ID: 1130153588

View in Genome Browser
Species Human (GRCh38)
Location 15:81331145-81331167
Sequence ATCCAGGGCTCAGACTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 5, 2: 6, 3: 20, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130153588_1130153598 30 Left 1130153588 15:81331145-81331167 CCAGGAAAGTCTGAGCCCTGGAT 0: 1
1: 5
2: 6
3: 20
4: 178
Right 1130153598 15:81331198-81331220 TGGCCGGGAGTACGCGAGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1130153588_1130153592 10 Left 1130153588 15:81331145-81331167 CCAGGAAAGTCTGAGCCCTGGAT 0: 1
1: 5
2: 6
3: 20
4: 178
Right 1130153592 15:81331178-81331200 GCCACCTTTTAAGCAGTCGGTGG 0: 3
1: 10
2: 1
3: 10
4: 93
1130153588_1130153596 15 Left 1130153588 15:81331145-81331167 CCAGGAAAGTCTGAGCCCTGGAT 0: 1
1: 5
2: 6
3: 20
4: 178
Right 1130153596 15:81331183-81331205 CTTTTAAGCAGTCGGTGGCCGGG 0: 1
1: 5
2: 4
3: 11
4: 72
1130153588_1130153591 7 Left 1130153588 15:81331145-81331167 CCAGGAAAGTCTGAGCCCTGGAT 0: 1
1: 5
2: 6
3: 20
4: 178
Right 1130153591 15:81331175-81331197 GCAGCCACCTTTTAAGCAGTCGG 0: 2
1: 2
2: 0
3: 7
4: 112
1130153588_1130153597 26 Left 1130153588 15:81331145-81331167 CCAGGAAAGTCTGAGCCCTGGAT 0: 1
1: 5
2: 6
3: 20
4: 178
Right 1130153597 15:81331194-81331216 TCGGTGGCCGGGAGTACGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 42
1130153588_1130153595 14 Left 1130153588 15:81331145-81331167 CCAGGAAAGTCTGAGCCCTGGAT 0: 1
1: 5
2: 6
3: 20
4: 178
Right 1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG 0: 2
1: 4
2: 4
3: 15
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130153588 Original CRISPR ATCCAGGGCTCAGACTTTCC TGG (reversed) Intergenic
901898395 1:12335556-12335578 CTCCAGGGCATAGACTTTCTCGG + Intronic
903174157 1:21570660-21570682 AGCCAGGGCTCAAACTTGCCTGG - Intronic
904859495 1:33524768-33524790 ATGCAAGGCTCAGACTTGTCTGG - Intronic
906787476 1:48628676-48628698 TTCCATTGCTCAGATTTTCCTGG + Intronic
907549268 1:55290456-55290478 ATCCAGGCTTTAGACTTACCAGG - Intergenic
908509593 1:64840875-64840897 ATCCTTGCCTCTGACTTTCCCGG - Intronic
915069499 1:153254522-153254544 ATCCAGGGATCATGCTTGCCTGG - Intergenic
915540320 1:156561948-156561970 CTTCAGGGCTCTGTCTTTCCAGG + Exonic
915575478 1:156773538-156773560 ATCCAGGGCTGAGAGTGTCCCGG - Intronic
916291176 1:163167877-163167899 ATCCAGGGCTCATAATTAACTGG + Intronic
917303505 1:173603673-173603695 GTCCAGGGCTCAGACTTTCCTGG + Intergenic
918163095 1:181919455-181919477 AGCCAGGGAAGAGACTTTCCGGG + Intergenic
918485012 1:185019412-185019434 CTCCAGGGCTCAGTTTTTTCTGG + Intergenic
920070521 1:203299539-203299561 AGCCAGGACTCAGACACTCCTGG - Intergenic
920920404 1:210293220-210293242 GCCCAGGGTTCAGATTTTCCTGG + Intergenic
921583464 1:216922410-216922432 AACCAAGACTGAGACTTTCCTGG + Intronic
924439859 1:244077178-244077200 TCCCAGGGGTCAGACTTCCCTGG + Intergenic
924646343 1:245880969-245880991 ACCCAGGGCACACACTGTCCAGG + Intronic
1063556951 10:7089433-7089455 TTTCATGGCTCAGACTTTCTTGG - Intergenic
1063939396 10:11111158-11111180 CTCAGGGGCTCAGACTTTCTGGG + Intronic
1064861710 10:19833909-19833931 ATTCAGAGTTCAGAGTTTCCTGG + Intronic
1066688501 10:38003515-38003537 GTCCAGGGTTCAGACTTTCCTGG - Intergenic
1067004128 10:42645465-42645487 CTCCAGGGCTCAGACTTTCCTGG + Intergenic
1067456538 10:46423224-46423246 ATCCAGGCTTCAGCCTTGCCTGG + Intergenic
1070175652 10:73967164-73967186 TTCCAGAGCTCAGCCCTTCCTGG - Intergenic
1070817866 10:79336477-79336499 ATCCAGGGATCAGACAGTCTGGG - Intergenic
1072227501 10:93384000-93384022 TTTTAGGGCTCAGACTCTCCAGG - Intronic
1075083827 10:119400920-119400942 ATCCTGTGCTCTGTCTTTCCTGG - Intronic
1075309888 10:121405233-121405255 TTCCAGGGCTGAGGCTTGCCTGG + Intergenic
1076088182 10:127654281-127654303 ATCCAGGTCTTAGTCTTGCCTGG - Intergenic
1076999315 11:314790-314812 CACCCGGGCTCAGACTCTCCAGG - Intronic
1077000553 11:320110-320132 CACCCGGGCTCAGACTCTCCAGG + Intronic
1077097236 11:804289-804311 GTCCAGGGCGCTGCCTTTCCTGG - Exonic
1077724312 11:4658844-4658866 GTCCAGGACTCATACTTTCCTGG - Intergenic
1078007511 11:7543518-7543540 GTCCAAGGCTCAGAATATCCTGG + Intronic
1078422261 11:11222341-11222363 ATAGAGGGCTCAGGCTTCCCAGG - Intergenic
1078467107 11:11558615-11558637 AGCCCAGGCTCAGAGTTTCCTGG + Intronic
1079089515 11:17470891-17470913 TTCCAGGCCTCAGTCTTCCCTGG + Intronic
1082608219 11:55268142-55268164 CTTCAAGACTCAGACTTTCCCGG + Intronic
1083589788 11:63886960-63886982 ATCCTGGGCTCAAGCTTGCCCGG - Intronic
1083995491 11:66269557-66269579 ATCCAGGTCTCAGATTTCCTTGG + Intronic
1085246811 11:75108602-75108624 ATCCATTGCCCAGACTTGCCAGG + Intronic
1085791957 11:79504070-79504092 ACCCAGGGCTCTGACCTTCCAGG + Intergenic
1088900256 11:114110207-114110229 ATGAAGGGCTCAGACTTTCTTGG + Intronic
1089130724 11:116209863-116209885 ATCCAGGACTCTGACTTTGCTGG + Intergenic
1090334090 11:125951177-125951199 CCCCAGGGCTCTGACATTCCAGG + Intergenic
1090711173 11:129387047-129387069 TACCAGGGTTCAGACTTTCGCGG + Intronic
1092318371 12:7443585-7443607 ATCAAGGGCTCAGACTTAGCTGG + Intronic
1092898919 12:13040396-13040418 TTCCTGGGCTCATACCTTCCTGG + Intergenic
1094301402 12:28968470-28968492 TTCCAGGGCACAGAATTTCAGGG - Intergenic
1094479603 12:30871215-30871237 ACCCTTGGCTCAGACTCTCCAGG + Intergenic
1095476871 12:42594472-42594494 ATCCAGTGCTCTAATTTTCCAGG - Intergenic
1102235045 12:111289228-111289250 ATCCAGGACCCTGGCTTTCCTGG + Intronic
1103053063 12:117797728-117797750 ATCCTGGGCTCAAACCATCCTGG + Intronic
1104749550 12:131229658-131229680 AACCAGCGCTCCCACTTTCCAGG - Intergenic
1112721264 13:102248656-102248678 ATACACGGCTCACAATTTCCTGG - Intronic
1118837567 14:69487483-69487505 ATGCAGTGCTGAGACTTTTCAGG - Intronic
1119435936 14:74597836-74597858 ATCCGGAGATGAGACTTTCCTGG + Intronic
1119780512 14:77273962-77273984 ATCTAGGGCCCAGGTTTTCCTGG - Intergenic
1120031088 14:79641672-79641694 ATCCAGGGCTTAGTCTTTCATGG + Intronic
1120584021 14:86288256-86288278 ATCCAGTGCTCAGATTTTCATGG + Intergenic
1120824994 14:88946737-88946759 GGCCAGGGCTCAGTCTTCCCAGG + Intergenic
1121573145 14:94962394-94962416 CACCAGAGCTCAGAATTTCCAGG - Intergenic
1122049736 14:99048083-99048105 AGCCAGGCCTCAGGTTTTCCTGG - Intergenic
1122374185 14:101247592-101247614 CTCCAGGCCTCAGCCTGTCCTGG + Intergenic
1123223430 14:106877895-106877917 GTCCAGGGCTCAGACTTTCCTGG + Intergenic
1125556566 15:40590695-40590717 GTCTGGGGCTCAGACTTTCCTGG - Intergenic
1125605368 15:40937199-40937221 ATGCAGGGCTCAGACCCTTCTGG + Intronic
1128599582 15:68984540-68984562 GTCCAGGGCTCAGACTTTCCTGG + Intronic
1130153588 15:81331145-81331167 ATCCAGGGCTCAGACTTTCCTGG - Intergenic
1130577438 15:85105137-85105159 ACCCAGGCCTCATACTTTGCAGG + Intronic
1130903499 15:88224310-88224332 CTCCAGGCCTCAGACTCTGCAGG - Intronic
1131527265 15:93162429-93162451 GTCCGGGGCTCAGACTTTCCTGG - Intergenic
1131534282 15:93221653-93221675 GTCCGGGGCTCAGACTTTCCTGG - Intergenic
1131549518 15:93344993-93345015 GTCCGGGGCTCAGACTTTCCTGG + Intergenic
1132231665 15:100189068-100189090 ATGCAGGGCTCAGGCCTGCCAGG - Intronic
1132625705 16:890522-890544 AGCCAAGGCTCAGCCTGTCCTGG + Intronic
1136042921 16:27594456-27594478 ATCAAGGGCTCTGAGATTCCTGG + Intronic
1136099322 16:27981930-27981952 ACCCAGGGGTCAGACTCTCTGGG + Intronic
1136608941 16:31354832-31354854 CTCCTTGGCCCAGACTTTCCAGG + Intergenic
1141777442 16:86133786-86133808 ATCCAGGCCTGAGACTATCTGGG - Intergenic
1142117801 16:88369183-88369205 ATCCATGGCTCAGAACTTTCTGG - Intergenic
1142475610 17:187297-187319 ATCCTGGGCTAAGTCTCTCCTGG - Intergenic
1142805227 17:2367903-2367925 CCCCAGGGCTCAGTCTTCCCAGG + Intronic
1143258786 17:5583523-5583545 ATCCAGGCCCCAGACTATGCTGG - Intronic
1143779768 17:9223228-9223250 ACCCAGGGCCCCTACTTTCCTGG - Intronic
1147536276 17:41324879-41324901 ATCCTGGCCTGAGACTTGCCTGG - Intergenic
1147586895 17:41658019-41658041 ATCTAGGTCTCAGCATTTCCTGG - Intergenic
1148216001 17:45834312-45834334 GCCCAGGGCTCAGCCCTTCCTGG - Intronic
1151955964 17:77380344-77380366 ATGCGGGGCTCAGACTCTACTGG + Intronic
1151959364 17:77397410-77397432 ATCCCGGGATGAGACTATCCTGG - Intronic
1152892586 17:82890955-82890977 CTCCTGGGCTCTCACTTTCCAGG - Intronic
1153572854 18:6490832-6490854 GTCCAGGGAGCAGACCTTCCTGG + Intergenic
1153676147 18:7457369-7457391 AGCCTGGGCTCAGCCTCTCCAGG + Intergenic
1153811634 18:8757204-8757226 ATCCCAGGTTCAGAATTTCCAGG + Intronic
1154265685 18:12876801-12876823 ATCCAGGGATCAGACTTGAAAGG - Intronic
1156063886 18:33116810-33116832 AACCAGGCCTGAGATTTTCCTGG - Intronic
1160857397 19:1223691-1223713 AGCGAGGGCTCAGACCTTTCAGG + Intronic
1161650697 19:5482708-5482730 ATCCAGGGCTGGTACTTTTCTGG - Intergenic
1162249488 19:9430309-9430331 GTCCAGGGCTCAGACTTTCCTGG + Intronic
1166912287 19:46167582-46167604 GACCAGGGCTCACACTTTACTGG + Intergenic
1168439972 19:56356245-56356267 GTTCGGGGCTCAGACTTTCCTGG - Intronic
925096204 2:1206028-1206050 ATGCAGAGCTCAGCATTTCCAGG - Intronic
925890728 2:8431957-8431979 ATCCAGCCTTCAGACTTTCATGG - Intergenic
926220996 2:10935356-10935378 ATCCAGGGCCAAGACTTTAAGGG + Intergenic
926739162 2:16096864-16096886 ATTCAGGGCTTACAGTTTCCTGG + Intergenic
927703253 2:25281218-25281240 ATCCAGGGCTCATTCAGTCCTGG - Intronic
928920953 2:36526742-36526764 GTCCAGGGGTCAGTCATTCCTGG + Intronic
930021390 2:47004108-47004130 CTCCAGAGCTCAGCCTTGCCGGG + Intronic
930610405 2:53536648-53536670 GTCCAGAGGACAGACTTTCCAGG - Intronic
930773087 2:55147331-55147353 ATTCAGGGCACTGACTTTCCCGG - Intergenic
934603502 2:95677060-95677082 ATCCAGGGTTTAGCCTCTCCAGG - Intergenic
935302644 2:101706727-101706749 ATCCAGGAAACAGACATTCCAGG - Intronic
936536890 2:113319287-113319309 ATCCAGGGTTTAGCCTCTCCAGG - Intergenic
937353659 2:121184794-121184816 ATCCAGGACTCAGACTTAGGTGG - Intergenic
938901692 2:135803911-135803933 AGCCAGGGCTGGGACTTACCTGG + Exonic
939580544 2:143941116-143941138 ATCTAGAACTCAGATTTTCCAGG - Exonic
943102573 2:183506193-183506215 TTCCAGGGCTCAGAAGTTCTAGG - Intergenic
945976188 2:216272901-216272923 ATAGGGAGCTCAGACTTTCCTGG + Intronic
946283041 2:218680197-218680219 ATCCAGGACTCAGACTCTCGAGG - Intronic
947142663 2:227033848-227033870 ATCCAGGCCTCACACCTCCCAGG + Intronic
947627317 2:231628108-231628130 ATGCAGGGCTCAGAAGGTCCTGG + Intergenic
948636121 2:239338847-239338869 ATCCAGGGCTCAGGGCCTCCAGG + Intronic
1170622610 20:18008191-18008213 AGCCAGGGACCAGACTGTCCCGG + Intronic
1172233369 20:33352331-33352353 ACCCAGATCTCTGACTTTCCAGG - Intergenic
1173253164 20:41375239-41375261 AGCCAGGGCTCCCACATTCCTGG + Intergenic
1173784504 20:45782921-45782943 AGGCAGGGCCCAGACTTTCGGGG - Intronic
1173998341 20:47357029-47357051 CTCCGGGCCTCAGGCTTTCCTGG - Intergenic
1174812745 20:53661010-53661032 ATCCAGGGCTGAACATTTCCTGG + Intergenic
1176874555 21:14115418-14115440 GTCCGGGGCTCAGACTTTTCTGG + Intronic
1176875687 21:14124695-14124717 GTCCGGGGCTCAGACTTTTCTGG + Intronic
1179189573 21:39111991-39112013 ATCCACATCTCAGACTTTCCGGG + Intergenic
1182860285 22:33553888-33553910 ACACAGGGCTCAGACTCTCACGG - Intronic
1182875158 22:33685193-33685215 ATCCAGTGCCCAGGGTTTCCAGG - Intronic
1183543658 22:38444120-38444142 ATCCAGCTCTCAGATCTTCCTGG + Intronic
1183658122 22:39202521-39202543 CTCCTAGGCTCAGACGTTCCTGG + Intergenic
1185161504 22:49232735-49232757 CTCCAGGGCTCAGCCGCTCCGGG + Intergenic
950427112 3:12930455-12930477 ATGCAGGGCTCTGACTGGCCTGG - Intronic
952173371 3:30834419-30834441 AGCCAGTGATCAGAATTTCCTGG - Intronic
952377985 3:32782754-32782776 GCCCAGGCCTGAGACTTTCCTGG - Intergenic
954520232 3:51218555-51218577 CTACAGGGTACAGACTTTCCAGG - Intronic
955888450 3:63625211-63625233 ATCAAGGGCTGAGACTTGACTGG + Intergenic
956459987 3:69462204-69462226 AACCAGAGCTCAGTCTTGCCGGG + Intronic
956717661 3:72092577-72092599 AGCAAGGGGTCAGAGTTTCCAGG - Intergenic
960513816 3:118580934-118580956 ACCCAGGGCTCCGGCTTTCTTGG - Intergenic
966613373 3:181890013-181890035 CTCCAGGCCTCAGCCTTTCCTGG - Intergenic
968739046 4:2318112-2318134 GTCCAGGGCCCAGGCTTCCCAGG - Intronic
971120406 4:23698054-23698076 ATCCAGGGCTGAGACTGTATTGG + Intergenic
975091578 4:70410357-70410379 ATACAGGGCTGAGACATTCAGGG + Intergenic
975626257 4:76351103-76351125 ATCCAGGGCCCTGAAGTTCCTGG + Exonic
975874271 4:78817594-78817616 ATACAAGGTTCAGAGTTTCCTGG - Intronic
975914131 4:79302881-79302903 ATCCAGGGATGAGCATTTCCAGG - Intronic
976853295 4:89574487-89574509 ATACAGTGCTGAGAATTTCCTGG - Intergenic
978051468 4:104205404-104205426 AGCAAGGGCTCAGACCTTCAGGG - Intergenic
978858221 4:113417740-113417762 TTCCATTGCTGAGACTTTCCAGG + Intergenic
979795949 4:124846930-124846952 ATACAGGGCTCAGACTTCTCAGG - Intergenic
979855270 4:125624400-125624422 ATTAAGAGCTCAGACTTTACTGG + Intergenic
980705689 4:136490247-136490269 ATCCTAGGCTGAGACTCTCCAGG + Intergenic
985030232 4:185781741-185781763 ATCCAGGGCCCTGGCTTGCCTGG + Intronic
985839443 5:2295209-2295231 ATCCAGGGCTGGGAGTTTGCAGG + Intergenic
988974902 5:36505423-36505445 ATCCAGGCCTGATTCTTTCCTGG - Intergenic
989260348 5:39412611-39412633 ATCCAGGACTGAGAATGTCCTGG + Intronic
994312085 5:98285131-98285153 ATCCAAGGCTCAGAACTTTCTGG - Intergenic
994837501 5:104874534-104874556 AACAAGTGGTCAGACTTTCCAGG + Intergenic
997864750 5:137451105-137451127 ACCCAGGACTCAAACTTTTCAGG + Intronic
998352588 5:141511240-141511262 ACCCAGGCCTCAGAGTTTCAGGG + Exonic
999782929 5:154865186-154865208 TTCCAGGACACAGAATTTCCAGG + Exonic
1000352367 5:160361962-160361984 ATGCAGGGCCCATACGTTCCTGG - Intronic
1001873692 5:175180918-175180940 ATCCAGAGCTCAAACTCACCAGG + Intergenic
1002400651 5:178990059-178990081 AGCCAGGGCTCAGCCTTTCCAGG + Intronic
1003493779 6:6646277-6646299 GTCCAGGGGTCAGACTATCTGGG - Intronic
1004462593 6:15852261-15852283 GTCCAGGACTGAGAGTTTCCTGG - Intergenic
1006739301 6:36295717-36295739 ATCCAGAGTTCAGATCTTCCTGG + Intronic
1007744664 6:44036217-44036239 ATCCAGGGCTCCCACTTGGCTGG - Intergenic
1008561127 6:52725672-52725694 ATTCAGGACTTAGTCTTTCCTGG + Intergenic
1009624881 6:66126567-66126589 AGCCAGAGCACAGACTTACCTGG - Intergenic
1010934451 6:81844827-81844849 AGCAATGGTTCAGACTTTCCAGG - Intergenic
1010970756 6:82260542-82260564 TTCCAGGGCTCAACTTTTCCTGG + Intergenic
1011408696 6:87043263-87043285 ATCCAGGAATCAAACTTTCATGG - Intergenic
1013211552 6:107991462-107991484 GTCCGGGGCTCAGACTTTACTGG + Intergenic
1017778803 6:157700269-157700291 ATCCAGGACAGAGCCTTTCCTGG + Intergenic
1018863522 6:167730628-167730650 ATCCAGGGCACAGCCTTGCAGGG - Intergenic
1021851499 7:24813236-24813258 ATCCAGTGCTGAGAATTTGCTGG + Intronic
1021939301 7:25663911-25663933 ATCCAGGACCCAGTCTTCCCTGG - Intergenic
1021942345 7:25690077-25690099 ATCCAGAGCTCAGACATTTTTGG - Intergenic
1023718868 7:43072558-43072580 GTCCGGGGCTCAGACTTTCCTGG - Intergenic
1024669339 7:51577786-51577808 ATCCAGTGTTCAGACTTCACAGG - Intergenic
1026438655 7:70423081-70423103 TTCCAGGGCTCTGACTTCACTGG - Intronic
1026443141 7:70460951-70460973 ACCCAGGGCTCACACCTGCCAGG - Intronic
1027829211 7:83155785-83155807 ATCCAGGCCTCAGACTAAACAGG - Exonic
1037928234 8:22861969-22861991 ATTCAGGGTTCAGACTTAGCGGG - Intronic
1038115872 8:24554605-24554627 AACCAGGACCCAGAGTTTCCAGG + Intergenic
1039509796 8:38081906-38081928 TGCCGAGGCTCAGACTTTCCTGG - Intergenic
1039510992 8:38091657-38091679 GTCCGAGGCTCAGACTTTCCTGG - Intergenic
1041508629 8:58629999-58630021 ATCCAGAGTTCTGACTTTTCAGG - Intronic
1042072256 8:64949135-64949157 TTCCAGGTTTCAGACTTTCATGG - Intergenic
1045663115 8:104458459-104458481 ATCCAGGGCTAAGAATTGCTTGG - Intronic
1047013818 8:120701283-120701305 ATCCAGGTCTCAGACTCCCAGGG - Intronic
1048215449 8:132489942-132489964 ATCCTGGTCTCAAACTTTACGGG + Intergenic
1050697376 9:8294126-8294148 TTGGAGGGCTCAGACTTTCATGG + Intergenic
1051765118 9:20514612-20514634 ATCAAGGGCACATTCTTTCCTGG - Intronic
1056742105 9:89266311-89266333 ATCCAGGGCACAGATTTCCAAGG - Intergenic
1057144752 9:92750279-92750301 ATCCAGCGATCAGACTCTTCAGG + Intronic
1058135699 9:101305504-101305526 CCCAAGGTCTCAGACTTTCCGGG + Intronic
1059428884 9:114238103-114238125 GTTCAGGGCTCAGAGCTTCCGGG + Intronic
1061087176 9:128405924-128405946 TTCCCGGGCACAGATTTTCCTGG - Intergenic
1061385204 9:130285527-130285549 GGCCAGGGCTCACACTTCCCTGG + Intronic
1062544697 9:137056159-137056181 ACGCAGGGCTCAGACCTCCCAGG + Intergenic
1186952190 X:14639012-14639034 ATCCAGGGTTCATACTTCCTTGG + Intronic
1193552921 X:82921170-82921192 CTCAAGGGTTCATACTTTCCTGG + Intergenic