ID: 1130154338

View in Genome Browser
Species Human (GRCh38)
Location 15:81336743-81336765
Sequence ATGGTCCAAGGTAAGAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130154338_1130154349 23 Left 1130154338 15:81336743-81336765 CCATAGTTCTTACCTTGGACCAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1130154349 15:81336789-81336811 TGGACGGTATGCTCTGGGCTCGG 0: 1
1: 0
2: 2
3: 5
4: 134
1130154338_1130154350 24 Left 1130154338 15:81336743-81336765 CCATAGTTCTTACCTTGGACCAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1130154350 15:81336790-81336812 GGACGGTATGCTCTGGGCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1130154338_1130154345 17 Left 1130154338 15:81336743-81336765 CCATAGTTCTTACCTTGGACCAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1130154345 15:81336783-81336805 CCCCTATGGACGGTATGCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1130154338_1130154347 18 Left 1130154338 15:81336743-81336765 CCATAGTTCTTACCTTGGACCAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1130154347 15:81336784-81336806 CCCTATGGACGGTATGCTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 30
1130154338_1130154342 7 Left 1130154338 15:81336743-81336765 CCATAGTTCTTACCTTGGACCAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1130154342 15:81336773-81336795 CTACTATTGCCCCCTATGGACGG 0: 1
1: 0
2: 0
3: 0
4: 46
1130154338_1130154341 3 Left 1130154338 15:81336743-81336765 CCATAGTTCTTACCTTGGACCAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1130154341 15:81336769-81336791 TGTACTACTATTGCCCCCTATGG 0: 1
1: 0
2: 0
3: 4
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130154338 Original CRISPR ATGGTCCAAGGTAAGAACTA TGG (reversed) Intronic
902845733 1:19109238-19109260 ATGGCCCAAAGAAAGAACTATGG + Intronic
904395611 1:30219449-30219471 ATGGTCCATTGTAAGGACTCTGG + Intergenic
905845774 1:41230235-41230257 ATGGTCCAAAAGAAGAACTATGG + Intronic
907371505 1:54006520-54006542 CTGGTTCAGGGTCAGAACTAAGG + Intergenic
909732306 1:78908664-78908686 ATGATGAAAGGGAAGAACTATGG - Intronic
909973160 1:82015127-82015149 ATGGTGCAAGGTTTGAACCATGG + Intergenic
912154725 1:106903833-106903855 ATGTTCCAAGCTAAGAAGTGTGG + Intergenic
912908942 1:113736880-113736902 ATAGGCCATGGTAAGAACTTTGG + Intronic
918677249 1:187302713-187302735 ATGGTACAAGGTAGGAATCAAGG + Intergenic
920678120 1:208052514-208052536 ATGGACCATGGTTAGATCTAAGG + Intronic
921306577 1:213803189-213803211 ATGGTCCATGGGTAAAACTAGGG + Intergenic
922022420 1:221718074-221718096 ATGGTCCAAGGTCAGAATGGGGG + Intronic
922280490 1:224118826-224118848 ATTTTCCAAGGTAAGTTCTATGG - Intronic
922507202 1:226133467-226133489 GTGGTCCAAGGTCAGGGCTATGG + Intergenic
924041346 1:239987075-239987097 ATGATACAATGTGAGAACTAAGG + Intergenic
1064953417 10:20880026-20880048 ATGGTCCAACCTAAGACCCATGG - Intronic
1065562746 10:26979986-26980008 TTGGGCCATGGTCAGAACTAAGG - Intergenic
1065661326 10:28006820-28006842 ATGGTCCAAGGTAAGACTGGTGG - Intergenic
1066604402 10:37146030-37146052 ATAGTCCAAGGTCACAACTGTGG + Intronic
1069022703 10:63506455-63506477 ATGGTGCAAGTTCAGAACTGGGG - Intergenic
1070673707 10:78397364-78397386 ATGGGCCATGGTAAGCACTGTGG + Intergenic
1072976545 10:100063670-100063692 ATGTTCCAAGGTTGGAACTGCGG - Exonic
1074193805 10:111161673-111161695 ATGGTCCAAGGGAGGAACAGTGG + Intergenic
1075893210 10:125971968-125971990 ATGGTACAAGGTTAAAAGTAAGG + Intronic
1077777282 11:5285506-5285528 AAGGTCGAAGGTAGGAACTAAGG + Intronic
1079787277 11:24689237-24689259 CTGCTCCAAGGGAAGAATTAGGG - Intronic
1079817562 11:25080893-25080915 ATGTTGAAAGGTAAGAACTCAGG + Exonic
1080552477 11:33385141-33385163 ATGGTGCAAAGTAAGAATCAAGG + Intergenic
1083013053 11:59422470-59422492 ATGTTTCAATGAAAGAACTAAGG + Exonic
1086913146 11:92496370-92496392 GTGGTCCCAGGTTAGAAGTAGGG - Intronic
1088459000 11:110063027-110063049 ATTGTCCAAGGAAGGAACTGTGG - Intergenic
1088822163 11:113465580-113465602 ATGGTACAAGGTAAGGCCAAAGG - Intronic
1093378551 12:18461427-18461449 ATAGTCCAAAGAAATAACTAAGG - Intronic
1096923209 12:55112394-55112416 ATGGTTCAAGGTAAGTAATAAGG + Intergenic
1098893619 12:76032793-76032815 GTGGGCCAAGGTAAGAGTTACGG + Exonic
1099775448 12:87122098-87122120 ATAGTCCAATGTCAGAACTGAGG + Intergenic
1100386167 12:94106136-94106158 ATGGTCCTAGTTAAGGACTTCGG - Intergenic
1102250301 12:111382168-111382190 AAGGTCCAAGGAGAGAACAAGGG + Intergenic
1107026808 13:35810065-35810087 ATGGCCCTTGGTAAGAAATAGGG + Intronic
1107425424 13:40288150-40288172 ATTGACCAAGGTATGGACTAGGG - Intergenic
1111213157 13:85107302-85107324 ATGGTACAAAGGATGAACTATGG + Intergenic
1114153400 14:20071547-20071569 ATGGTCAAAAGTTAGAAATATGG - Intergenic
1116318552 14:43429727-43429749 ATGTTCTCAGGGAAGAACTATGG - Intergenic
1116910267 14:50455178-50455200 TTGGTAGAAGGTAAGAAGTATGG - Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118957763 14:70498309-70498331 AAGAACCAAGGTAAGAACTTTGG + Intergenic
1121714850 14:96066199-96066221 ATGGTCCATGGTGAGAATTCAGG - Intronic
1121779324 14:96612095-96612117 ATGGTACAATGTAAGAAATTTGG - Intergenic
1125521972 15:40353258-40353280 ATGGACCCAGGTAAGCACTGTGG + Exonic
1126235091 15:46374439-46374461 ATGGTTCAAGGTAAGAAGACAGG - Intergenic
1127338277 15:58012752-58012774 ATGGTAGAAGGGAAGAACTATGG + Intronic
1127934529 15:63624191-63624213 ATGGTTCAAGGCAAAAACTATGG - Exonic
1130154338 15:81336743-81336765 ATGGTCCAAGGTAAGAACTATGG - Intronic
1133734608 16:8605140-8605162 ATGGTACAAGGTAAGAACAGAGG - Intergenic
1138189321 16:55001198-55001220 ATGGTACAGGGTGAGAACTGTGG + Intergenic
1138784127 16:59826087-59826109 AAGGTCAAAGGAAAGAATTAGGG - Intergenic
1139813584 16:69646072-69646094 ATTTTCCAATGTAAGAACAATGG - Intronic
1141506409 16:84481326-84481348 GTTGCCCAAGGTCAGAACTAGGG - Intronic
1144007094 17:11110624-11110646 ATGGTGGAAGGTGAGAACTCTGG - Intergenic
1147057606 17:37846268-37846290 ATGGGGCAAGGGAAGAACAATGG + Intergenic
1203162916 17_GL000205v2_random:68250-68272 ATGGCCAAGGGGAAGAACTAAGG - Intergenic
1159536333 18:69719589-69719611 AAGGCCCAAGGTTAGAATTATGG - Intronic
1160218231 18:76952921-76952943 CTGGTCCAAAGTAAGCACTCAGG + Intronic
1164288400 19:23843408-23843430 ATGCTCCTATATAAGAACTAGGG - Intergenic
1166262459 19:41650317-41650339 ATGTTGCAAGGTTAGAATTATGG - Intronic
927253374 2:21018358-21018380 ATAGGCCATGGTAAGAACTTTGG - Intronic
929063689 2:37950205-37950227 ATGGTCCAAGGTGAGAGAGATGG + Intronic
929085443 2:38163232-38163254 ATGGTCCAACCTAAGAACCTAGG + Intergenic
931295723 2:60923186-60923208 ATGGGCCAAGGTAACCCCTAAGG + Exonic
931694749 2:64863401-64863423 ATGGATCAAGGTAAGAAGTGTGG - Intergenic
933845041 2:86318858-86318880 ATGTGCCAAGGTAAGAATAATGG + Intronic
934566255 2:95343195-95343217 ATATTCCAAGGTAAGAGCCAGGG + Intronic
936630617 2:114198909-114198931 ATTGGCCAAGGTAAGGACTTTGG + Intergenic
941004854 2:160237556-160237578 ATGGACCACTGTAAGAACTGTGG - Intronic
941258210 2:163260692-163260714 ATGGTTCAATGTAATAACTTTGG + Intergenic
942664734 2:178305241-178305263 ATGTTAAAAGGTAAGCACTATGG - Intronic
942995060 2:182250795-182250817 TTTCTCCAAGGTAAGACCTACGG + Intronic
947344591 2:229177841-229177863 ATGCTCTGAGGTAGGAACTACGG + Intronic
948572196 2:238924753-238924775 CTGCTCCAAGGGAAGAACCAAGG + Intergenic
948898216 2:240938257-240938279 ATGGTATGATGTAAGAACTAAGG + Intronic
1168917900 20:1506308-1506330 GAGGGCCAAGGTAAGAACTTTGG + Intergenic
1170693762 20:18638670-18638692 ATGGGCCAAGGTAAGGAATTTGG + Intronic
1177190950 21:17850364-17850386 ATGGTGGAAGGGAAGAACTCTGG + Intergenic
1178484691 21:33011353-33011375 ATGGTCCTTGGTAGGAAATATGG - Intergenic
1183150577 22:36034038-36034060 CTTGTCCAAGGTAAGATATATGG - Intergenic
1183902741 22:41018799-41018821 GTAGTCCCAGCTAAGAACTATGG + Intergenic
949089972 3:15695-15717 ATGGTACAAACTAAGAATTATGG + Intergenic
949381292 3:3448416-3448438 GAGGTCCAAGGTAAAAACTAAGG - Intergenic
951664341 3:25105516-25105538 AAAGGCCAAGGAAAGAACTAAGG - Intergenic
953691419 3:45123015-45123037 TTGGTCCATGGTGAGAAGTAGGG + Intronic
954206543 3:49063396-49063418 ATGGTCAAATTTAAGAACTAGGG + Intronic
954984716 3:54779531-54779553 ATTGACCATGGTAAGAACTTGGG - Intronic
955181353 3:56673645-56673667 TTGGTTCAAGGTAAGAAGAATGG + Exonic
955752333 3:62195677-62195699 AAGGTCCAGGGCCAGAACTAGGG + Intronic
957029642 3:75225422-75225444 ATGGTACAAACTAAGAATTATGG + Intergenic
957974454 3:87425324-87425346 ATGGTCCACGGTAAGAAGTTGGG + Intergenic
958493754 3:94814726-94814748 GTGGTCCAAGATAAGAACCCTGG + Intergenic
958987446 3:100798891-100798913 ATGGTACAAGGTTAGAATAAAGG - Intronic
962555522 3:136547320-136547342 ATGATACTAGGTAAAAACTAAGG - Intronic
963223920 3:142841386-142841408 ATGATCAAAGGGAAGAACAATGG + Intronic
963291533 3:143495122-143495144 ATGGTTCAAGATAAGAACTTTGG - Intronic
963759643 3:149274171-149274193 ACGGTCCAAAGTCAGAACTGAGG - Intergenic
964265727 3:154893401-154893423 ATGGCCCAAGGTCACAGCTAGGG + Intergenic
964850185 3:161087740-161087762 ATGGTGCAAGGAAAGCTCTATGG - Intronic
965781988 3:172295924-172295946 ATTGTGCAAGGTAAGAAATAGGG - Intronic
967650104 3:191975035-191975057 AAGGTCTGAGGGAAGAACTAAGG + Intergenic
970218678 4:13785296-13785318 ATGGGCCAAGGTAAGGATTCAGG + Intergenic
971302972 4:25456944-25456966 AAGGGCCAAGGTCTGAACTAGGG - Intergenic
974025426 4:56729275-56729297 ATGTACCAAAGTAAGAACTTGGG - Intergenic
977089209 4:92649638-92649660 ATGGTTCAAGGAAATACCTATGG - Intronic
978503896 4:109436102-109436124 ATGGTAAAGTGTAAGAACTAGGG + Intronic
979258202 4:118625739-118625761 ATGGTCAGAGGGGAGAACTAGGG + Intergenic
979330147 4:119414829-119414851 ATGGTCAGAGGGGAGAACTAGGG - Intergenic
979717969 4:123864508-123864530 ATGGTACATGGTAAGAATTTAGG - Intergenic
983954974 4:173686742-173686764 ATGGTGAAAGGTAAGACTTAGGG + Intergenic
984087718 4:175332858-175332880 ATAGTCCAAGGAAAAAAATATGG - Intergenic
984872427 4:184338524-184338546 ATTGTGCAAGGTAAGGACTGAGG - Intergenic
987939144 5:24509729-24509751 ATGGTCCTAGGTAATAAAAACGG + Exonic
989436258 5:41416986-41417008 ATGGACCAAGACAAGAACAATGG + Intronic
990051365 5:51505669-51505691 ATCGTCTAAGAAAAGAACTAAGG + Intergenic
990120232 5:52442347-52442369 ATGGTGGAAGGGAAGAACTCTGG - Intergenic
990170332 5:53040855-53040877 ATGGTCCAAGGTTACAAAAATGG - Intronic
990705847 5:58528575-58528597 AGGGTGGAAGGGAAGAACTAAGG + Intergenic
991029117 5:62064304-62064326 ATGTTCCGAGGTAAGAAAGAAGG - Intergenic
995716398 5:115085392-115085414 AAGGTCATAGGTAAGAACTAAGG - Intergenic
999662378 5:153878975-153878997 ATGGTCAAATTTAAGAACCATGG + Intergenic
1000987885 5:167880806-167880828 ATGGTCCTTTATAAGAACTAAGG - Intronic
1002117452 5:176974358-176974380 ATGGTGCAAGGTAAGAATTAAGG - Intronic
1007189469 6:40001080-40001102 ATGTTCAAATGTAAGAACTCAGG - Intergenic
1012698117 6:102416351-102416373 ATGGCCTTAGGTAAAAACTAAGG - Intergenic
1012977401 6:105794779-105794801 ATGGTCAAATGTAAGAAGTGAGG + Intergenic
1015456210 6:133429417-133429439 ATGGGTCAAGGGAAGAATTAAGG + Intronic
1018096719 6:160393704-160393726 AAGGTCAAAGGTAAGAAGCAAGG - Intronic
1024455408 7:49600337-49600359 ATGGCCCCAGGTAAGTAGTATGG - Intergenic
1033467861 7:141612729-141612751 ATGGACCAAAGTAAGCATTAAGG - Intronic
1033889072 7:145985962-145985984 ATATTGCAAGGTTAGAACTATGG + Intergenic
1036539877 8:9695918-9695940 ATGTTTCAAGGGAAGCACTAGGG + Intronic
1037190506 8:16119058-16119080 AGGGTGCAAGTTAAAAACTACGG + Intronic
1038686852 8:29726904-29726926 ATTGTCCATGGCAAGAACCAAGG + Intergenic
1042391655 8:68242753-68242775 ATTGTCCAAGCTAAAAACTTTGG - Intergenic
1043802739 8:84631223-84631245 ATTGTCCAAGAAAAGAAATATGG + Intronic
1049400103 8:142422117-142422139 ATGCTGAAAGGAAAGAACTACGG + Intergenic
1050705887 9:8396698-8396720 ATAGTCTAAGGTAGGAGCTAGGG + Intronic
1051297515 9:15611997-15612019 ATGGTGGAAGGCAAGAACTCTGG - Intronic
1052248410 9:26367164-26367186 ATGGTTAAAGGGAAGAATTAAGG - Intergenic
1053189539 9:36050655-36050677 ATAGGCCATGGTAAGAACTTTGG - Intronic
1059420982 9:114192341-114192363 ATGGTACAAGGCCAGACCTAGGG - Intronic
1188504831 X:30871146-30871168 ATGGTTCAAAGCAAGAATTATGG + Intronic
1190503313 X:51100388-51100410 ATGAGAAAAGGTAAGAACTATGG + Intergenic
1192586004 X:72318635-72318657 ATGGGCCACTGTAAGAACTTTGG - Intergenic
1192688972 X:73340130-73340152 ATGGTACAAGGTAGGAATCAAGG - Intergenic
1193227067 X:78996235-78996257 CTGGTCCAAGTGAAAAACTATGG + Intergenic
1193598021 X:83472399-83472421 ATGACCCATGGTAAGCACTAAGG + Intergenic
1194528737 X:95016032-95016054 ATGGTACAAATTATGAACTAAGG - Intergenic
1194901375 X:99515630-99515652 ATTTTCCAAGGTTAAAACTAAGG + Intergenic
1199964808 X:152811005-152811027 AAGGTCCAAGATTAGAACGAAGG + Intergenic
1201964634 Y:19718517-19718539 GTGGTCCAAGGTTAGAAGCAGGG + Intronic