ID: 1130153589

View in Genome Browser
Species Human (GRCh38)
Location 15:81331160-81331182
Sequence GTGGCTGCTTTCTTTATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 5, 2: 8, 3: 17, 4: 248}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130153589_1130153592 -5 Left 1130153589 15:81331160-81331182 CCCTGGATAAAGAAAGCAGCCAC 0: 1
1: 5
2: 8
3: 17
4: 248
Right 1130153592 15:81331178-81331200 GCCACCTTTTAAGCAGTCGGTGG 0: 3
1: 10
2: 1
3: 10
4: 93
1130153589_1130153597 11 Left 1130153589 15:81331160-81331182 CCCTGGATAAAGAAAGCAGCCAC 0: 1
1: 5
2: 8
3: 17
4: 248
Right 1130153597 15:81331194-81331216 TCGGTGGCCGGGAGTACGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 42
1130153589_1130153595 -1 Left 1130153589 15:81331160-81331182 CCCTGGATAAAGAAAGCAGCCAC 0: 1
1: 5
2: 8
3: 17
4: 248
Right 1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG 0: 2
1: 4
2: 4
3: 15
4: 80
1130153589_1130153591 -8 Left 1130153589 15:81331160-81331182 CCCTGGATAAAGAAAGCAGCCAC 0: 1
1: 5
2: 8
3: 17
4: 248
Right 1130153591 15:81331175-81331197 GCAGCCACCTTTTAAGCAGTCGG 0: 2
1: 2
2: 0
3: 7
4: 112
1130153589_1130153596 0 Left 1130153589 15:81331160-81331182 CCCTGGATAAAGAAAGCAGCCAC 0: 1
1: 5
2: 8
3: 17
4: 248
Right 1130153596 15:81331183-81331205 CTTTTAAGCAGTCGGTGGCCGGG 0: 1
1: 5
2: 4
3: 11
4: 72
1130153589_1130153598 15 Left 1130153589 15:81331160-81331182 CCCTGGATAAAGAAAGCAGCCAC 0: 1
1: 5
2: 8
3: 17
4: 248
Right 1130153598 15:81331198-81331220 TGGCCGGGAGTACGCGAGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130153589 Original CRISPR GTGGCTGCTTTCTTTATCCA GGG (reversed) Intergenic
900719235 1:4164592-4164614 TTGCTTGCTTTCTTTGTCCATGG + Intergenic
901350021 1:8586927-8586949 TGGGCTGCATTCTTAATCCAAGG - Intronic
902038984 1:13478950-13478972 GTGTCTGCTTTATATACCCAAGG + Intronic
905022261 1:34825912-34825934 GTGGCTGGGTGCTTTATCCCTGG - Intronic
905662469 1:39738107-39738129 GTGGCTGCTTTCCTACTACAAGG - Intronic
906645167 1:47469619-47469641 GTGACTGATTTCTATATTCATGG + Intergenic
907230670 1:52995641-52995663 GTGGCTGCTGTCTTTGTGGATGG + Intronic
909259169 1:73464879-73464901 GTGTCTGCGTTCCTTTTCCATGG - Intergenic
909905237 1:81186374-81186396 TTGGCTGCTGTCTTTATCTGAGG - Intergenic
911430046 1:97773903-97773925 GGGGCTTCTTTCTGTATCCTGGG - Intronic
914980414 1:152410158-152410180 GTGGCTGCTGTCCTGCTCCACGG + Exonic
917193139 1:172439970-172439992 TGGACTGCTTTCTATATCCAAGG - Intronic
917303504 1:173603658-173603680 GTGGCTGCTTTCTTTGTCCAGGG + Intergenic
917525901 1:175788246-175788268 GTGGCTCCCTTCCTTATTCATGG + Intergenic
918971998 1:191432214-191432236 ATGGTTGCTTTCTTTACGCAAGG + Intergenic
919449263 1:197751328-197751350 GTGACTTCTTTCTTGATCCGTGG - Intronic
920713994 1:208322234-208322256 GTCCCTGCTTTCTCTATCCAGGG + Intergenic
920922812 1:210312100-210312122 CTGGCTCCTTCCTTTACCCACGG + Intergenic
922319846 1:224477090-224477112 GAGGCTGCTTGCTTTCTCAATGG - Intronic
922729882 1:227944320-227944342 TTGTCTGCGTTCTTTCTCCACGG - Intronic
924020081 1:239771712-239771734 CTGGCTGCTTTCTTGATATAAGG - Intronic
924543076 1:244999674-244999696 GTAGTTCCTTACTTTATCCATGG + Intronic
1063548343 10:7003677-7003699 GAGACTGCTTTCTATATACAAGG - Intergenic
1064342743 10:14501361-14501383 GGGGCTGCTTTCCATAACCAAGG - Intergenic
1064971317 10:21069973-21069995 GTGGCTGCATTCTGGCTCCAGGG - Intronic
1066688502 10:38003530-38003552 GAGGCTGCATTCTTTGTCCAGGG - Intergenic
1066982923 10:42435844-42435866 GCGGCTGCTTTGTTTACCTAAGG - Intergenic
1067004127 10:42645450-42645472 GTGGCTGCATTCTTTCTCCAGGG + Intergenic
1067202597 10:44186282-44186304 TTGCCTTCTTTCTCTATCCATGG + Intergenic
1068556779 10:58467163-58467185 GTGGCTGCTATTTTTTTCCCAGG + Intergenic
1069115700 10:64503490-64503512 TTGGCTGTTTCCTTTTTCCATGG + Intergenic
1071988749 10:91078254-91078276 GTTGCTGCTTTATTTATAAATGG - Intergenic
1073814776 10:107194658-107194680 GTGGCTGGTTTCTGTATCAGTGG + Intergenic
1074044052 10:109820488-109820510 GTGGTTCCTTTCTTTGGCCAGGG - Intergenic
1075085622 10:119412585-119412607 GTGGTTCCTTTCTCTGTCCATGG - Intronic
1076208706 10:128623628-128623650 GTGGCTGGTTTCGTTGGCCACGG + Intergenic
1076920853 10:133454069-133454091 GTTTCTGCTTCCTTCATCCATGG + Intergenic
1077036834 11:499424-499446 GAGGCTGGTTTCTTTCTCCCGGG - Intronic
1079277518 11:19055814-19055836 GTGGCTGATTTTTTTATTCATGG - Exonic
1080578811 11:33624237-33624259 GAGGCTGTTCTCTTTAGCCAAGG + Intronic
1080888461 11:36388008-36388030 ATGGCTGCCTCCTTTAGCCAGGG + Intronic
1083366240 11:62143093-62143115 TTGGCAGCTTTCTCTGTCCAGGG + Intronic
1085280650 11:75328131-75328153 GTGTCTGCTTTCTGTCTCTATGG + Intronic
1085742363 11:79088192-79088214 GGGGCTGCTTGCTCTCTCCAGGG + Intronic
1091405742 12:208211-208233 GTGGTTTCCTTCTTCATCCAGGG - Intronic
1091965150 12:4734548-4734570 TTCGCTTCTTTCTTTCTCCAGGG + Intronic
1093756071 12:22853486-22853508 CTGGATGCTTTCCTTATTCAGGG + Intergenic
1094268298 12:28583723-28583745 GTTGTTGGTTTCTTTTTCCATGG + Intergenic
1094342514 12:29428730-29428752 TTTGATGCTTTCTTTTTCCAGGG - Intronic
1095524791 12:43112546-43112568 CTGTCTGCTTTCTTTATCTCTGG - Intergenic
1095592093 12:43915028-43915050 CTGGCTGCTTTCTTTCCTCATGG + Intronic
1096193318 12:49633803-49633825 CTGGCTGGTTTCTCTATCCTGGG - Intronic
1101682579 12:106984097-106984119 GTCACAGCTTTCATTATCCAGGG + Intronic
1102327334 12:111998458-111998480 ATGGCTGCTTTTCTTCTCCAGGG - Intronic
1107346723 13:39469414-39469436 GTGGCTGATATCTTTCTTCATGG + Intronic
1107490283 13:40874910-40874932 GTGGCTGCTTTCTTTGTCCAGGG + Intergenic
1107939620 13:45372332-45372354 GTTCCTGCTTTCTCTCTCCACGG - Intergenic
1108454897 13:50603584-50603606 GTAGCTGCTTTCTTTCTTTAGGG + Intronic
1108464579 13:50702034-50702056 GTGGCTGGTTTCATAAGCCAAGG + Intronic
1108745295 13:53387339-53387361 GTGGCTGCTTTCATGTTACAAGG + Intergenic
1109221294 13:59643491-59643513 CTATTTGCTTTCTTTATCCAAGG + Intergenic
1110141726 13:72138817-72138839 GAAGCTTCTATCTTTATCCATGG - Intergenic
1110553897 13:76836931-76836953 GTGCCTGCTTTCTTTTCCCAGGG + Intergenic
1111567834 13:90039966-90039988 GGTGCTGGTTTGTTTATCCAAGG + Intergenic
1112111049 13:96299469-96299491 GTGGCCGTTTTCTCTATGCATGG - Intronic
1112419216 13:99232558-99232580 TTAGCTGCTTGCTTTATCCTAGG - Intronic
1112604518 13:100890847-100890869 GTGGCTGACTCCTTAATCCAGGG - Intergenic
1112956376 13:105063956-105063978 GTGCCTGCTCTCATTATCCTCGG - Intergenic
1113179920 13:107613046-107613068 GTGGCTGCTCCCTTCCTCCAGGG - Intronic
1114169662 14:20259454-20259476 TTGGCTGCTTACTTTTTCCTAGG + Intronic
1114993532 14:28318044-28318066 CTGGCTGCTTTGTTTACCTACGG + Intergenic
1116864097 14:50017399-50017421 ATGGCTGCTTTCTCTCTTCATGG + Intergenic
1116885858 14:50220430-50220452 CTGAGTGCTTTCTTTATGCAGGG - Intronic
1118604498 14:67492756-67492778 GTAGCTGGTTTATTTATTCAAGG + Intronic
1122006601 14:98709916-98709938 GTGGCTGCTTTCCTGATACAAGG - Intergenic
1122114211 14:99519854-99519876 GTTGGTGCTTTCTGTTTCCACGG - Intronic
1122807453 14:104267173-104267195 GTGGCTGCTCTCCCTTTCCAAGG + Intergenic
1123223429 14:106877880-106877902 GTGGCTGCTTTCTTTGTCCAGGG + Intergenic
1125226786 15:37404992-37405014 CTGGCTGCTTTGTTTACCTAAGG + Intergenic
1125471237 15:40005921-40005943 TTGGGTGGTTTCTGTATCCATGG + Intronic
1125556567 15:40590710-40590732 GTGGCTACTTTCTTTGTCTGGGG - Intergenic
1126493488 15:49265239-49265261 CTGGCTGCTTTATTTACCTAAGG + Intronic
1126789995 15:52212267-52212289 GTGCCTGCTTTCCCTATTCAAGG - Intronic
1126936789 15:53719028-53719050 GTGGCTGATGTATTTATCCATGG - Intronic
1128599581 15:68984525-68984547 GTGGCTGCTTTCTTTGTCCAGGG + Intronic
1129125883 15:73440928-73440950 GTTGGTGCTTTCTATTTCCAGGG - Intergenic
1129133883 15:73528733-73528755 GTGGCTGCTTTCGTGCTACAAGG + Intronic
1129135162 15:73542518-73542540 GTGGATGCTTTCCTTATAAAAGG - Intronic
1129377696 15:75144614-75144636 GTAGCTCCTTTCTGTAGCCAGGG + Intergenic
1129482309 15:75837323-75837345 GTGGGTGCTTTCTATGTCCCAGG + Intergenic
1129671527 15:77610481-77610503 GAGGCTGCTTTCTTCATGCCTGG - Intergenic
1129733443 15:77944758-77944780 GTGGATGCTGTTTTTTTCCAGGG - Intergenic
1130153589 15:81331160-81331182 GTGGCTGCTTTCTTTATCCAGGG - Intergenic
1131014779 15:89049431-89049453 CTGGCTGCTTTGTTTACCTAAGG + Intergenic
1131235954 15:90697339-90697361 GTGGCTGCATCCTTTGCCCAAGG - Intergenic
1131527266 15:93162444-93162466 GTGGCTGCTTTCTTTGTCCGGGG - Intergenic
1131534283 15:93221668-93221690 GTGGCTGCTTTCTTTGTCCGGGG - Intergenic
1131549517 15:93344978-93345000 GTGGCTGCTTTCTTTGTCCGGGG + Intergenic
1132465521 16:75701-75723 GTGGCTGCCTTCTCTGCCCAAGG + Intronic
1133502465 16:6378951-6378973 ATTGCTACTTTCTTTTTCCAGGG - Intronic
1134184711 16:12075833-12075855 CTGGCTGCTTTGTTTACCTAAGG + Intronic
1135025795 16:18998098-18998120 GTGGCTGCTTTCCTGCTACAAGG + Intronic
1137630924 16:49944190-49944212 GTGGCTGTTTGCTTTCTCCCAGG - Intergenic
1137914336 16:52412377-52412399 GTGGCTTCTTTTTTTATCACTGG - Intergenic
1141697591 16:85627476-85627498 GTGGCAGCTTTTTTTTTCCTGGG + Intronic
1146620096 17:34390540-34390562 GTGGCTGCTTGTTTTCTTCAGGG - Intergenic
1149690093 17:58568249-58568271 TTGGTTTCTTTCTTTTTCCATGG - Intronic
1150063807 17:62091826-62091848 TTGGCTGCTATCTTGATCCTAGG + Intergenic
1150150067 17:62801943-62801965 GTGGCTGCATTATTTATGCCTGG - Intronic
1152687496 17:81701803-81701825 GTCTCTGCTTTCTTTCCCCAGGG + Exonic
1153083154 18:1251933-1251955 GTGTCTGCTGGCTTTTTCCAGGG + Intergenic
1153526272 18:5997900-5997922 GTAGCTGCTTTTGGTATCCATGG + Intronic
1154965197 18:21348993-21349015 GTGGCTGCCCTCTGTCTCCAGGG + Intronic
1157035565 18:43969019-43969041 ATGGCTGCTTTCTTACTCAAGGG - Intergenic
1157549846 18:48573926-48573948 GTGGCTGGTGTCATTACCCAGGG + Intronic
1158103860 18:53861664-53861686 GTGGCTGATCTCTTTATTAAAGG + Intergenic
1160105745 18:75974290-75974312 GTGGCAGCTGTCTTTATAGACGG - Intergenic
1160467767 18:79096323-79096345 GAGGCTGCTTTCTTTTGCAAAGG - Intronic
1160849289 19:1182382-1182404 TTGGCTCCTTTCTTCATCCTCGG - Intronic
1162249487 19:9430294-9430316 GTGGCTGCTTTCTTTGTCCAGGG + Intronic
1164041195 19:21494098-21494120 GTGACTGTTTTCTTTTTCCTAGG + Intergenic
1164203265 19:23036106-23036128 GTGGCTGCTTTCTTTGTCTGGGG - Intergenic
1164702624 19:30296588-30296610 GTGGCTGCCATCTCTAACCATGG + Intronic
1165304884 19:34997536-34997558 GTGGCTGCTTGTTCTATTCAGGG - Intronic
1168439973 19:56356260-56356282 GTGGCTGCTCTCTTTGTTCGGGG - Intronic
1168463878 19:56586410-56586432 GTGGCTGGTTCCTTTATACAAGG - Intronic
925047112 2:780805-780827 AAGGCTGCTGTCTGTATCCAAGG - Intergenic
926112021 2:10189555-10189577 GTGGCTGCTTTCTTTGGTCTGGG + Intronic
926421622 2:12705327-12705349 ATGGCAGCTTGCTTTATCCAGGG - Intergenic
928231140 2:29499911-29499933 GTGGTTGCTTTTCTTATTCATGG + Intronic
928661708 2:33508463-33508485 GTGGCCCTCTTCTTTATCCAAGG - Intronic
928999774 2:37335076-37335098 GTTACTGCATTCTTTATCTATGG + Intergenic
929540402 2:42815009-42815031 TTTGCTGTTTTCTTTATCCCAGG + Intergenic
932160597 2:69455952-69455974 ATGGCTGCTTTTGCTATCCAAGG - Intergenic
932501023 2:72182718-72182740 CTGGCTGCCTTCTCTATCCTTGG - Intronic
933624019 2:84578031-84578053 ATGGCTGCTTTCTTCCTACAAGG + Intronic
933947823 2:87302126-87302148 GTTGCTGCTTTTGTTGTCCAAGG - Intergenic
934151665 2:89153315-89153337 GTAGCTGCTCTCTTGAGCCATGG + Intergenic
934215595 2:90028591-90028613 GTAGCTGCTCTCTTGAGCCATGG - Intergenic
936264937 2:110996859-110996881 TTGGCTGCTTTCTGCTTCCAGGG - Intronic
936899341 2:117466402-117466424 GTGTCTGCTTGCTTTCTCAATGG - Intergenic
937014923 2:118596556-118596578 TTGTCAGCTTTCTTTTTCCAGGG + Intergenic
939867889 2:147495048-147495070 GTGGTTACTTTCTTTATTGAAGG - Intergenic
940637354 2:156315091-156315113 GGGGCAACTTTCTTTGTCCAGGG - Intergenic
942327132 2:174785567-174785589 ATGGCTGCTTCCTTTACCCCAGG + Intergenic
943287479 2:186021322-186021344 ATGGTTGCCTTCTTTATTCACGG + Intergenic
944257639 2:197640277-197640299 CTGGCTGCTTTGTTTACCTAAGG + Intronic
946897066 2:224334766-224334788 GTGGTTGCTTGCTTTATCAGTGG - Intergenic
947547521 2:231020950-231020972 GAGGCAGCTTACTTTAGCCAAGG - Intronic
1171068788 20:22046129-22046151 CTGGCTGCTTTGTTTACCTAAGG + Intergenic
1171281432 20:23902516-23902538 CTGGCTGCTTTGTTTACCTAAGG + Intergenic
1173903513 20:46608348-46608370 GTGGCTGCTTTCTCACTGCAAGG + Intronic
1174795484 20:53518978-53519000 GTGGCTGCTTTCCTGGTGCAAGG - Intergenic
1174798527 20:53542775-53542797 GTGGCTGCTTTCCTGCTGCAAGG - Intergenic
1174868023 20:54156754-54156776 GTGGCTGCTTTCATGTTCCAAGG + Intronic
1175356443 20:58372668-58372690 GTGCCTGCTTTTTTTTGCCATGG + Intergenic
1176874554 21:14115403-14115425 GTGGCTGCTTTCTTTGTCCGGGG + Intronic
1176875686 21:14124680-14124702 GTGGCTGCTTTCTTTGTCCGGGG + Intronic
1177811885 21:25933689-25933711 GTGGCTGTTTTAATTAGCCAGGG - Intronic
1178209551 21:30513652-30513674 GGGACTGCTTTCCTTTTCCATGG - Intergenic
1179180306 21:39038994-39039016 ATGGCAGCCCTCTTTATCCATGG - Intergenic
1179469524 21:41601327-41601349 GTGGCTGTTTTGCTTAACCAGGG - Intergenic
1181349746 22:22246453-22246475 GTGGCTGCTTTCTTGCTACTAGG - Intergenic
1182069097 22:27450870-27450892 GGGGCTGCCTTCATCATCCAGGG - Intergenic
1182098439 22:27641548-27641570 GTGTCTGCTGATTTTATCCAGGG - Intergenic
950023556 3:9805878-9805900 GAGGTTGCTTTCTTTAGGCATGG - Intronic
952039013 3:29239213-29239235 CTGGCTGCTTTGTGTATCAATGG + Intergenic
953216852 3:40926806-40926828 GTGACTGTTTGCTCTATCCAGGG + Intergenic
953374792 3:42419668-42419690 GAGACTGCTTTTTTTATCAATGG - Intergenic
953500286 3:43426507-43426529 GAGGCTGTTTTCTTTCTCAAAGG + Intronic
953667106 3:44933375-44933397 GTGGCTGCTCACTTGACCCAGGG - Intronic
953801545 3:46027678-46027700 CAGGCTCTTTTCTTTATCCAGGG - Exonic
953861667 3:46549495-46549517 GTGGCTGTTTTCCTTATCTTGGG + Intronic
954932551 3:54296701-54296723 CTGGCTGTTTTCTTTGTACACGG + Intronic
955194289 3:56790731-56790753 GTGGGTGCTTTCTGAACCCAAGG - Intronic
955544819 3:60017244-60017266 TCGTCTGCTTTCTTTTTCCAAGG - Intronic
955683929 3:61530868-61530890 GTGGGTGGTTTGTTTATCTAGGG - Intergenic
956971596 3:74532626-74532648 TTGAATCCTTTCTTTATCCAGGG - Intergenic
959595467 3:108124511-108124533 TCTGCTGCTTTCTTTGTCCATGG + Intergenic
960703048 3:120455771-120455793 GTGGGTGCTTTCATCTTCCAGGG + Intergenic
962686389 3:137851976-137851998 GTTGCTCCTTTCTTTATTAAAGG + Intergenic
962881709 3:139583961-139583983 GTGACTTCTTTCTTTTTCCTTGG + Intronic
964485447 3:157180874-157180896 GTGGCTGCTGTTTTTAAACAAGG + Intergenic
964996588 3:162889944-162889966 ATGGGTGCTTTCTTTATGGAAGG - Intergenic
965393665 3:168135286-168135308 TTGACTGCTATCTTTAACCATGG - Intergenic
966876043 3:184322275-184322297 TTGGCTGCTTTCTATTTCCCAGG + Intronic
967136041 3:186513446-186513468 GTGGCAGCTTTATCTCTCCATGG - Intergenic
970486529 4:16530249-16530271 GTGGCTGCTCTCCTTGTTCAAGG + Intronic
971099202 4:23444320-23444342 GTGTGTGTTTTCTTTATGCATGG - Intergenic
971208107 4:24589721-24589743 ATGGCAGCTTTCTTTAGCCATGG - Intergenic
974109533 4:57510859-57510881 TTGGCTGCTTTGTTGGTCCAAGG + Intergenic
974666404 4:64968592-64968614 ATGCCTGCTTCCTTTCTCCATGG - Intergenic
978498508 4:109384849-109384871 GTAGCTGCTCTCTGTAGCCAGGG - Intergenic
979808921 4:125011553-125011575 ATAGTTGCTTTCTTTACCCATGG + Intergenic
980001260 4:127491167-127491189 GTGGTTCTTTTCTTTATACATGG - Intergenic
980546724 4:134273294-134273316 GTGACTGCTCTTTATATCCAAGG + Intergenic
981987191 4:150872056-150872078 GTGGCTGCTTTCATGATACAAGG - Intronic
982221152 4:153126280-153126302 CTAGCTGCTTTCTTTATATATGG + Intergenic
982818122 4:159911652-159911674 GTGCCTGCTTTCTTAATAAACGG - Intergenic
983312442 4:166081804-166081826 GTTCCAGCTTTCTATATCCAAGG + Intronic
983488087 4:168354891-168354913 CTTGCTGCCTACTTTATCCATGG + Intergenic
985356893 4:189130765-189130787 GTGGCTGCTGACTTTATGAAGGG + Intergenic
986993528 5:13580114-13580136 GTGGCTTCCTTCTTTCTCCCGGG + Intergenic
988666604 5:33335700-33335722 ATGGCTTCTGTCTTTAACCAAGG - Intergenic
988686765 5:33532918-33532940 GTGGCTGGTTTCTTAAATCAAGG + Intronic
990235408 5:53761983-53762005 GTGTCAGTTTTCATTATCCAAGG - Intergenic
990341384 5:54826596-54826618 CTGGCTGCTCTCTGTAACCATGG - Intergenic
992781129 5:80128991-80129013 ATGGCTGCTGTCTTGAACCAAGG - Intronic
993255017 5:85579812-85579834 GTGCCTACTTTATTTATCTATGG - Intergenic
993513845 5:88804801-88804823 TTGGCTGCTTTCTTTTTTCTAGG - Exonic
994363100 5:98878240-98878262 GTGACTGCTCACTTTCTCCAAGG - Intronic
994750128 5:103727005-103727027 TTTGCTACTTTCTTTATACATGG - Intergenic
998264079 5:140653917-140653939 GTGGCCTCTTTCATTATACAGGG + Exonic
998921786 5:147076861-147076883 GTGAGTGCTTACTATATCCAGGG - Intronic
998964493 5:147524579-147524601 GTGCTTGCATTCTTTATTCATGG - Intergenic
1001022803 5:168197882-168197904 GTGGCTGATTTCTTTGCCAATGG - Intronic
1002549013 5:179973249-179973271 GTGGCTGTTCTCTTCACCCATGG + Intronic
1003412856 6:5880847-5880869 GTGGCTGCTTTCTTCTAGCAAGG + Intergenic
1003492885 6:6639367-6639389 GTCCCTCCTTTCTTAATCCAAGG + Intronic
1003593161 6:7452835-7452857 GTGACAGCTTTCTGTATCCCAGG - Intergenic
1004035279 6:11917416-11917438 GTGGCTTCTTTCTCTTTACATGG - Intergenic
1004290269 6:14360682-14360704 TCGGCAGCTTTCTTTAGCCATGG + Intergenic
1004475309 6:15966087-15966109 GTGCCTGCTTTCTAATTCCATGG - Intergenic
1004966059 6:20853023-20853045 GTGGCTGCTTTCATGCTACAAGG - Intronic
1006268792 6:32948588-32948610 GTGGCTTCTTTCTTAACTCATGG - Intronic
1006577316 6:35056065-35056087 GTTTCTGCTTTCTGTGTCCAAGG + Intronic
1006928235 6:37671104-37671126 GAGGCTGTTTTCCTTTTCCATGG - Intronic
1007734600 6:43972698-43972720 CAGGCTGCTTTCTTTCCCCAAGG - Intergenic
1009029610 6:58040831-58040853 GAAGCTGCTTTCTTTAACAAAGG + Intergenic
1009205147 6:60792220-60792242 GAAGCTGCTTTCTTTAACAAAGG + Intergenic
1009259316 6:61463763-61463785 GTGGTTGCTGTGTTTATCCTGGG - Intergenic
1010119932 6:72363711-72363733 TTGGCTTGTTTCTTTAACCAGGG + Intronic
1012517085 6:100074348-100074370 GTGGCTTCATTTTTAATCCAAGG + Intergenic
1013005591 6:106070334-106070356 GTATCTGCTTTTTTAATCCAGGG + Intergenic
1013211551 6:107991447-107991469 GTGGCTGCTTTCTTTGTCCGGGG + Intergenic
1013711285 6:112902582-112902604 ATGGCTGCTTTCTCTAGCTAAGG + Intergenic
1015830303 6:137361870-137361892 GGGGCTGATTTCTTCATCCTAGG + Intergenic
1016052572 6:139545178-139545200 GTGCCTCCTTCCTTTAACCAGGG - Intergenic
1016216874 6:141615148-141615170 ATTGCTGCTTTCTTTTTTCAGGG + Intergenic
1017445411 6:154503011-154503033 GTAGCTCCATCCTTTATCCATGG - Intronic
1018249050 6:161849983-161850005 TTGGCTGCTTACTCTATCCTTGG - Intronic
1019661376 7:2225862-2225884 GTGGCTGCATTCTCTGACCAGGG + Intronic
1020671171 7:11114828-11114850 GTGGCTGCTGTCTTAATCAATGG - Intronic
1020699189 7:11456710-11456732 ATGGCTGCTTTCATGATACAAGG - Intronic
1021853295 7:24829528-24829550 CTTGCTGCTCTCTTTATCAATGG - Intronic
1022765605 7:33408104-33408126 CTGGCTGCTTTGTTTACCTAAGG + Intronic
1023017627 7:35983093-35983115 GTGGGTGCTTTCTTCATGCTGGG - Intergenic
1023718869 7:43072573-43072595 GTGGCTGTTTTCTTTGTCCGGGG - Intergenic
1027389410 7:77690404-77690426 ATAACTGCTTTCTTTATACAAGG + Intergenic
1028465098 7:91142292-91142314 GTGGCTGCCTTCTTTAGCAAAGG + Intronic
1028660312 7:93264765-93264787 GTGCCTGCTTTCTTCCTCTAAGG + Intronic
1032746748 7:134793733-134793755 GTGGATGCTTATTCTATCCATGG + Intronic
1034744464 7:153510746-153510768 GTGACTACCTCCTTTATCCAGGG + Intergenic
1036929998 8:12946930-12946952 GTAGCTGCTGCCTTTATCCAAGG - Intronic
1037581679 8:20249296-20249318 ATGGCTTCTTTCTATTTCCAAGG + Exonic
1039510993 8:38091672-38091694 GTGGCTGCTTTCTTTGTCCGAGG - Intergenic
1041157801 8:55005854-55005876 GTGGCTGTCTTCTTTCTCTAGGG + Intergenic
1044396004 8:91713526-91713548 ATGGCTGATTTCATTATCTAAGG + Intergenic
1044770985 8:95633774-95633796 GTGGCTGCTTTCTCTTACCAGGG - Intergenic
1044836254 8:96298179-96298201 GTGGCTGCATTCTTAACCCCAGG - Intronic
1045381888 8:101635511-101635533 TTTGCTGCTTTCTTTAAACATGG - Intronic
1048621842 8:136142151-136142173 CTGGCTGCCTGCTTTTTCCAGGG + Intergenic
1051458738 9:17290551-17290573 CTGGCTGCTTTGTTTACCTAAGG + Intronic
1051658461 9:19404785-19404807 GTGCCTGCATTTTTTACCCAAGG + Intergenic
1051982683 9:23042941-23042963 GTCCCAGCTTTCTTCATCCAAGG - Intergenic
1054362725 9:64192655-64192677 GTGGTTGCTGTGTTTATCCTGGG - Intergenic
1057845136 9:98517109-98517131 GAGGCTGCCTCCTTTATTCAAGG - Intronic
1058341918 9:103908052-103908074 CTGGCTGTACTCTTTATCCAAGG + Intergenic
1061607840 9:131724865-131724887 GTGGCTGCTGTTTTTAAACAGGG - Intronic
1187392431 X:18894854-18894876 TTGGCTCCTTTCTTTCACCAGGG + Intronic
1192229481 X:69255275-69255297 TTGGCTGCTTTCTTGATTCTTGG + Intergenic
1192485037 X:71517712-71517734 GTGCCTGGATTCTTGATCCATGG + Intronic
1192486327 X:71530237-71530259 GTGACTGGTTACTTCATCCAGGG + Intronic
1193033523 X:76924823-76924845 CTGGCTGCTTTGTTTACCTAAGG - Intergenic
1194307987 X:92272120-92272142 ATGTCTGCTTTTTTTATCAAGGG + Intronic
1194561340 X:95425341-95425363 GTAGCGTCTTTCTTTATCCTTGG - Intergenic
1195104041 X:101585706-101585728 TTGGCTGCTTTGTTTACCTAAGG + Intergenic
1198664690 X:139007858-139007880 GTGTCTGCTTGCTTTCTCAATGG + Intronic
1200308262 X:155051114-155051136 GTGCCTGCTGTTTTTATCAAGGG + Intronic