 GAGGGGAGAGAAAGGGAGGAGGG - Intergenic
1177764870 21:25446027-25446049 CAGGGTAGAGGGTGGGAAGAAGG + Intergenic
1177886418 21:26751231-26751253 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1178258856 21:31080174-31080196 CAGGGTAGAGAGAGGTGGGCTGG + Intergenic
1178259472 21:31085571-31085593 AGGGATAGACAGAGGGAGGGAGG + Intergenic
1178416136 21:32406648-32406670 GAGGGTGGAGAGAGGGAGTAGGG + Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1179030028 21:37712471-37712493 GAGGGAAGAGAAAGGGAGGAGGG - Intronic
1179030043 21:37712516-37712538 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030089 21:37712656-37712678 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030102 21:37712701-37712723 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179164141 21:38922486-38922508 GAGGGTAGAGGGTGGGAGGAAGG - Intergenic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1179372749 21:40821861-40821883 AAGGGTGGAAAGTGGGAGGAGGG + Intronic
1179436437 21:41365371-41365393 AAGGGTAGAGGGTGGGAGGAAGG - Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179711150 21:43263956-43263978 CAGGGTACAATGAGAGAGGAAGG + Intergenic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1179851820 21:44142334-44142356 GACTGTAGACAGCGGGAGGAGGG + Intronic
1180186868 21:46144560-46144582 GGAGGGAGACAGAGGGAGGAGGG - Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180713426 22:17855525-17855547 CAGGGCGGACGGATGGAGGAAGG + Intronic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181660200 22:24341167-24341189 CAGGGCAGATACTGGGAGGAGGG + Intronic
1181729418 22:24833802-24833824 CATGCTAGACAGTGGGAGGTAGG + Intronic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1182083206 22:27543604-27543626 CAGGGAAGAAAGAGGAAGGGAGG - Intergenic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1182641146 22:31768773-31768795 AGGGGTAGAGAGAGGGAGGGAGG - Intronic
1182766328 22:32760606-32760628 TAGGGTAGACGGTGGGAGGCTGG - Intronic
1182881184 22:33734853-33734875 CATGGTAGCCAGAGGTAGCATGG - Intronic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183151929 22:36044526-36044548 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183375652 22:37463405-37463427 CAGGGTAGACGTGGGGAGGGAGG + Intergenic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183473038 22:38019587-38019609 CAAGGCAGAGAGAGGGAGGGCGG + Intronic
1183826057 22:40388624-40388646 CAGGGTAGAGAGTGGTTGGAGGG + Intronic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184351708 22:43948567-43948589 TAGGGAAGACAGAGAGAGGTTGG - Intronic
1184563418 22:45276612-45276634 CAGGTAAGACACAGGGAGTAGGG - Intergenic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184822619 22:46921230-46921252 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
1184992537 22:48180487-48180509 CATGGCAGCCCGAGGGAGGAGGG - Intergenic
1185039167 22:48495646-48495668 CAGCCCAGACAGAGAGAGGACGG - Intronic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
1185209694 22:49563741-49563763 CAAGGAAGAGAGGGGGAGGAGGG + Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950848432 3:16038032-16038054 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
950947693 3:16966914-16966936 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
951097828 3:18652401-18652423 CATGGTAGACAGAGAGAAGGTGG + Intergenic
951720547 3:25693216-25693238 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
952721863 3:36541981-36542003 TATGTTAGAGAGAGGGAGGAAGG + Intronic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953312001 3:41889535-41889557 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
953472297 3:43177627-43177649 CAGGGGAGTCAGAGGGGGGGGGG - Intergenic
953602429 3:44379890-44379912 TAGGGAAGAGAGTGGGAGGAGGG + Intronic
953712954 3:45290464-45290486 CTGGGTAGTGAGAGTGAGGAAGG + Intergenic
953745214 3:45568782-45568804 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
954406164 3:50346109-50346131 CAGTCTGGACATAGGGAGGATGG - Exonic
954437480 3:50503705-50503727 CCGGGAAGAGAGAGGGAGGGAGG - Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
954936516 3:54331926-54331948 CAGGGTAGATTGAGGGAGGGAGG - Intronic
955033121 3:55240210-55240232 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955488492 3:59459112-59459134 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955973178 3:64456229-64456251 CAAGGCAGAGAGAGGGATGAAGG + Intergenic
956032269 3:65051402-65051424 GAGGGTAGAGGGTGGGAGGAAGG - Intergenic
956354475 3:68376397-68376419 GAGGGTAGATGGTGGGAGGAGGG - Intronic
956577450 3:70768958-70768980 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
956659695 3:71584620-71584642 GAGGAGAGACCGAGGGAGGACGG - Intergenic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
956932781 3:74064402-74064424 GAGGGGAGACAGAGAAAGGAGGG + Intergenic
956972051 3:74537640-74537662 TAGGGAAGGCAGAGGAAGGATGG + Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957890320 3:86348788-86348810 GTGGGTAGTCAGAGGGTGGAAGG - Intergenic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
958843272 3:99234623-99234645 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
959113161 3:102145754-102145776 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
959416444 3:106080987-106081009 GAGGATAGAGAGTGGGAGGAGGG - Intergenic
959481564 3:106878923-106878945 GAAGGTAGAGAGTGGGAGGAGGG + Intergenic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
959881923 3:111453678-111453700 TAGGGTAGAGGGTGGGAGGAGGG + Intronic
959935630 3:112025640-112025662 TATGGTAGAGAGGGGGAGGATGG - Intergenic
959974435 3:112442532-112442554 GAGGGCAGAGAGAGGGAGGGGGG + Intergenic
959976224 3:112462837-112462859 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
960098168 3:113708206-113708228 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
960188810 3:114677844-114677866 AAGAGTAGGCAGAGAGAGGAAGG - Intronic
960343608 3:116505557-116505579 CAGGGTAGGGGGAGGGGGGACGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961018701 3:123486298-123486320 CAGGGGAGACAGAGAAAGGTTGG + Intergenic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961356463 3:126343039-126343061 CAGGGCAGACAGAGCCAGAAGGG - Exonic
961428865 3:126865703-126865725 CAGAGTAGACTCAGGGAAGAGGG - Intronic
961445362 3:126978122-126978144 ACGGGAAGTCAGAGGGAGGAGGG + Intergenic
961850603 3:129813643-129813665 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
962350820 3:134654526-134654548 CAGGGTAGGCTGAGGGAGTTAGG - Intronic
962597426 3:136960805-136960827 CAAGGTAGAAGAAGGGAGGAGGG + Intronic
962671890 3:137716707-137716729 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
962906607 3:139809137-139809159 CTTGGAAGACCGAGGGAGGAGGG + Intergenic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
963611298 3:147472127-147472149 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
963632097 3:147746242-147746264 AAGGGTGGAGAGTGGGAGGAGGG - Intergenic
963634426 3:147776609-147776631 CAGAGTAGAAATAGGGAGAATGG - Intergenic
964158839 3:153621285-153621307 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
964554709 3:157923949-157923971 GAGGGTAGACAGTAGAAGGAGGG - Intergenic
964650966 3:159010845-159010867 TGGGGTAGGCAGAGGGGGGACGG - Intronic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965017582 3:163177705-163177727 CAGGGTGGAGAGTGGGATGAGGG + Intergenic
965033558 3:163405351-163405373 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
965069094 3:163894219-163894241 CAAGGTACACAATGGGAGGAGGG + Intergenic
965084629 3:164079018-164079040 GATGGTAGACAGTGGGAGGATGG + Intergenic
965123092 3:164589038-164589060 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
965179196 3:165379380-165379402 GAGGGTAGAGAGAGAAAGGAAGG - Intergenic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966593895 3:181710233-181710255 AAGGGTAGACCAGGGGAGGAGGG + Intergenic
966647786 3:182266101-182266123 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967556943 3:190871005-190871027 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
967604102 3:191423885-191423907 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
967959060 3:194904995-194905017 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
968080829 3:195845710-195845732 CAAGCGAGAAAGAGGGAGGAAGG - Intergenic
968250874 3:197212086-197212108 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
968448048 4:662335-662357 CAGGGCAGAAGGATGGAGGAGGG + Intronic
969205909 4:5645402-5645424 GAGGGTGGAGAGTGGGAGGAAGG - Intronic
969340295 4:6536080-6536102 CAGGCTACACAGAGTGAGGTGGG - Intronic
969481316 4:7448543-7448565 GAGGGTAGAGAAAGGGAGGGAGG - Intronic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969637670 4:8378625-8378647 CAGGCTAGAGGTAGGGAGGAGGG + Intronic
970044853 4:11840577-11840599 CAGGGAAGAAAGAGAGGGGAAGG - Intergenic
970083201 4:12314083-12314105 CAGGGTAGAAAGTGGAAGGAGGG + Intergenic
970581454 4:17477608-17477630 CCTGGTAGAGAAAGGGAGGATGG - Intronic
970640078 4:18054271-18054293 CAAGGCAGCCAGTGGGAGGAAGG - Intergenic
970726031 4:19045819-19045841 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
970897878 4:21124508-21124530 GAGGGCAGACAGAGCAAGGAAGG - Intronic
970993804 4:22242420-22242442 GAGGGCAGACAGAGGGAGTGGGG - Intergenic
971056490 4:22919222-22919244 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971394347 4:26214675-26214697 GAGGGAGGAGAGAGGGAGGAAGG + Intronic
971620174 4:28845626-28845648 GAGGGTAGAAAGTGGGAGGAGGG - Intergenic
971703200 4:30007259-30007281 CAGGGAGGAGAGTGGGAGGAGGG + Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972565522 4:40265676-40265698 GAGGGAAGGGAGAGGGAGGAGGG + Intergenic
973102416 4:46289548-46289570 AAGGGTAGAGGGTGGGAGGAGGG + Intronic
973331046 4:48910394-48910416 GAGGGGAGAGAGAGGAAGGAAGG - Intergenic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
973761038 4:54116074-54116096 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
974239760 4:59231658-59231680 GAGGGTGGACGGTGGGAGGATGG - Intergenic
974451122 4:62061613-62061635 CAGGGGTGAAAGATGGAGGATGG - Intronic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
974738720 4:65976695-65976717 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
974938764 4:68438882-68438904 TGGGGTAGAGGGAGGGAGGAGGG + Intergenic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975891137 4:79029140-79029162 CAGGCAGGAGAGAGGGAGGAGGG - Intergenic
976443495 4:85104043-85104065 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
976611396 4:87034259-87034281 CAGGGAGGATAGGGGGAGGAAGG + Intronic
976759595 4:88533960-88533982 GGAGGTAGAAAGAGGGAGGAAGG - Intronic
976825318 4:89254375-89254397 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
977148789 4:93481875-93481897 CAGGCTTGATGGAGGGAGGAAGG + Intronic
977186578 4:93945683-93945705 GAGGGTAGATGGTGGGAGGAGGG + Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977307955 4:95348970-95348992 AAGGGTAGTGAGAGGGAGGGCGG + Intronic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
977893600 4:102340256-102340278 GAGGGTAGAGAGAGGCAGCAGGG + Intronic
978430956 4:108633055-108633077 CAGGGTAGAGGGTGGGAGGAGGG - Intergenic
978543068 4:109839603-109839625 AAGGGTAGAGGGAGGGAGGAGGG - Intronic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
978968108 4:114767819-114767841 CAGGGCAGAGGGTGGGAGGAGGG + Intergenic
978973044 4:114834133-114834155 CAAACAAGACAGAGGGAGGAGGG + Intronic
979109260 4:116730665-116730687 GAGGGTGGACAGTGGAAGGAAGG - Intergenic
979154609 4:117368480-117368502 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
979853234 4:125599605-125599627 GAGGGGAGAAAAAGGGAGGACGG - Intergenic
980166423 4:129233610-129233632 ATGGGTAGACAGAGGCAGGTGGG + Intergenic
980288516 4:130813176-130813198 CGGGGTTGAGGGAGGGAGGAGGG - Intergenic
980405269 4:132346386-132346408 GAGGGTTGAAAGAGGAAGGAGGG + Intergenic
981439195 4:144763258-144763280 AAGAGTAGAGAGAGGGAGGACGG + Intergenic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
981886140 4:149675311-149675333 TAGGGAAGACAAAGGGAGAATGG + Intergenic
982086002 4:151836753-151836775 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982346622 4:154367294-154367316 CAGGGTGGAAGGAGGGAGAACGG + Intronic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983145385 4:164207818-164207840 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
983522074 4:168719721-168719743 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
983728428 4:170961036-170961058 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
983745865 4:171199430-171199452 GAGGGTGGAGAGAGGGAGAAGGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984712231 4:182895506-182895528 CAGGTTCGAGAGAGGGAGGAAGG - Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
984959094 4:185077327-185077349 CAGGGTGGAAAGAGAGAGGTCGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985092399 4:186377810-186377832 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985235993 4:187875141-187875163 GAGGGCGGACAGTGGGAGGAGGG - Intergenic
985245439 4:187975795-187975817 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985654997 5:1126629-1126651 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
986011288 5:3718070-3718092 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986381025 5:7185838-7185860 GAGGGTAGAGGGTGGGAGGAAGG + Intergenic
986530115 5:8727034-8727056 GAGGGAAGAAAGAGCGAGGAAGG + Intergenic
986648859 5:9944680-9944702 CAGGGTAGAAGGAGGTGGGAGGG + Intergenic
987063615 5:14266322-14266344 CTGGGTAGAAAGATGGATGAAGG - Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987954676 5:24723090-24723112 CAGAGTAGTCATAGGGAAGAAGG - Intergenic
988163116 5:27547147-27547169 GAGGGTAGAGGGTGGGAGGAAGG - Intergenic
988514892 5:31895760-31895782 GGGAGCAGACAGAGGGAGGAAGG - Intronic
989017344 5:36954208-36954230 AAGGGTAGAAAGTGAGAGGATGG + Intronic
989214277 5:38888062-38888084 CATGCGAGACAGACGGAGGAGGG + Intronic
989824860 5:45840770-45840792 GAAGGTAGAGAGTGGGAGGAGGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990782254 5:59378280-59378302 GAGGGTAGAAGGTGGGAGGAGGG + Intronic
991227827 5:64293023-64293045 CAGAGTAGACAGGGTGAGGAGGG - Intronic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
991958909 5:72022096-72022118 GAGGGTGGAGAGTGGGAGGATGG - Intergenic
991964860 5:72080701-72080723 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
993275901 5:85858223-85858245 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
993325986 5:86537177-86537199 GAGGGTGGAGAGTGGGAGGATGG + Intergenic
994670763 5:102758824-102758846 CAGGGTAGGGGGAGGGGGGAAGG + Intronic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
994957527 5:106552554-106552576 CAGGGTGGAAGGTGGGAGGAGGG + Intergenic
995653367 5:114396866-114396888 GAGGGTAGAGGGTGGGAGGAAGG - Intronic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
995888582 5:116923422-116923444 CAGGGCAGACAGTGGGAAGGAGG + Intergenic
995928679 5:117408256-117408278 CAGGGTGGAGAGTGGAAGGAGGG - Intergenic
996046523 5:118879802-118879824 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
996338037 5:122406261-122406283 CAAGAAAGACAGGGGGAGGAGGG - Intronic
996614371 5:125422734-125422756 CATGGAAGGCAGAGGGAGGTGGG - Intergenic
997181735 5:131836041-131836063 AAGGGTGGAGAGTGGGAGGAGGG - Intronic
997613273 5:135229939-135229961 CAGGGCAGGATGAGGGAGGAAGG - Intronic
998265246 5:140663191-140663213 CAGGGTAGACAGTGGCAGCGTGG - Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998595669 5:143527328-143527350 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
998619624 5:143779908-143779930 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
998692900 5:144606854-144606876 GAGGGTAGAGGTAGGGAGGAGGG - Intergenic
999071061 5:148744598-148744620 GAGGGTAGAGGGTGGGAGGAAGG + Intergenic
999071105 5:148744988-148745010 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
999199627 5:149806471-149806493 CAGGAGAGACCGAGGGAGCAGGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000338717 5:160260800-160260822 CAGGGTTGGCTGAGTGAGGAGGG - Intronic
1000343285 5:160294204-160294226 CGGGGCAGAGAGAGGAAGGAGGG - Intronic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000974612 5:167751106-167751128 CAGGGTGGAGAGAGGAAGCAGGG + Intronic
1001206274 5:169766213-169766235 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1001898896 5:175406173-175406195 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1002279769 5:178123476-178123498 CAGGGTAGCCAAAGGGAGTGAGG - Exonic
1002419079 5:179136158-179136180 CAGGGCAGACAGAGAGGGAAAGG + Intronic
1002713310 5:181208466-181208488 CACGGTAGCCAAAAGGAGGAAGG - Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003004267 6:2366418-2366440 AAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003476711 6:6490369-6490391 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1003754414 6:9100576-9100598 GAAGGAAGAAAGAGGGAGGAAGG - Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004586819 6:17010711-17010733 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1004725648 6:18308917-18308939 AAGGGAAGAGAGAGAGAGGAAGG - Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005244915 6:23872648-23872670 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007292744 6:40799585-40799607 AAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1007404597 6:41627236-41627258 GAGGGTAGAGAGAGGGAGCTAGG - Intergenic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007973020 6:46072084-46072106 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1007989905 6:46244304-46244326 AAGGAAAGAAAGAGGGAGGAAGG - Intronic
1008251642 6:49247009-49247031 GACGGTAGAGAGAGGGAGGAGGG + Intergenic
1008323975 6:50154302-50154324 GAGGGTGGATGGAGGGAGGAGGG - Intergenic
1008475532 6:51931886-51931908 AAGGGGAGAGAGAGAGAGGAGGG + Intronic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1008917114 6:56800173-56800195 CCGAGTAGACAAAGGGAAGAAGG + Intronic
1009330646 6:62415519-62415541 AAGGGTAGACGGTGAGAGGAGGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009423081 6:63485177-63485199 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010042073 6:71396768-71396790 AGGGGTAGGAAGAGGGAGGAGGG - Intergenic
1010252612 6:73723741-73723763 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1010277068 6:73981107-73981129 CAGGGTAGGGAGAGGGAGCTGGG - Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1010507219 6:76675401-76675423 GAGGGTAGAGGGAGGGAGGAGGG - Intergenic
1010531340 6:76971217-76971239 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1010659025 6:78547313-78547335 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1010680399 6:78792470-78792492 GAGTGTGGACAGTGGGAGGAGGG + Intergenic
1011038971 6:83009960-83009982 GAGAGTAGACAAATGGAGGAGGG + Intronic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011922825 6:92602522-92602544 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012161874 6:95895355-95895377 GAGGGTAGACGGTGGGAGGTGGG - Intergenic
1012518270 6:100089333-100089355 GAGGGTAGAGAGTGGGAGAAGGG - Intergenic
1012850147 6:104436914-104436936 GAGGGTGGAGAGTGGGAGGAAGG + Intergenic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013435282 6:110098842-110098864 CAGGTTTGAGAGAGGGAGGTAGG + Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1013682110 6:112535835-112535857 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1014795630 6:125721039-125721061 GAGGGTAGTGAGTGGGAGGAGGG - Intergenic
1015059936 6:128951017-128951039 CAGGATAGAGAAGGGGAGGAAGG + Intronic
1015096843 6:129425575-129425597 GAGGGTAGCTAGTGGGAGGAGGG - Intronic
1015395863 6:132733954-132733976 GAGGGGAGAGAGAGAGAGGAAGG + Intronic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1015918335 6:138241290-138241312 CTGGGTAGACAGAGGAGTGATGG - Intronic
1016054025 6:139559708-139559730 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1016532545 6:145074939-145074961 AAAGGAAGAGAGAGGGAGGAAGG + Intergenic
1016616878 6:146060391-146060413 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017026727 6:150187444-150187466 AAGGGTAGAGGGTGGGAGGAGGG - Intronic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017127598 6:151080383-151080405 CAGGGCAGCCAGTGAGAGGATGG + Intronic
1017493238 6:154962347-154962369 CAGGGTAGAAGGAGAGAGGGAGG + Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017634874 6:156434025-156434047 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1017869843 6:158478091-158478113 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018001451 6:159582018-159582040 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1018147021 6:160900798-160900820 CAGGGTACTGAGAGGGAGCATGG + Intergenic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018787454 6:167119167-167119189 CCAGGTAGGCAGGGGGAGGAAGG - Intergenic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019096388 6:169584062-169584084 CAGGGTAGACATAGGCGGGGAGG - Intronic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019716728 7:2542629-2542651 GAGAGTAGACCGGGGGAGGATGG - Intronic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019817174 7:3209883-3209905 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1019825276 7:3279387-3279409 AAGGGGAGAGAGAGGAAGGAGGG + Intergenic
1019917941 7:4145243-4145265 CAGGGAAGACAAAGGAGGGAAGG + Intronic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020029133 7:4920674-4920696 GAGGGAGGAGAGAGGGAGGAGGG - Intronic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1020986333 7:15139505-15139527 AAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1021327973 7:19297752-19297774 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1021336518 7:19409451-19409473 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1021407483 7:20289105-20289127 AAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1021492973 7:21239939-21239961 CAGGTTAGTGAGAGGGAGGTTGG - Intergenic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1022083714 7:27046581-27046603 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1022108075 7:27210936-27210958 CAGGCCTGACAGAGGCAGGAGGG - Intergenic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022335426 7:29417257-29417279 AAAGGAAGAGAGAGGGAGGAAGG + Intronic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1023522901 7:41066652-41066674 GAGGATAGACAGAGGAATGATGG - Intergenic
1023856305 7:44186174-44186196 CAGGGCAGCTGGAGGGAGGAAGG + Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024356824 7:48422097-48422119 GAAGGAAGAAAGAGGGAGGAAGG + Intronic
1024423322 7:49196199-49196221 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1024481997 7:49873325-49873347 CAAGGTGGACATAGGGAGAAGGG - Intronic
1024885139 7:54132825-54132847 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026098947 7:67368946-67368968 CAGGGTAGAAAAAGTGAGGGAGG - Intergenic
1026282333 7:68933080-68933102 CAGGGTAGAGGGAGGAAGGAAGG - Intergenic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1027833948 7:83217708-83217730 AAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1028168228 7:87564013-87564035 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1028239896 7:88406948-88406970 CAGGGCTGAGAGAGGGAGGGGGG - Intergenic
1028342122 7:89734632-89734654 GAGGGTAGAGAGTTGGAGGAAGG + Intergenic
1028437394 7:90820492-90820514 CAGGAGAGACAGAGCGAGGCAGG - Intronic
1028913400 7:96232441-96232463 GAGGGTAGAAGGTGGGAGGAGGG + Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030077109 7:105746226-105746248 CAGTGTAGACACAGGAAGGGTGG - Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030441843 7:109596550-109596572 CAGAGTAGAGACAGGGAGAAGGG + Intergenic
1030982772 7:116206273-116206295 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1030989078 7:116278479-116278501 GAGGGTAGAGGGAGGGAGAAGGG + Intergenic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031445817 7:121852315-121852337 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1031592107 7:123605844-123605866 GAGGGTCGAAAGTGGGAGGAGGG + Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031663860 7:124460864-124460886 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032361204 7:131256798-131256820 AAGGGTGGAGGGAGGGAGGAGGG + Intronic
1032625003 7:133582118-133582140 GAGGGTAGAGGGAGGGAGGAAGG - Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034070440 7:148179582-148179604 CGGGGGAGAGAGAGGGAGGGAGG + Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034577499 7:152013191-152013213 GAGGGTGGACTGTGGGAGGAGGG + Intronic
1034577668 7:152015023-152015045 GAGGGTGGACTGTGGGAGGAGGG + Intronic
1034625164 7:152487154-152487176 AAGGGAAGAGAGAGGAAGGAAGG - Intergenic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035239687 7:157521492-157521514 CAGGGCAGTGAGTGGGAGGAGGG + Intergenic
1035417036 7:158697935-158697957 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1036154173 8:6326261-6326283 AAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1036229727 8:6989666-6989688 CAAGGTAGGCAGAGTGAAGAGGG + Intergenic
1036232178 8:7008769-7008791 CAAGGTAGGCAGAGTGAAGAGGG + Intronic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1036926978 8:12916400-12916422 GAGGGAGGACAGAGAGAGGATGG - Intergenic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037491766 8:19403004-19403026 GAGGGTGGACTGTGGGAGGAGGG + Intergenic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1037558741 8:20053520-20053542 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038650848 8:29401998-29402020 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1039407544 8:37326286-37326308 GAGGGAAGCCAGTGGGAGGAAGG - Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040681918 8:49820776-49820798 GAAGGGAGACGGAGGGAGGAAGG + Intergenic
1040703786 8:50100925-50100947 GAAGGTGGACAGTGGGAGGAGGG - Intronic
1041255705 8:55978295-55978317 CAGGGATGAGGGAGGGAGGATGG + Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG + Intergenic
1041389845 8:57338589-57338611 AAGGGTGGACAGAGTTAGGAGGG - Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1041624307 8:60007806-60007828 GAGGGTAGGGAGTGGGAGGAGGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041755173 8:61305699-61305721 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1041910797 8:63086373-63086395 GAAGGAAGAGAGAGGGAGGAAGG - Intergenic
1042703990 8:71647396-71647418 GAGGGTGGAAAGTGGGAGGAGGG + Intergenic
1042713645 8:71747084-71747106 GAGGGTAGAGGGTGGGAGGAAGG + Intergenic
1043267738 8:78287622-78287644 GAGGGTAGAGGGTGGGAGGATGG - Intergenic
1043289341 8:78577341-78577363 GAGGGTAGAGCGTGGGAGGAGGG + Intronic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1043919837 8:85968715-85968737 CAGGCTAGATAGAGGTAGGGAGG + Intergenic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1044119951 8:88382473-88382495 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1044186398 8:89256884-89256906 GAGGTGAGAGAGAGGGAGGAGGG + Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1044314836 8:90738014-90738036 TAGGGCTGACAGAGGGTGGAAGG + Intronic
1044351264 8:91169252-91169274 GAGGGTAGAAAGTGGGAGGAGGG + Intronic
1044545957 8:93459672-93459694 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1044608830 8:94072262-94072284 CATCCTAGACGGAGGGAGGAGGG - Intergenic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1044900298 8:96936973-96936995 GAGGGAGGAGAGAGGGAGGAAGG - Intronic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1045545914 8:103128149-103128171 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045674098 8:104589082-104589104 CAGGCGAGCCGGAGGGAGGAGGG - Intergenic
1045948968 8:107830078-107830100 AGGGGTAGACACAGGGAGGGAGG + Intergenic
1046048198 8:108987982-108988004 GAGGGTAGAGGGAGGGAGGAGGG + Intergenic
1046072029 8:109267267-109267289 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1046074736 8:109302012-109302034 GAGGGTAGAGACAGGGAGAAGGG - Intronic
1046188902 8:110763491-110763513 GAGGGTAGAAAGTGGGAGGAGGG + Intergenic
1046282650 8:112053860-112053882 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1047018377 8:120747673-120747695 GAGGGTGGAGAGTGGGAGGAAGG + Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048236580 8:132696888-132696910 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1048436083 8:134419164-134419186 GAGGATGGACAGTGGGAGGAGGG + Intergenic
1048825635 8:138423115-138423137 GAGGGTAGAGAGTGGGAGGGGGG + Intronic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049337418 8:142093804-142093826 CGGGGTAGACAGGGAGAGGAAGG + Intergenic
1049370333 8:142261276-142261298 GAGGATAGAGGGAGGGAGGAGGG + Intronic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1049726190 8:144147590-144147612 CGGGGCAGACAGAGGGCGGGCGG + Intergenic
1049879760 8:145053558-145053580 CAGGGAAGCCTGAGGGAGCAGGG + Intronic
1050070780 9:1811068-1811090 GAGGGTGGAGAGCGGGAGGAGGG + Intergenic
1050120336 9:2301204-2301226 CAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1050333775 9:4571231-4571253 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1051196596 9:14568401-14568423 GAGGGCGGAAAGAGGGAGGAAGG + Intergenic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1051494609 9:17705800-17705822 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1052114913 9:24638879-24638901 TGGGGTAGGCAGAGGGGGGAGGG - Intergenic
1052626824 9:30986038-30986060 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1052784275 9:32814127-32814149 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1052829332 9:33202356-33202378 CAGGGCAGACAGAGCAAGGGTGG + Intergenic
1053049321 9:34945669-34945691 TACAGGAGACAGAGGGAGGAAGG - Intergenic
1053070726 9:35100282-35100304 CAGGTTTGAGAGAGGGAGAAAGG - Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053525511 9:38826230-38826252 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1053543866 9:39002578-39002600 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1053786212 9:41654605-41654627 TAGAGAAGACAGTGGGAGGAGGG + Intergenic
1053789702 9:41678135-41678157 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1053808296 9:41826075-41826097 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1054155442 9:61636618-61636640 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054158839 9:61659593-61659615 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054174927 9:61868550-61868572 TAGAGAAGACAGTGGGAGGAGGG + Intergenic
1054178040 9:61889825-61889847 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054197740 9:62050657-62050679 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1054475227 9:65567728-65567750 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054478613 9:65590598-65590620 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054622296 9:67361353-67361375 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1054640614 9:67537715-67537737 GAGGGGAGCCAGAGGGGGGATGG + Intergenic
1054659489 9:67690999-67691021 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054662612 9:67712243-67712265 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054714570 9:68544611-68544633 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1054793099 9:69274142-69274164 CGAGGAAGTCAGAGGGAGGAAGG - Intergenic
1056408387 9:86299062-86299084 CAGGTCAGCCAGAGGAAGGAGGG + Intronic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056906905 9:90659684-90659706 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1057380685 9:94564660-94564682 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1057545769 9:96019846-96019868 CAGGGTGGTGAGAGAGAGGAAGG + Intergenic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058169794 9:101666489-101666511 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059003327 9:110374144-110374166 GAGGGTAGAGGGTGGGAGGAAGG - Intronic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1059812733 9:117874033-117874055 CAGCGTAGGCAGGGGGAGCAGGG + Intergenic
1059824534 9:118013457-118013479 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1059856317 9:118401624-118401646 CCAGGAAGAAAGAGGGAGGAAGG - Intergenic
1059916873 9:119113686-119113708 GAGGGTAGAGAGTGGGGGGAGGG + Intergenic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1061231972 9:129320501-129320523 CAAGCTAGACTGAGGGCGGAGGG - Intergenic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1061921844 9:133786914-133786936 AAGGGGAGAAAGAGGGAGGGAGG + Intronic
1061970233 9:134040985-134041007 CAAGGAAGACAGAGGGCGGGTGG + Intronic
1061975548 9:134066663-134066685 CAGGGTAGGGCGGGGGAGGACGG + Intronic
1062227091 9:135458479-135458501 AAGGGTAGAGGGTGGGAGGAAGG - Intergenic
1062328247 9:136023061-136023083 GAGGGAAGAGGGAGGGAGGAGGG + Intronic
1062328259 9:136023091-136023113 GAGGGAAGAGGGAGGGAGGAGGG + Intronic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062525126 9:136975155-136975177 CAAGGTGGACAGGGGCAGGAGGG - Intergenic
1062627239 9:137448841-137448863 CAGTGTAGACAGAGCCAGGCTGG + Exonic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1185644133 X:1605097-1605119 AGGGGTTGAGAGAGGGAGGAGGG - Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186111945 X:6266901-6266923 AAGGGAGGAAAGAGGGAGGAGGG + Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186135111 X:6511068-6511090 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186549849 X:10492361-10492383 CAGGGTAGGCTGAGCAAGGAGGG - Intronic
1186757288 X:12685348-12685370 GAGAGAAGAAAGAGGGAGGAAGG - Intronic
1186904968 X:14101056-14101078 GAAGGTAGAGAGTGGGAGGAGGG - Intergenic
1186921003 X:14280247-14280269 GAGGGTAGAGGGCGGGAGGAAGG - Intergenic
1187053641 X:15718831-15718853 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1187428451 X:19200199-19200221 CAGGGTAGAGTGAGAGATGAGGG + Intergenic
1187595172 X:20763283-20763305 CAAGGTGGAGGGAGGGAGGAGGG - Intergenic
1187756432 X:22532179-22532201 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188004853 X:25010222-25010244 GAGGGAAGAGGGAGGGAGGAGGG - Intronic
1188035129 X:25308919-25308941 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1188194882 X:27221437-27221459 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1188259144 X:28001907-28001929 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1188734585 X:33696728-33696750 AAGGGGAGAGAGAGGGAAGAGGG + Intergenic
1188819749 X:34760508-34760530 CATGTAAGACAGAGGGAGAAAGG - Intergenic
1188828942 X:34872559-34872581 GAGGGTAGAGTGTGGGAGGAGGG + Intergenic
1188969130 X:36591682-36591704 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189571415 X:42301924-42301946 GAGAGGAGAAAGAGGGAGGAGGG - Intergenic
1189689561 X:43601777-43601799 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1189892997 X:45625027-45625049 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1189895606 X:45652749-45652771 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1189938867 X:46099790-46099812 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1190132520 X:47762811-47762833 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1190160919 X:48030782-48030804 AAGGGGAGCCAAAGGGAGGAAGG + Intronic
1190212660 X:48460408-48460430 CAGGGTAGTCAGTTGGAGGGAGG - Intronic
1190447932 X:50549236-50549258 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190812202 X:53895629-53895651 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1190880651 X:54490182-54490204 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1191088102 X:56590825-56590847 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
1191630976 X:63321839-63321861 GAGGGTGGACGGCGGGAGGAGGG + Intergenic
1191738371 X:64411044-64411066 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1192445110 X:71205322-71205344 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1192725180 X:73742906-73742928 GAGGGTGGAGAGAGGGAGAAGGG - Intergenic
1192831844 X:74758551-74758573 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1193722190 X:85000270-85000292 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1193857042 X:86615917-86615939 GAGGGTAGAGTGTGGGAGGAGGG - Intronic
1193947611 X:87757401-87757423 GAGGGTGGAGAGCGGGAGGAGGG - Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194022355 X:88707672-88707694 GAGGGTAGAAAGTGAGAGGAGGG - Intergenic
1194027779 X:88775323-88775345 AAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1194504526 X:94715860-94715882 CAAGGTGGAGAGTGGGAGGAGGG + Intergenic
1194914382 X:99686862-99686884 AAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1195353430 X:104015686-104015708 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1195375164 X:104219512-104219534 AAGGATAGAGGGAGGGAGGAAGG + Intergenic
1195467673 X:105197906-105197928 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1196010264 X:110879534-110879556 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196216810 X:113062392-113062414 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196494606 X:116309754-116309776 AAGGGTGGAGGGAGGGAGGATGG - Intergenic
1196896604 X:120343087-120343109 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1197679524 X:129367327-129367349 CAGGGTAGACCATCGGAGGAAGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197824793 X:130577387-130577409 CAGGTTAGAGAAAGGAAGGAAGG + Intergenic
1197862043 X:130981135-130981157 AAGGGTAGTGAGAGGGTGGAGGG + Intergenic
1197862596 X:130986337-130986359 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
1198063210 X:133068251-133068273 GAGGGTAGAGGGAGGAAGGAGGG + Intronic
1198276532 X:135099212-135099234 CAGGGGAGACCGTGGGAGAAGGG - Intergenic
1198309966 X:135421540-135421562 CAGGGGAGACCGTGGGAGAAGGG + Intergenic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1198626892 X:138586060-138586082 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1198690523 X:139279117-139279139 AAGGGTAGTGAGAGGGAGGTGGG + Intergenic
1198733232 X:139756818-139756840 CAGGGTGGAGAGTGAGAGGAGGG + Intronic
1198843415 X:140882922-140882944 AAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1198885365 X:141329666-141329688 GAGGGTGGAAAGTGGGAGGAGGG + Intergenic
1198937664 X:141915912-141915934 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1198961391 X:142186951-142186973 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1199330052 X:146548975-146548997 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1199338465 X:146647201-146647223 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199640338 X:149854469-149854491 GAGGGTAGAGGGTGGGAGGAAGG + Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1199791376 X:151158439-151158461 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1200383268 X:155862121-155862143 GAGGGTAGAGGGTGGGAGGAAGG - Intergenic
1200384245 X:155873899-155873921 CAAAGTAGGCAGAGGAAGGAAGG - Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1201691719 Y:16774753-16774775 AAGGGTAGAGAGAGGTAGCAAGG - Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic