ID: 1130153595

View in Genome Browser
Species Human (GRCh38)
Location 15:81331182-81331204
Sequence CCTTTTAAGCAGTCGGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 2, 1: 4, 2: 4, 3: 15, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130153588_1130153595 14 Left 1130153588 15:81331145-81331167 CCAGGAAAGTCTGAGCCCTGGAT 0: 1
1: 5
2: 6
3: 20
4: 178
Right 1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG 0: 2
1: 4
2: 4
3: 15
4: 80
1130153590_1130153595 -2 Left 1130153590 15:81331161-81331183 CCTGGATAAAGAAAGCAGCCACC 0: 1
1: 11
2: 4
3: 19
4: 201
Right 1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG 0: 2
1: 4
2: 4
3: 15
4: 80
1130153589_1130153595 -1 Left 1130153589 15:81331160-81331182 CCCTGGATAAAGAAAGCAGCCAC 0: 1
1: 5
2: 8
3: 17
4: 248
Right 1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG 0: 2
1: 4
2: 4
3: 15
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130153595 Original CRISPR CCTTTTAAGCAGTCGGTGGC CGG Intergenic
902956597 1:19928914-19928936 CCTTTTAAGCAACCGATAGCCGG + Intergenic
903486986 1:23697055-23697077 CCTTTTGAGCACTACGTGGCTGG - Intergenic
903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG + Intronic
908004167 1:59711284-59711306 CCTGTCAAGCAGTCGGGGGAAGG + Intronic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG + Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065067153 10:21981686-21981708 CCTTTTCAGCAGACGGTGCCAGG + Intronic
1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG + Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067005248 10:42654821-42654843 CATTTTAAGCAATCAGTGGCCGG - Intergenic
1067340846 10:45402248-45402270 CCTTGACAGCAGTGGGTGGCTGG - Intronic
1074356103 10:112784872-112784894 CCTTTTAAAAAGTCAGTGGGAGG - Intronic
1076722761 10:132399948-132399970 CCTTTCCAGCAGTCTGTGTCTGG - Intronic
1077206738 11:1348429-1348451 CTGCTTAAGCAGTGGGTGGCTGG - Intergenic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102683947 12:114709707-114709729 CCTTTTAAGAAATCTGGGGCTGG - Intergenic
1107483595 13:40805433-40805455 CTTTTTATGCAGTGGGTGGTGGG - Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG + Intergenic
1111140244 13:84108157-84108179 CATTCTAAGCAGTCGTTGGAAGG + Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1114362159 14:21985924-21985946 CCTCTTAAGCAGTAGAAGGCTGG + Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1117316561 14:54576833-54576855 CCCTTTAGGCAGACAGTGGCTGG - Intronic
1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG + Intronic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG + Intergenic
1129604728 15:77019312-77019334 CCTTTCAAGAAGTTGGAGGCCGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1140137832 16:72223511-72223533 CCTTATGACCAGTCAGTGGCTGG + Intergenic
1142718199 17:1759065-1759087 CTTTTAAAGAAGTCGGGGGCCGG + Intergenic
1156952302 18:42917089-42917111 CCCTTTAAGCACTTGATGGCCGG + Intronic
1159036909 18:63286286-63286308 CCTTTTACACAGTTGGGGGCAGG + Intronic
1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG + Intronic
1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG + Intergenic
1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG + Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
932766320 2:74472749-74472771 CCTGCTAAGCAGCCGGCGGCCGG - Exonic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG + Intronic
1173961816 20:47079486-47079508 CCTTATAAGGGGTCGGGGGCAGG - Intronic
1174670556 20:52303748-52303770 CCATTTTGGCAGTGGGTGGCGGG - Intergenic
1176185073 20:63773848-63773870 CCTTTCCAGGAGGCGGTGGCAGG - Intronic
1176380025 21:6107767-6107789 CCATTTAAGCAGCCCGTGGAAGG + Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
1179743449 21:43430471-43430493 CCATTTAAGCAGCCCGTGGAAGG - Intergenic
1183578607 22:38708570-38708592 CCTGTTAAGCAGCAGGAGGCAGG + Intronic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
1184689934 22:46112901-46112923 CCTTGGCAGCAGTCGGGGGCAGG + Intronic
963882904 3:150547858-150547880 CCTTTTAAACAGTCTTTGCCTGG - Intronic
969218832 4:5746208-5746230 GCTTTGAAGCAGGGGGTGGCTGG + Intronic
971232997 4:24815830-24815852 CTTTTTAAGCAGTGGGTGCAGGG + Intronic
987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG + Intronic
988510852 5:31863356-31863378 CCTGTTAAGCATTAGTTGGCAGG + Intronic
988727383 5:33938244-33938266 CCATTTAAGAAGTAGGTGGGAGG + Intergenic
994502181 5:100593083-100593105 CTTTTTAAGCACTGGGTGCCTGG + Intergenic
996093959 5:119378775-119378797 CCTTTAAAGCAAAAGGTGGCTGG + Intronic
999153783 5:149443732-149443754 CCTTTTCAGAAGTGGGTGGGAGG - Intergenic
1002877977 6:1227821-1227843 CTTTTTAGGAAATCGGTGGCAGG - Intergenic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1011242817 6:85290060-85290082 CCTGTTGAGGGGTCGGTGGCTGG + Intergenic
1011995514 6:93582015-93582037 TCTTTTAAGTGGGCGGTGGCAGG + Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG + Intergenic
1023873832 7:44276431-44276453 CCCTTTGTGCAGTGGGTGGCGGG - Intronic
1028509451 7:91607741-91607763 CCTGTTAAGGAGTTGGTTGCTGG - Intergenic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1031340684 7:120596291-120596313 CTTTTTAAGCAGACATTGGCTGG - Intronic
1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG + Intergenic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1037293111 8:17372198-17372220 CATTTTTAGCAGAAGGTGGCAGG - Intronic
1037802683 8:22043988-22044010 CCTTTGAAGCAGTGGGGGGGTGG + Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG + Intronic
1055979067 9:81983733-81983755 CATTTTAAGCAGCCTGTGGGAGG - Intergenic
1056149141 9:83766842-83766864 CCTTTTAAACACCTGGTGGCTGG + Intronic
1057807699 9:98232288-98232310 CCTTTGGAGCAGTCAGTGCCTGG - Intronic
1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG + Intronic
1059263579 9:113004063-113004085 CCTTTTAAGAAGACGGTCACGGG + Intergenic
1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG + Intergenic
1185684584 X:1917871-1917893 CCTTTTTAGCACACGGTGGAAGG - Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG + Intergenic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic