ID: 1130153590

View in Genome Browser
Species Human (GRCh38)
Location 15:81331161-81331183
Sequence GGTGGCTGCTTTCTTTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 11, 2: 4, 3: 19, 4: 201}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130153590_1130153592 -6 Left 1130153590 15:81331161-81331183 CCTGGATAAAGAAAGCAGCCACC 0: 1
1: 11
2: 4
3: 19
4: 201
Right 1130153592 15:81331178-81331200 GCCACCTTTTAAGCAGTCGGTGG 0: 3
1: 10
2: 1
3: 10
4: 93
1130153590_1130153597 10 Left 1130153590 15:81331161-81331183 CCTGGATAAAGAAAGCAGCCACC 0: 1
1: 11
2: 4
3: 19
4: 201
Right 1130153597 15:81331194-81331216 TCGGTGGCCGGGAGTACGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 42
1130153590_1130153596 -1 Left 1130153590 15:81331161-81331183 CCTGGATAAAGAAAGCAGCCACC 0: 1
1: 11
2: 4
3: 19
4: 201
Right 1130153596 15:81331183-81331205 CTTTTAAGCAGTCGGTGGCCGGG 0: 1
1: 5
2: 4
3: 11
4: 72
1130153590_1130153598 14 Left 1130153590 15:81331161-81331183 CCTGGATAAAGAAAGCAGCCACC 0: 1
1: 11
2: 4
3: 19
4: 201
Right 1130153598 15:81331198-81331220 TGGCCGGGAGTACGCGAGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1130153590_1130153595 -2 Left 1130153590 15:81331161-81331183 CCTGGATAAAGAAAGCAGCCACC 0: 1
1: 11
2: 4
3: 19
4: 201
Right 1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG 0: 2
1: 4
2: 4
3: 15
4: 80
1130153590_1130153591 -9 Left 1130153590 15:81331161-81331183 CCTGGATAAAGAAAGCAGCCACC 0: 1
1: 11
2: 4
3: 19
4: 201
Right 1130153591 15:81331175-81331197 GCAGCCACCTTTTAAGCAGTCGG 0: 2
1: 2
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130153590 Original CRISPR GGTGGCTGCTTTCTTTATCC AGG (reversed) Intergenic
901039143 1:6353897-6353919 CGTGGCTGCCTTCTTTCTCTGGG + Intronic
901340010 1:8489073-8489095 GGTGGCTCATGTCTTAATCCCGG + Intronic
905400501 1:37699285-37699307 GTTGCCTGCTTACTTTCTCCTGG + Intronic
907915560 1:58865689-58865711 GGTGTCTGCTTTCTTTGTGAAGG + Intergenic
909135050 1:71787471-71787493 GGTAGCTGCTCTCTTTAGACAGG - Intronic
911430047 1:97773904-97773926 AGGGGCTTCTTTCTGTATCCTGG - Intronic
911543008 1:99181863-99181885 ACTGGCTGCTTTATTTCTCCCGG - Intergenic
912153644 1:106888736-106888758 GGTGGCTGATGTCTTTTTCAGGG + Intergenic
917303503 1:173603657-173603679 GGTGGCTGCTTTCTTTGTCCAGG + Intergenic
918279480 1:182989891-182989913 CATTGCTGCTTTATTTATCCAGG + Intergenic
918610149 1:186480521-186480543 TGTGGCTGCTTTCTTTACCCTGG + Intergenic
920713993 1:208322233-208322255 AGTCCCTGCTTTCTCTATCCAGG + Intergenic
921664402 1:217850522-217850544 GGAGGATGCCTTCCTTATCCTGG + Intronic
923085974 1:230703874-230703896 GGTGCTTGCTGTCTTCATCCCGG + Intronic
923519442 1:234724712-234724734 GCTCGCTGCTCTGTTTATCCTGG - Intergenic
1063943560 10:11155827-11155849 GCTGGCTGCCTTCCTTAGCCTGG + Intronic
1064591103 10:16891517-16891539 GGTGGCTCCTTGCTGTATTCAGG - Intronic
1066688503 10:38003531-38003553 GGAGGCTGCATTCTTTGTCCAGG - Intergenic
1067004126 10:42645449-42645471 GGTGGCTGCATTCTTTCTCCAGG + Intergenic
1067350009 10:45466918-45466940 TGTGGCTGCTTCCTTGATCCAGG - Intronic
1067437403 10:46287711-46287733 GGTGGCTTTTTTCCTCATCCAGG - Intronic
1069747482 10:70725069-70725091 GGTTGATGGTTTCTTTATCTCGG + Intronic
1073454098 10:103626253-103626275 GGCGGCTGCTTACTTTGGCCTGG + Intronic
1073583279 10:104686442-104686464 GGTTGTTACTTTATTTATCCAGG - Intronic
1074044053 10:109820489-109820511 GGTGGTTCCTTTCTTTGGCCAGG - Intergenic
1074227758 10:111504234-111504256 GGTGGCTAATTTCCTTATTCCGG + Intergenic
1074563611 10:114556384-114556406 GGTGACTGCTCACTTTATACGGG + Intronic
1074670279 10:115782521-115782543 GGTGGCTGATTTCATTCACCTGG + Intronic
1077036835 11:499425-499447 AGAGGCTGGTTTCTTTCTCCCGG - Intronic
1077724314 11:4658860-4658882 GGTGGCTCCTTTCTTTGTCCAGG - Intergenic
1077807317 11:5603149-5603171 GGTGTCTGACCTCTTTATCCAGG + Intronic
1077810413 11:5630816-5630838 GGTGACTGTTTACTTTATTCTGG + Intronic
1077928538 11:6706874-6706896 GGATGCTGCTTTCTTCATACAGG + Intergenic
1078663561 11:13306284-13306306 GGTGGCTGCTGCCTGTGTCCAGG + Intronic
1078876541 11:15404008-15404030 GCTGTCTGCTTTCTTTTTCCTGG + Intergenic
1081578980 11:44339088-44339110 GGTGGGTGCCTTCTTTAGACTGG + Intergenic
1082192003 11:49257215-49257237 GGTCGCATCTTTCTTTACCCAGG - Intergenic
1082959531 11:58905640-58905662 AGTGACTGCTTAGTTTATCCTGG + Intronic
1082979499 11:59106837-59106859 GGTGATTGCTTAGTTTATCCTGG + Intergenic
1083268838 11:61560475-61560497 GGTGGCTGCTGTCATCTTCCAGG + Intronic
1084599357 11:70135758-70135780 GACGGCTTCTTTCTTCATCCGGG - Intronic
1085362350 11:75901646-75901668 GGTGGCTGCTACTTTTTTCCTGG + Intronic
1086637493 11:89106879-89106901 GGGGGATACTTTTTTTATCCTGG + Intergenic
1087117455 11:94541027-94541049 GGAGGCTGGTTTCTTTCTCTGGG - Intergenic
1088011255 11:105003552-105003574 GGAGTCTGCTTTCTCTATCAGGG - Intronic
1088015724 11:105057068-105057090 GATTTCTGCTTTCTTTATCAGGG - Intronic
1088405478 11:109471308-109471330 GGTGGCTTCTTTCATCATCTGGG + Intergenic
1089128926 11:116197158-116197180 GGTGGCTGCTTGCCTTATGTGGG + Intergenic
1089612659 11:119678126-119678148 GGTGGCTCCTTTCCTTACCGTGG + Intronic
1090463340 11:126911226-126911248 GGTGGCTGCTTTTTATTTGCTGG - Intronic
1091405743 12:208212-208234 GGTGGTTTCCTTCTTCATCCAGG - Intronic
1091770648 12:3148985-3149007 GGTGGCTGCCTCCTGGATCCTGG + Intronic
1095466477 12:42492504-42492526 GCTGGCTGTTTTCTTCTTCCAGG - Intronic
1095728293 12:45475743-45475765 TCTGGCTGCTTTCTTTATTGTGG + Intergenic
1096193319 12:49633804-49633826 GCTGGCTGGTTTCTCTATCCTGG - Intronic
1099829517 12:87822670-87822692 GGTGTCTGCTGTATTTATTCTGG - Intergenic
1100018388 12:90040161-90040183 GGTGGCTGCCTATTTTATTCAGG - Intergenic
1101691897 12:107090616-107090638 GGGGGCTGTTTTGTTTATACTGG + Intronic
1102639325 12:114352671-114352693 GGTGGGTGCTTGCTTTAGACTGG - Intergenic
1103340812 12:120220290-120220312 GGTGGCTGCTTTCTCTTGCTTGG - Intronic
1103575808 12:121876429-121876451 GGTGGCTGTTTTCCCTATCATGG - Intergenic
1106085931 13:26541615-26541637 GGTTTCTCCTTTCTATATCCCGG + Intergenic
1107490282 13:40874909-40874931 GGTGGCTGCTTTCTTTGTCCAGG + Intergenic
1107841201 13:44459401-44459423 GGTGGCTGCTTTCTGCAGGCAGG - Intronic
1109951639 13:69508013-69508035 AGTGACTGCTTTCATTATCGTGG + Intergenic
1110553896 13:76836930-76836952 TGTGCCTGCTTTCTTTTCCCAGG + Intergenic
1111364133 13:87219126-87219148 GGAGGATGTCTTCTTTATCCTGG - Intergenic
1112604519 13:100890848-100890870 GGTGGCTGACTCCTTAATCCAGG - Intergenic
1113385366 13:109843148-109843170 TGTGGCTGCTTTCTCTTCCCTGG - Intergenic
1114668404 14:24395740-24395762 GGTGGCTGTGATCTTTACCCAGG + Intergenic
1115064577 14:29242100-29242122 GGAGGCTGCTTTTTTTTTTCAGG - Intergenic
1118211333 14:63768631-63768653 GGCTGCTTCTTTCTTTGTCCTGG - Intergenic
1118775219 14:68969679-68969701 GGAGGCTGCCCTCTTTTTCCTGG + Intronic
1122279083 14:100610665-100610687 GGTGGTTGCTTTCCTTGGCCTGG - Intergenic
1122508238 14:102245825-102245847 GGTGGGAGCTCTCTTTAACCTGG - Intronic
1123223428 14:106877879-106877901 GGTGGCTGCTTTCTTTGTCCAGG + Intergenic
1124521867 15:30411648-30411670 AGTGGCTGTTCTCTTTGTCCTGG + Intronic
1124536797 15:30554571-30554593 AGTGGCTGTTCTCTTTGTCCTGG - Intronic
1124543270 15:30606624-30606646 AGTGGCTGTTCTCTTTGTCCTGG - Intronic
1124761855 15:32453020-32453042 AGTGGCTGTTCTCTTTGTCCTGG + Intronic
1124776774 15:32596048-32596070 AGTGGCTGTTCTCTTTGTCCTGG - Intronic
1125556568 15:40590711-40590733 CGTGGCTACTTTCTTTGTCTGGG - Intergenic
1128599580 15:68984524-68984546 GGTGGCTGCTTTCTTTGTCCAGG + Intronic
1129036048 15:72648878-72648900 GCTGGCTGCTGTCTTTGGCCAGG + Intergenic
1129213838 15:74088338-74088360 GCTGGCTGCTGTCTTTGGCCAGG - Intergenic
1129377695 15:75144613-75144635 GGTAGCTCCTTTCTGTAGCCAGG + Intergenic
1129400174 15:75277025-75277047 GCTGGCTGCTGTCTTTGGCCAGG + Intronic
1129730977 15:77932683-77932705 GCTGGCTGCTGTCTTTGGCCAGG - Intergenic
1129733444 15:77944759-77944781 GGTGGATGCTGTTTTTTTCCAGG - Intergenic
1130153590 15:81331161-81331183 GGTGGCTGCTTTCTTTATCCAGG - Intergenic
1131123581 15:89838891-89838913 GATGGCAACTTTCTTTATGCAGG + Intronic
1131305891 15:91242966-91242988 GGTGGCTGCTCCCTTTAGACGGG + Intronic
1131527267 15:93162445-93162467 GGTGGCTGCTTTCTTTGTCCGGG - Intergenic
1131534284 15:93221669-93221691 GGTGGCTGCTTTCTTTGTCCGGG - Intergenic
1131549516 15:93344977-93344999 GGTGGCTGCTTTCTTTGTCCGGG + Intergenic
1131739307 15:95370050-95370072 GGTAGCTACTGTCTTTATCATGG + Intergenic
1132018450 15:98339406-98339428 GTTGTCTGGCTTCTTTATCCTGG - Intergenic
1132209019 15:100006917-100006939 AGTGGCTGCTTCCTTTGGCCTGG - Intronic
1134682879 16:16138675-16138697 GGTGGATCCTCTCTTCATCCTGG + Intronic
1135776594 16:25262001-25262023 AGTGGCTGCTTCCTTTAGACAGG - Intergenic
1140456044 16:75106166-75106188 GGTGGCTGCTGCCATTCTCCTGG + Intronic
1141697590 16:85627475-85627497 TGTGGCAGCTTTTTTTTTCCTGG + Intronic
1142105860 16:88302420-88302442 AGTGGCTGCTTCCTTTGGCCCGG + Intergenic
1144193911 17:12872271-12872293 TTTGACTGCTTTCTTTATCTTGG + Intronic
1144568846 17:16382225-16382247 GAGGGATGCCTTCTTTATCCTGG - Exonic
1144568880 17:16382453-16382475 GGGGGATGCCTTCTTTATCTTGG - Exonic
1145360039 17:22204410-22204432 GGGGGATGCCTTCTTTATCTTGG - Exonic
1145360074 17:22204638-22204660 GGGGGATGCCTTCTTTATCTTGG - Intronic
1145360109 17:22204865-22204887 GGGGGATGCCTTCTTCATCCTGG - Exonic
1146459287 17:33033102-33033124 AGTGGCTGCTTACATTATGCCGG + Intronic
1148046549 17:44748430-44748452 GCTGTCTTCTTTCCTTATCCTGG - Exonic
1149324292 17:55514114-55514136 GGTGGCTCCTTTATTCATACTGG + Intergenic
1152547511 17:81009246-81009268 GGGGGGTGCTTTGTTTTTCCTGG - Intronic
1153083153 18:1251932-1251954 GGTGTCTGCTGGCTTTTTCCAGG + Intergenic
1156699244 18:39805399-39805421 AGTGCTTGCTTACTTTATCCAGG - Intergenic
1157323880 18:46655587-46655609 GGCGGATGCTTCCTTTTTCCTGG + Intronic
1157549845 18:48573925-48573947 GGTGGCTGGTGTCATTACCCAGG + Intronic
1158158351 18:54451103-54451125 GGAGGCTGCTGTCTATATTCTGG + Intergenic
1158913750 18:62097823-62097845 GGTAGTTGCTTTTATTATCCCGG - Intronic
1160602572 18:80025132-80025154 TGTGCCTGCATTTTTTATCCTGG - Intronic
1160624021 18:80190649-80190671 GGTGGCTGCCTTTTTTATATAGG - Intronic
1160663847 19:313701-313723 GTTGGCTGCTTTGCTTGTCCTGG - Intronic
1162249486 19:9430293-9430315 GGTGGCTGCTTTCTTTGTCCAGG + Intronic
1163108091 19:15139105-15139127 GTTGGCTGCTCTCTTTATTAGGG - Intergenic
1163861760 19:19746661-19746683 TGTGGCTACCTTCTGTATCCCGG + Intergenic
1164203266 19:23036107-23036129 GGTGGCTGCTTTCTTTGTCTGGG - Intergenic
1168439974 19:56356261-56356283 GGTGGCTGCTCTCTTTGTTCGGG - Intronic
926112020 2:10189554-10189576 AGTGGCTGCTTTCTTTGGTCTGG + Intronic
926421623 2:12705328-12705350 CATGGCAGCTTGCTTTATCCAGG - Intergenic
927248957 2:20981182-20981204 GGTGACTCCTTTCCTTGTCCAGG - Intergenic
929144569 2:38695424-38695446 GGTGGGTACTTCATTTATCCTGG + Intronic
933466235 2:82656229-82656251 GCTTCCTGCTTTCTTTATCTTGG + Intergenic
936611039 2:114002186-114002208 GTTGGCTGCTTTCTTTCCTCTGG + Intergenic
937014922 2:118596555-118596577 GTTGTCAGCTTTCTTTTTCCAGG + Intergenic
937065064 2:119011581-119011603 GGAGGTTGCTTTCTCTCTCCCGG + Intergenic
937761634 2:125611344-125611366 GGTAGATGATTTCTTTATCTGGG - Intergenic
938482831 2:131675634-131675656 GGGGGCATCTTTCTTCATCCAGG + Intergenic
938959631 2:136329574-136329596 GGGGGGTGCCTTCTTTATCCTGG + Intergenic
939153855 2:138501891-138501913 GGCGGCGGGTTTGTTTATCCCGG + Exonic
941090292 2:161167386-161167408 GATTACTACTTTCTTTATCCAGG + Intronic
941805131 2:169704494-169704516 GCTGGCTTCTTTCTGTTTCCTGG - Intronic
943470674 2:188291379-188291401 TGTGGCTGCTTTCTTGATAAAGG + Intergenic
946375354 2:219305217-219305239 GATGGTTCCTCTCTTTATCCTGG + Intronic
947465774 2:230343836-230343858 TATGGCTGCTTTCTTAATCTTGG + Intronic
1169083415 20:2812264-2812286 GTTGGTTACTTTCTTTACCCGGG + Intergenic
1170517160 20:17142630-17142652 GGTGGCTGCTTTCCTCATCAAGG + Intergenic
1172342628 20:34170361-34170383 GCTGGCTTCTTTCTTTTTTCTGG + Intergenic
1174439399 20:50537659-50537681 GGTAGCTGCTTTCTTAAAACAGG - Intronic
1176874553 21:14115402-14115424 GGTGGCTGCTTTCTTTGTCCGGG + Intronic
1176875685 21:14124679-14124701 GGTGGCTGCTTTCTTTGTCCGGG + Intronic
1178707702 21:34889029-34889051 GGGGCCTGCTTTCTTTTTCCAGG - Intronic
1179081444 21:38174267-38174289 TGTGGCTGCTTTCTTCTTCCAGG - Intronic
1179892907 21:44345937-44345959 GCTGGCTGCAGTCTTTACCCTGG + Intergenic
1182069098 22:27450871-27450893 GGGGGCTGCCTTCATCATCCAGG - Intergenic
1182690690 22:32159481-32159503 GGTGACTGCATTATTCATCCTGG + Intergenic
1183905123 22:41034784-41034806 GGTAGCTGCTTTCTGCATCTTGG + Intergenic
952984835 3:38770114-38770136 GGTTGTTGTTTTCTTTTTCCTGG + Intronic
953216851 3:40926805-40926827 GGTGACTGTTTGCTCTATCCAGG + Intergenic
953667107 3:44933376-44933398 GGTGGCTGCTCACTTGACCCAGG - Intronic
953801546 3:46027679-46027701 GCAGGCTCTTTTCTTTATCCAGG - Exonic
953861666 3:46549494-46549516 GGTGGCTGTTTTCCTTATCTTGG + Intronic
958418781 3:93907468-93907490 GGTGGCTCCTCTCTGTAGCCAGG - Intronic
965104104 3:164337512-164337534 GGTGGCAGCTTTCTCGATCAGGG - Intergenic
968103835 3:195987202-195987224 GGTTGCTGCTGGCTTTTTCCTGG + Intergenic
968183080 3:196611588-196611610 GGTGGCTTCTTTCTTTCCCTGGG + Intergenic
968302136 3:197624795-197624817 GGTTGCTGCTGGCTTTTTCCCGG + Intergenic
968975818 4:3821595-3821617 GGAGGCTGCTTTCTGTGGCCTGG + Intergenic
972260479 4:37403390-37403412 TGTGGCTGCTTTAATTATTCTGG - Intronic
978498509 4:109384850-109384872 GGTAGCTGCTCTCTGTAGCCAGG - Intergenic
979888366 4:126060598-126060620 GGTGGCTGCATTCTTCCTTCTGG + Intergenic
980347743 4:131644695-131644717 AGTGTTTGCTTTATTTATCCAGG + Intergenic
981713439 4:147731576-147731598 GGGGGCTCTTTTCCTTATCCCGG - Intergenic
981769128 4:148286632-148286654 GTTGTATGATTTCTTTATCCTGG - Intronic
986993527 5:13580113-13580135 TGTGGCTTCCTTCTTTCTCCCGG + Intergenic
991996053 5:72388332-72388354 GCTGGCTGTTTTCTACATCCTGG + Intergenic
992103326 5:73428473-73428495 GGTGGCTGGATTCTTGAGCCTGG - Intergenic
992534317 5:77683117-77683139 TGTGCCTGCTTTCTTGATCTAGG + Intergenic
993328769 5:86570721-86570743 AGTGTCTTCTTTCTTTAACCAGG - Intergenic
996157978 5:120127116-120127138 GGTGTTTGGTTTCTTTGTCCTGG + Intergenic
996664066 5:126037228-126037250 GGTGGCTGCTTTCTCTACTATGG - Intergenic
997312249 5:132896815-132896837 GGTGGCTGCTTTGTGTCTGCTGG + Exonic
1001636712 5:173215333-173215355 GGTGGGTGCTTTCTATGTGCAGG + Intergenic
1005338746 6:24823000-24823022 GGTTGCTTCTTTAATTATCCAGG - Intronic
1006598126 6:35208473-35208495 GCTGGCTGCTTTCTCTCTGCTGG - Intergenic
1007141494 6:39579446-39579468 GGTAGCTTCTTTCTATATTCTGG + Intronic
1007699340 6:43757565-43757587 GGTTGCTCATTTCTTCATCCTGG - Intergenic
1008589700 6:52981759-52981781 GGCTGCTGATTTCTTTATTCTGG + Intronic
1009259317 6:61463764-61463786 GGTGGTTGCTGTGTTTATCCTGG - Intergenic
1010765448 6:79773461-79773483 GGTGGATGTTTTCTTTTTCAGGG - Intergenic
1013211550 6:107991446-107991468 GGTGGCTGCTTTCTTTGTCCGGG + Intergenic
1017870163 6:158480172-158480194 GGTGGCTGTTATCTTTCTCATGG + Intronic
1018234286 6:161707807-161707829 GCCTGCTGCTTTTTTTATCCAGG + Intronic
1019661375 7:2225861-2225883 GGTGGCTGCATTCTCTGACCAGG + Intronic
1019746878 7:2705713-2705735 GGTGGCATGTTTCTTTGTCCTGG + Intronic
1021138137 7:16991242-16991264 TGTGGCTGCTTTATTTCTCCTGG + Intergenic
1021278017 7:18679987-18680009 AGTTCCTGGTTTCTTTATCCAGG + Intronic
1022245671 7:28556871-28556893 GTTGGCTGCTTTCTTTGACCAGG + Intronic
1023017628 7:35983094-35983116 TGTGGGTGCTTTCTTCATGCTGG - Intergenic
1023718870 7:43072574-43072596 AGTGGCTGTTTTCTTTGTCCGGG - Intergenic
1026141811 7:67713061-67713083 CATGGCTGCTTTCTGTACCCTGG + Intergenic
1028129391 7:87152477-87152499 CGTGGCTGCTTCCTCCATCCTGG + Intronic
1028583544 7:92431099-92431121 GGTTGCTGCTTTCTTTAAGTGGG + Intergenic
1028867835 7:95734249-95734271 GGTGGATGCTTTCTTTGTGAGGG + Intergenic
1029080779 7:97972290-97972312 GGTGGCTGCTTTCTCTGGGCTGG - Intergenic
1029113052 7:98223245-98223267 GTTGGCTGCTTTCCTCCTCCTGG - Intronic
1033705310 7:143880941-143880963 GCTTCCTGCTTTCTTTCTCCTGG + Intronic
1035004674 7:155646538-155646560 TGTGATTGCTTCCTTTATCCTGG + Intronic
1035024950 7:155819188-155819210 GGTGGCTTGTTTCTTTCTCTGGG + Intergenic
1038444371 8:27593112-27593134 GGTGGCAGCTGTCTTAACCCAGG + Intergenic
1038673022 8:29597461-29597483 GGTGGCTGCTTTCTGTAAAAAGG + Intergenic
1039268822 8:35858086-35858108 CGTGGCTGCTTTGCTTATCCTGG + Intergenic
1039273538 8:35909310-35909332 TTTGGCTTCTTTCTTTACCCCGG - Intergenic
1039509797 8:38081921-38081943 GGTGGCTGCTTTCTTTGCCGAGG - Intergenic
1039710982 8:40055728-40055750 GGAGGCTGCCTTATTTAACCTGG + Intergenic
1040499079 8:47991744-47991766 GGTGGGAGCTCTCTTTAACCTGG + Intergenic
1042367051 8:67949569-67949591 GGTTGTTGCTTTCCTTTTCCTGG + Intergenic
1044770986 8:95633775-95633797 TGTGGCTGCTTTCTCTTACCAGG - Intergenic
1051055988 9:12986653-12986675 GGTGGCTGCCTTGTTTATGCTGG - Intergenic
1051948052 9:22596196-22596218 TGTGACTGCATTATTTATCCAGG + Intergenic
1053577070 9:39364043-39364065 GGAGGCTGCTTCAGTTATCCGGG - Intergenic
1053841577 9:42191968-42191990 GGAGGCTGCTTCAGTTATCCAGG - Intergenic
1054098641 9:60922733-60922755 GGAGGCTGCTTCAGTTATCCGGG - Intergenic
1054120041 9:61198362-61198384 GGAGGCTGCTTCAGTTATCCGGG - Intergenic
1054362726 9:64192656-64192678 GGTGGTTGCTGTGTTTATCCTGG - Intergenic
1054587715 9:66984200-66984222 GGAGGCTGCTTCAGTTATCCGGG + Intergenic
1060187529 9:121572832-121572854 GGTGGTTGCTTTCGATATCATGG + Intronic
1060766064 9:126295859-126295881 GATGGCTGCTCTCTTTTTCCTGG - Intergenic
1186131446 X:6470296-6470318 GGTGGTTTCTTGCTTTTTCCAGG - Intergenic
1186237716 X:7531550-7531572 GTGGGCTTCTCTCTTTATCCTGG + Intergenic
1191738027 X:64407629-64407651 GGATGCTGCTTTCTGCATCCTGG - Intergenic
1192165844 X:68827340-68827362 GCAGGCTGCTTTCTGTATTCAGG + Intergenic
1194307986 X:92272119-92272141 GATGTCTGCTTTTTTTATCAAGG + Intronic
1196067347 X:111478819-111478841 GGTGAGTCCTTTCTTTATCAAGG + Intergenic
1196150483 X:112368181-112368203 GGTGGCTGTTTTAGTGATCCAGG + Intergenic
1196281523 X:113828583-113828605 GCAGGGTGCTTTCTGTATCCCGG - Intergenic
1201569416 Y:15398309-15398331 GGTGGGTGCTATCTTGATCATGG + Intergenic