ID: 1130154881

View in Genome Browser
Species Human (GRCh38)
Location 15:81341673-81341695
Sequence TCTTATCTTTAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130154881_1130154885 -9 Left 1130154881 15:81341673-81341695 CCCTCCACCTTCTAAAGATAAGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1130154885 15:81341687-81341709 AAGATAAGACAAGTCACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 333
1130154881_1130154886 -6 Left 1130154881 15:81341673-81341695 CCCTCCACCTTCTAAAGATAAGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 207
1130154881_1130154887 -5 Left 1130154881 15:81341673-81341695 CCCTCCACCTTCTAAAGATAAGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130154881 Original CRISPR TCTTATCTTTAGAAGGTGGA GGG (reversed) Intronic
903003603 1:20283847-20283869 TCTTATCTTTAGAGTGGAGATGG - Intergenic
904105793 1:28081669-28081691 TCTTATTTTGAAAAGGGGGAGGG + Intronic
905011680 1:34751380-34751402 TCCTTTCTTTCGAATGTGGAAGG - Intronic
906369949 1:45245045-45245067 GCTCATCTTTAGAAGGGAGAGGG - Intronic
906441310 1:45848086-45848108 TCTTATCTATAGAATGTATAGGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG + Intergenic
912022538 1:105123150-105123172 TATTATCTTTATATGGTGGAAGG + Intergenic
912158117 1:106947359-106947381 TCTTATCTTAATAAGATAGAAGG + Intergenic
912186849 1:107287600-107287622 TCTTAAATTTAGAGGGTTGATGG + Intronic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
916898976 1:169200487-169200509 TATTATCTCTAGAAGATGGCTGG - Intronic
917985898 1:180318261-180318283 TTTTATCTTTAAAATGTTGAGGG - Intronic
918720012 1:187840769-187840791 TCTTATCTTGACATGGTGTAAGG - Intergenic
920785123 1:209033943-209033965 TCTTATCTTTTAAAGGTGTGTGG - Intergenic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921988529 1:221338814-221338836 TCTTATGTTTTGAAGCGGGAGGG + Intergenic
923969619 1:239185289-239185311 TCATCTTTTTATAAGGTGGATGG + Intergenic
1064672183 10:17726892-17726914 TCATTTCTATAAAAGGTGGATGG + Intergenic
1065257743 10:23889935-23889957 TCATATCTTTAGCAGGTTGTAGG + Intronic
1069166206 10:65163647-65163669 TGTTAGCTTTAGAATCTGGAGGG - Intergenic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1071681394 10:87709408-87709430 TTTTATCATTAGAAGGAGGCTGG + Intronic
1072412048 10:95211866-95211888 CTTTCTCTTTAGACGGTGGATGG + Exonic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1073504262 10:103969911-103969933 TCTTGTAGTTAGAAGGTGGTAGG + Intronic
1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG + Intergenic
1079015944 11:16868771-16868793 TCTTCTCCTTGGAAGCTGGATGG + Intronic
1079324995 11:19484242-19484264 TCCTATCTTGAGAGGTTGGAAGG + Intronic
1082846730 11:57732199-57732221 GCAAAACTTTAGAAGGTGGAGGG + Intronic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1089180889 11:116582147-116582169 TGTTGTCTTTAGAAGCTGGTGGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1093994904 12:25630888-25630910 TCTTATCTTTCGCAGCTGGGAGG + Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1095634005 12:44409857-44409879 TCTTATTTTTGGTAGGAGGAGGG + Intergenic
1096200981 12:49682778-49682800 TTTTATCTTTTGAAGGGGCAAGG - Intronic
1097693370 12:62754938-62754960 TGTTATCTTTACAAGATGGGTGG + Intronic
1098279888 12:68851857-68851879 TCATGACTTTAGAAGGGGGAAGG - Exonic
1098681686 12:73364215-73364237 TTTTATCTTGAGAAAGTGAATGG - Intergenic
1099832563 12:87863727-87863749 TCTTTTCTTTTGAAAGGGGATGG + Intergenic
1100680725 12:96917019-96917041 TTTTATCTTGAGAAACTGGATGG + Intronic
1100820889 12:98428544-98428566 TCTTATCTCTAAAACGGGGATGG - Intergenic
1101281898 12:103266316-103266338 TCTTTATTTTAGAAAGTGGATGG + Intronic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1102326785 12:111992554-111992576 TCTTATATTTAGAAGATGTTTGG - Intronic
1103967440 12:124648871-124648893 TCTTTTCTTTGGAATGTGCAGGG - Intergenic
1104374987 12:128257748-128257770 TCTCATCCTTACAAGGTGGGAGG + Intergenic
1106034041 13:26027777-26027799 TTGTAGCTTTAGTAGGTGGAAGG - Intergenic
1106288132 13:28336019-28336041 TTTTCTTTTTAGATGGTGGAAGG - Intronic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1106606449 13:31233750-31233772 TCTAATCTTTAGAAGGGAAAGGG + Intronic
1107425229 13:40286345-40286367 TCTAAACTTTAAAAGGAGGATGG + Intergenic
1108594727 13:51939659-51939681 TCTTAGCTATAGAAGCAGGAGGG + Intronic
1109031362 13:57193876-57193898 TCCTATCTTTAGAAGGTCGCTGG - Intergenic
1113384512 13:109836339-109836361 TTTTGTCATTAGAAAGTGGATGG - Intergenic
1113738996 13:112698014-112698036 TCTTAACTTTAGCAGGGGCAGGG - Intronic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115776188 14:36717851-36717873 TCCTCTCTTTATAAGGTTGATGG - Intronic
1115890449 14:38021553-38021575 TCTTGTCTCTAAAATGTGGATGG + Intronic
1116194617 14:41707183-41707205 TTTTATCTTACTAAGGTGGAAGG + Intronic
1116825604 14:49670527-49670549 TCCTATCTATAGAAGGGGGAAGG - Intronic
1118001121 14:61524958-61524980 TCTTATTTTTAGGGGATGGAAGG - Intronic
1120645939 14:87074086-87074108 TCTTATCTATGGAACGTGAAAGG - Intergenic
1120757981 14:88262170-88262192 TCTAAAGTTTGGAAGGTGGAGGG - Intronic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG + Intergenic
1129043700 15:72713528-72713550 TCTTTTTTTTAGTAAGTGGAAGG + Intronic
1129898759 15:79129516-79129538 CCTTATCTTGAAAAGCTGGAGGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1131392127 15:92058203-92058225 TAGCATCTCTAGAAGGTGGAGGG + Intronic
1132008221 15:98250043-98250065 TCTTTTATTTGGAAAGTGGAAGG - Intergenic
1132541821 16:513686-513708 TCTTAGCTTTAAGAGCTGGAAGG - Intronic
1135826325 16:25731715-25731737 TCCTTTCTTTGGAATGTGGAGGG + Intronic
1135927007 16:26704031-26704053 TCTTACCTTAAGAAGCTGGAAGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1139843462 16:69901378-69901400 TCTTTTCTTTAGGATGTGAAAGG + Intronic
1203140564 16_KI270728v1_random:1762812-1762834 TCAGATATTTAGAAGGTGGCTGG + Intergenic
1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG + Intergenic
1144174699 17:12694002-12694024 TCTTATCTTTGGAAGGTCGTGGG - Intronic
1145327839 17:21845943-21845965 TATTATCTTTAGAAGTTTTATGG + Intergenic
1145694653 17:26777323-26777345 TATTATCTTTAGAAGTTTTATGG + Intergenic
1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG + Intronic
1146711295 17:35043970-35043992 CTTTATCTTTAGAAGGTTGGGGG - Intronic
1150531199 17:65983643-65983665 ACTCATGGTTAGAAGGTGGAGGG - Intronic
1151809578 17:76430162-76430184 TCCAATTTCTAGAAGGTGGAAGG - Intronic
1203192473 17_KI270729v1_random:202171-202193 TATTATCTTTAGAAGTTTTATGG + Intergenic
1203201838 17_KI270730v1_random:1606-1628 TATTATCTTTAGAAGTTTTATGG + Intergenic
1154360225 18:13654561-13654583 GCTTAGCTTCAGAAGTTGGAGGG - Intergenic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1155194235 18:23458285-23458307 TCATATCTTTAGGAAGTGGAAGG + Intronic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1158035194 18:53020145-53020167 GCTTTTCTTTAAAAGGTAGAAGG - Intronic
1158430512 18:57381768-57381790 TCTTATGCTTAGAATATGGATGG + Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1167623059 19:50569284-50569306 TCTTCTCTTCATGAGGTGGAGGG - Intergenic
1167707601 19:51090768-51090790 TCCTATCTTTGGAAGCTGGGGGG + Intergenic
1168163505 19:54529281-54529303 TCTTATCTTCAATTGGTGGAGGG - Intergenic
925067679 2:941179-941201 TTTTATCTTTACCAGATGGAGGG - Intergenic
925978423 2:9157006-9157028 TCTTATCTTTGCCAAGTGGAAGG - Intergenic
926829928 2:16950583-16950605 TCTTATCTTTACAAGTTGTTTGG - Intergenic
927274865 2:21254199-21254221 TCTTTCTTTGAGAAGGTGGAGGG + Intergenic
927438633 2:23092564-23092586 TCATCTCTTAAGAAGGTGAAAGG - Intergenic
929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG + Intergenic
931316417 2:61136795-61136817 TTTTATTTTTAGTAGGTGCAGGG - Intronic
935627344 2:105182045-105182067 TCTAATCTTTACAAGGCAGATGG - Intergenic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
937738986 2:125326615-125326637 TTTTATCTTCAGTAGGTGGGAGG - Intergenic
939797061 2:146658149-146658171 TCCTTTCTTTAGAAGGTAAAGGG - Intergenic
941085910 2:161118036-161118058 TCATATGTTTACAAGGTAGAAGG - Intergenic
941111882 2:161425138-161425160 TATTCTATTTAGAAGGTGGGGGG - Exonic
942888508 2:180958693-180958715 TCCTATTTTTAAAAGGAGGAAGG + Intergenic
943071719 2:183148965-183148987 GATTATCTATAGAAGGTGGGGGG - Intronic
944654769 2:201866618-201866640 TCTTGTCTTTGGAAGGAGAAGGG + Intronic
947300378 2:228682433-228682455 TCTTATCTTTAGAAAATAGGGGG + Intergenic
1168820411 20:769085-769107 TCTGACATTTTGAAGGTGGAAGG + Intergenic
1169262185 20:4147356-4147378 GTTTATCTTTAGAAGGTGAACGG - Intronic
1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG + Intergenic
1170187559 20:13608025-13608047 TCTCAGCTTTAGAAGGTTAAAGG - Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1171518114 20:25754748-25754770 TATTATCTTTAGAAGTTTTATGG + Intergenic
1171558745 20:26101459-26101481 TATTATCTTTAGAAGTTTTATGG - Intergenic
1173296804 20:41766909-41766931 TCTTATCTTTGGAACCTAGAGGG + Intergenic
1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG + Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1178137645 21:29645984-29646006 TCTTCTCTTTGGAATGTGCAAGG - Intronic
1178841378 21:36140198-36140220 TCTTAACCTAAGAAGGTGAATGG + Intronic
1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG + Intronic
1182258824 22:29058103-29058125 CCTTATTTTTATAAAGTGGATGG - Intergenic
950518511 3:13482477-13482499 TAATATCATCAGAAGGTGGAGGG + Intronic
951059547 3:18189096-18189118 TCTAAGCTTTAAAAGGTGGGAGG - Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951317796 3:21207543-21207565 TCTAATCTTTAGTACATGGAAGG - Intergenic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
954967970 3:54627635-54627657 TCTTATGTTTTGAATGTAGAAGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
956429614 3:69172604-69172626 TAATATATTTAGAAGGTGGCAGG + Intronic
956608670 3:71099628-71099650 TCTTATCTAGAGAATGTGGCTGG - Intronic
958502560 3:94933241-94933263 GATTGTCATTAGAAGGTGGATGG + Intergenic
959211120 3:103382234-103382256 TTTTATCCCCAGAAGGTGGATGG - Intergenic
962122234 3:132574074-132574096 CATTAACTTTAAAAGGTGGAAGG + Intronic
962786147 3:138769871-138769893 TCTTATCTTTAAAATGGGTAGGG - Intronic
964779153 3:160315829-160315851 TCTTTTTTTTAGAAAGGGGATGG + Intronic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
967344773 3:188442505-188442527 TCTGATATTTAGATAGTGGATGG + Intronic
967780443 3:193433378-193433400 TTTATTCATTAGAAGGTGGAGGG + Intronic
970435428 4:16029652-16029674 TCTTTTCTTTAGGGGGTGAAGGG - Intronic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
972860269 4:43160020-43160042 TCTTAACTTTAGAAGAAGAAAGG - Intergenic
976120938 4:81780585-81780607 TATTATTTTAAGAAGGTGAAGGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG + Intergenic
977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG + Intergenic
977484925 4:97632937-97632959 AATTATATTTAGAAGGGGGATGG + Intronic
978702567 4:111666120-111666142 TCTTATCTTTTGATGGTGATTGG - Intergenic
978932969 4:114338845-114338867 TCATATTTTTAAAAGGTGGCTGG + Intergenic
979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG + Intergenic
981333100 4:143535541-143535563 GGTTATCTGTAGAAGGTGGTTGG + Intronic
981735717 4:147948214-147948236 TATTATCTTTAAAAAGTGGCAGG - Intronic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984246667 4:177283205-177283227 TCTTATCTTGAGAAGGATGCTGG - Intergenic
984971194 4:185192701-185192723 TCTGATCTTAAGAAGGTCAAAGG - Intronic
985343487 4:188976094-188976116 TCTTATATTTTGCTGGTGGAAGG - Intergenic
986835759 5:11635265-11635287 TGTTATCTTTAGAAAGAAGAAGG + Intronic
987166668 5:15205066-15205088 TCTTATCCTGAGAAGCTGGATGG - Intergenic
987865641 5:23532928-23532950 TTTTTTCTGTAGAAGGTGGTTGG - Intergenic
987969440 5:24923154-24923176 TCTTATTTTTTAAAAGTGGAAGG + Intergenic
988550346 5:32195313-32195335 TCTTAGCTCTTGAAGGAGGATGG + Intergenic
990592947 5:57283944-57283966 CCTTATCTTTGGAAAGGGGAGGG + Intergenic
992724495 5:79592500-79592522 TCTTATCTTAAGTTGGGGGAGGG - Intergenic
995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG + Intergenic
997419575 5:133755387-133755409 TCCTGTCTATAGCAGGTGGAGGG - Intergenic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
998937112 5:147241040-147241062 CCTTATTTTTAGAAGGTTCATGG - Intronic
999594338 5:153185443-153185465 TTCAAACTTTAGAAGGTGGAAGG - Intergenic
1002682005 5:180972876-180972898 TCTTATTTTTACATGGTAGAAGG - Intergenic
1002807196 6:588650-588672 TCTTTTCATTAGAAAGTGAAGGG - Intronic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1003131031 6:3395408-3395430 GCTGATCTTTACAAGATGGATGG - Intronic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003552944 6:7115158-7115180 TCTCCTCTTGAGAGGGTGGATGG + Intronic
1005395702 6:25379613-25379635 TCTGATCACTAAAAGGTGGATGG + Intronic
1007717705 6:43866791-43866813 TCTTCTCTGTAGCAGCTGGAAGG - Intergenic
1008721877 6:54364022-54364044 TTTTATCTTTAGGAGCTAGAAGG + Intronic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1010679279 6:78781026-78781048 CCTTTTCTTTAGCAGCTGGAAGG + Intergenic
1011131712 6:84058681-84058703 GCTTGTGTTTAGAAGTTGGAGGG + Intronic
1012666658 6:101979429-101979451 ACTTATCTGTTAAAGGTGGAAGG + Intronic
1013545588 6:111153810-111153832 TCTTATCTTTGTAAGGAGAAAGG - Intronic
1014461556 6:121702907-121702929 TCATGTCTTTTTAAGGTGGAAGG - Intergenic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1014906246 6:127032162-127032184 TCTTATCTTAAGAAAGTAGTTGG - Intergenic
1015315789 6:131814615-131814637 TCTTAACTCTAGAATATGGAAGG + Intronic
1015373516 6:132483161-132483183 TGTTGTCTTTGGGAGGTGGATGG - Intronic
1015503459 6:133956965-133956987 TCTTTTCTTTAGAAGACAGATGG + Intronic
1016063120 6:139650830-139650852 CCTTATCTTTACAATGTGGTTGG + Intergenic
1018327760 6:162692290-162692312 TCTTTTCTTTAGAATGTGTGTGG - Intronic
1020766718 7:12331192-12331214 TCTTATCTGTAGTAGGAAGAAGG + Exonic
1021330594 7:19334302-19334324 TCAGATTTTTAGAAGGTAGACGG + Intergenic
1021441644 7:20684327-20684349 TCTTTTCTTGAGAAGGTCGCTGG - Intronic
1022633594 7:32109786-32109808 TCTTTTCTTTAGAGGGAAGAGGG + Intronic
1024110820 7:46144831-46144853 TCTCCTCTTTAGATGGTGGAGGG - Intergenic
1025278938 7:57612094-57612116 TATTATCTTTAGAAGTTTTATGG + Intergenic
1025305793 7:57853406-57853428 TATTATCTTTAGAAGTTTTATGG - Intergenic
1028154137 7:87410305-87410327 TCTTAGCTTTAGAAATTTGAAGG - Intronic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1030798792 7:113823676-113823698 TCTCATCTATAGAAGCTGCAGGG - Intergenic
1035775928 8:2188239-2188261 TCATAGCTTGAGAAAGTGGAGGG - Intergenic
1036098135 8:5747706-5747728 TCTTCTCTATGGAAGATGGAAGG + Intergenic
1036487991 8:9196924-9196946 TTTTATCTTTAGAACTTTGAAGG + Intergenic
1036599516 8:10247523-10247545 TCTTATGTTTAGAAGGAAAAAGG + Intronic
1038015741 8:23513084-23513106 TCTTACATTTAGAATGTGGCAGG + Intergenic
1038923370 8:32110927-32110949 TCTTATCATTAGAAAGTGAAAGG + Intronic
1039393886 8:37206348-37206370 TCGTCTCCTTAGAAGGTGAAAGG + Intergenic
1042787223 8:72561517-72561539 CCTTGTCCTTAGAAAGTGGAAGG - Intronic
1043028479 8:75102152-75102174 AATTATATTTAGAAGTTGGAAGG - Intergenic
1043910393 8:85857400-85857422 TTTTATTTTTAGGGGGTGGAAGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045387482 8:101685850-101685872 TCTGATCCTGAGAAGGTGGCTGG - Intergenic
1046292562 8:112181839-112181861 TGCTATCTTTACATGGTGGAAGG - Intergenic
1046764070 8:118050866-118050888 TCTAAGAATTAGAAGGTGGAGGG + Intronic
1047745537 8:127842095-127842117 TCTTATTTTTAAAAGTTGTATGG + Intergenic
1047863400 8:128993925-128993947 CCTGATCTTTGGAAGGCGGAAGG + Intergenic
1049077150 8:140407547-140407569 CCCTTTCTTTAAAAGGTGGAGGG - Intronic
1049653096 8:143784831-143784853 TACTATGTCTAGAAGGTGGAAGG + Intergenic
1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG + Intronic
1055563494 9:77545357-77545379 TCTTAGCTTTCCAAGGTGAACGG - Intronic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1056290674 9:85140771-85140793 TTCTATTTATAGAAGGTGGATGG - Intergenic
1056923949 9:90816575-90816597 TTATATCTGTACAAGGTGGAAGG + Intronic
1060168769 9:121443286-121443308 TCTTATCTTTACATTGTGCATGG - Intergenic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1186315144 X:8361491-8361513 TCTTATCTTTAGAAATTTTATGG - Intergenic
1187122570 X:16423493-16423515 TCTTATGATTAGAAGGAGGAAGG - Intergenic
1188800565 X:34524738-34524760 TCTTATCTTGAGCAGGTAAAAGG - Intergenic
1188960566 X:36486584-36486606 TGTTTTCTCTGGAAGGTGGAGGG - Intergenic
1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG + Intronic
1193718329 X:84958065-84958087 TCAGATCTTTAAAAGGTGGTAGG + Intergenic
1196494674 X:116310626-116310648 TCTTCTCTCTATAAGGTGCAAGG - Intergenic
1196769031 X:119274390-119274412 TTATATCTTTTGAAAGTGGAAGG + Intergenic
1197291283 X:124661588-124661610 TCTTAACTTTGGATGGTGGCAGG + Intronic
1198301622 X:135339177-135339199 TCTTATCTGTTGAAGATAGAGGG - Intronic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199058133 X:143321472-143321494 TCTTATCTATCAAAGGAGGAGGG + Intergenic
1201417105 Y:13758334-13758356 CCTTATCTTTACAAGAAGGAGGG - Intergenic
1201928804 Y:19318928-19318950 TCTCAGCTTTTGAAAGTGGAGGG - Intergenic