ID: 1130154885

View in Genome Browser
Species Human (GRCh38)
Location 15:81341687-81341709
Sequence AAGATAAGACAAGTCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 333}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130154880_1130154885 -3 Left 1130154880 15:81341667-81341689 CCACAACCCTCCACCTTCTAAAG 0: 1
1: 0
2: 7
3: 33
4: 524
Right 1130154885 15:81341687-81341709 AAGATAAGACAAGTCACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 333
1130154876_1130154885 13 Left 1130154876 15:81341651-81341673 CCCTGAAGTCCCGAGACCACAAC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1130154885 15:81341687-81341709 AAGATAAGACAAGTCACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 333
1130154882_1130154885 -10 Left 1130154882 15:81341674-81341696 CCTCCACCTTCTAAAGATAAGAC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1130154885 15:81341687-81341709 AAGATAAGACAAGTCACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 333
1130154877_1130154885 12 Left 1130154877 15:81341652-81341674 CCTGAAGTCCCGAGACCACAACC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1130154885 15:81341687-81341709 AAGATAAGACAAGTCACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 333
1130154878_1130154885 4 Left 1130154878 15:81341660-81341682 CCCGAGACCACAACCCTCCACCT 0: 1
1: 0
2: 6
3: 24
4: 259
Right 1130154885 15:81341687-81341709 AAGATAAGACAAGTCACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 333
1130154879_1130154885 3 Left 1130154879 15:81341661-81341683 CCGAGACCACAACCCTCCACCTT 0: 1
1: 0
2: 1
3: 28
4: 252
Right 1130154885 15:81341687-81341709 AAGATAAGACAAGTCACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 333
1130154875_1130154885 14 Left 1130154875 15:81341650-81341672 CCCCTGAAGTCCCGAGACCACAA 0: 1
1: 0
2: 0
3: 14
4: 89
Right 1130154885 15:81341687-81341709 AAGATAAGACAAGTCACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 333
1130154881_1130154885 -9 Left 1130154881 15:81341673-81341695 CCCTCCACCTTCTAAAGATAAGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1130154885 15:81341687-81341709 AAGATAAGACAAGTCACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130154885 Original CRISPR AAGATAAGACAAGTCACTGA AGG Intronic
901966078 1:12867489-12867511 AAGACAAGACAAGACAGTGGAGG - Intronic
902019844 1:13336752-13336774 AAGACAAGACAAGACAGTGGAGG + Intergenic
902610509 1:17594471-17594493 AAGAAAAGAAAAGAAACTGAGGG - Intronic
904365034 1:30005260-30005282 CAAATAAGACCAGTAACTGAGGG - Intergenic
905278129 1:36832385-36832407 AGGATAAAGCAAGTCACAGACGG + Intronic
906172317 1:43737219-43737241 AAGAGAAGACATATCACTGCAGG - Intronic
906855432 1:49298961-49298983 ATGATAAAGCAAGTAACTGAGGG - Intronic
907564348 1:55420911-55420933 AGGATAAGACACGTCATAGATGG + Intergenic
908440042 1:64144098-64144120 GAGACAAGAGGAGTCACTGATGG + Intronic
908904129 1:68988193-68988215 AAGATAAGAAAAGACAAAGAAGG + Intergenic
909288944 1:73857898-73857920 AAGTTAAGAAATGTCACTGTGGG - Intergenic
912161398 1:106989375-106989397 ATGAAAAGACAAGACACAGATGG + Intergenic
912278417 1:108286446-108286468 AAGATAAGAAAAATCAGTGAGGG - Intergenic
912289809 1:108407911-108407933 AAGATAAGAAAAATCAGTGAGGG + Intronic
912596470 1:110882054-110882076 ATGAAAAGACAAGGCACAGAAGG - Intronic
912893421 1:113559447-113559469 AAGATCAGAAAAGTCAAAGAAGG + Intronic
914214739 1:145615230-145615252 AAGCTAAGAAAACTCTCTGAAGG + Intronic
914466682 1:147935622-147935644 AAGGTAAGAAAACTCTCTGAAGG + Intronic
915024004 1:152810361-152810383 AAAAGCAGACAAGTCACAGAAGG + Intronic
915157747 1:153892184-153892206 AAGAAAAGACAAGACAATTAGGG + Intronic
918284569 1:183039366-183039388 AAGTTAATCCAAGACACTGAAGG - Intronic
918752968 1:188296096-188296118 AAGATATGACAAGCAATTGAAGG + Intergenic
921862593 1:220055144-220055166 AAGATTAGTCAAGACACTGCAGG + Intergenic
922651079 1:227338938-227338960 AAAATATTACAACTCACTGAAGG - Intergenic
923898414 1:238298914-238298936 AAAATATTACAACTCACTGAAGG + Intergenic
923909073 1:238419223-238419245 AAGATAACATAAGAGACTGACGG + Intergenic
924313082 1:242766459-242766481 AAGAAAAGACAAGGACCTGATGG + Intergenic
924365282 1:243286352-243286374 AAGACAAGAGGAGACACTGAGGG + Exonic
924828159 1:247563628-247563650 AAGATAAGAAAAGTAAGTCATGG + Exonic
1063061733 10:2562434-2562456 TAGATAAGACTAGTCATTCAAGG - Intergenic
1063384561 10:5607910-5607932 ACAATAAGAGAAGTCACTGCAGG - Intergenic
1063647211 10:7897045-7897067 AGGATTTGACAAGTCACTGCTGG - Intronic
1063863922 10:10343396-10343418 ATGATAATACAAGTTACAGAAGG + Intergenic
1064027233 10:11858672-11858694 AAGAAATGACAAGTCTCTGAAGG - Intronic
1064507237 10:16045976-16045998 ATGAAAAGACAAGCCACAGATGG - Intergenic
1065678711 10:28207372-28207394 AAGATGAGACCAATCATTGAAGG + Intronic
1067536455 10:47114168-47114190 AAGTTAATACATGTCACTTATGG + Intergenic
1068105543 10:52610390-52610412 AGGAGAAGACATGTCACTGGGGG - Intergenic
1068749387 10:60574008-60574030 AGGAAAAAACAAGTCACAGAGGG + Intronic
1069166842 10:65170776-65170798 AAGATAAGAAAAGACAAAGAAGG - Intergenic
1070521056 10:77253959-77253981 TAGAGAAGACAAGTCTCTGATGG - Intronic
1071446475 10:85753406-85753428 AAGAGATGACAAGCCACTTAAGG + Intronic
1071726846 10:88207231-88207253 ATGAGAAGACAAGTTACAGATGG + Intergenic
1071871655 10:89801910-89801932 AAGAAATGACAACTCATTGAAGG - Intergenic
1071893372 10:90037500-90037522 AAAAAAAAAAAAGTCACTGAAGG + Intergenic
1073603995 10:104875079-104875101 AAGATAAGACATGTGACTCGAGG - Intronic
1073716168 10:106109853-106109875 AACATAAGGAAAGACACTGATGG - Intergenic
1074232703 10:111553749-111553771 GAGAGAAGACAAGCCACTGTTGG - Intergenic
1074765938 10:116700111-116700133 AAGATAAAACAAGGCAGGGAGGG + Intronic
1075136508 10:119790834-119790856 AAGAGAAGAGAAGGCACAGAAGG - Intronic
1077036262 11:495920-495942 AACAAAAGACAAAACACTGAGGG + Intronic
1077075944 11:702228-702250 AAGTGCAGACAAGACACTGACGG - Intronic
1078805048 11:14690703-14690725 AAGAGGAGACAAATCACGGATGG + Intronic
1081364643 11:42219382-42219404 AAGAAAAGACCAGGAACTGAAGG + Intergenic
1082662220 11:55925883-55925905 AAGATAATACAAGTTTCAGAAGG - Intergenic
1085654400 11:78299611-78299633 AAGAGAAGCCAAGTTCCTGAAGG - Intronic
1086530212 11:87776273-87776295 AAAAAAAGACAATACACTGAGGG - Intergenic
1088324135 11:108584953-108584975 AAGTTAAGACAAGCTACAGATGG + Intronic
1089154757 11:116393002-116393024 ATGAAAAGACAAGCCACAGATGG + Intergenic
1089578885 11:119469087-119469109 AAGACAAGAAAAGACAATGAGGG - Intergenic
1093836412 12:23835114-23835136 TAGAGAACACAAGACACTGAGGG + Intronic
1095327857 12:40919495-40919517 AAGACAAAACAAGTGACTGATGG + Intronic
1097351102 12:58549957-58549979 AAGTTTGGAGAAGTCACTGATGG + Intronic
1098499376 12:71172718-71172740 ATGAAAAGACAAGCCACAGAAGG - Intronic
1098621244 12:72602413-72602435 AAAATAAGACACATCTCTGAAGG + Intronic
1099488431 12:83256329-83256351 AAGAAAAGGCAGGTGACTGAAGG - Intergenic
1100518393 12:95350243-95350265 AGGAAAAGACAAGCCACAGATGG - Intergenic
1100728371 12:97435015-97435037 GAGAAAAGACAAGTAACTAAAGG - Intergenic
1104710910 12:130985297-130985319 ATGAGAAGACAAGTCACGGATGG - Intronic
1106683090 13:32028251-32028273 AAGTTATGACAAGTGACTCAGGG + Intergenic
1106714247 13:32371941-32371963 AAAATATTACAACTCACTGAAGG - Intronic
1107059093 13:36136190-36136212 AAGAAAAGGAAAATCACTGAAGG + Intergenic
1107671949 13:42755070-42755092 AAAATGAGAGAAGACACTGAGGG + Intergenic
1108115109 13:47118949-47118971 AAGTTAAGAGATGTCAGTGATGG + Intergenic
1108493574 13:51003904-51003926 AAGACAAGGCAAGCTACTGAGGG + Intergenic
1108612045 13:52093615-52093637 TAGCTAAGATAAGGCACTGAAGG + Intronic
1110587257 13:77208222-77208244 AAGAAAAGACAAGCCACAGCAGG - Intronic
1111068435 13:83129744-83129766 AAAATAAGACAAGTCTCTAATGG - Intergenic
1111961700 13:94818061-94818083 GTGAAAAGACAAGCCACTGAGGG - Intergenic
1112825258 13:103384668-103384690 AAGAAAAGACAATTCACTTGAGG - Intergenic
1112854739 13:103753782-103753804 AAGAAAATACAAGTCATTGTGGG + Intergenic
1113192414 13:107764555-107764577 AAGGTAAGACAAATCAATGAAGG + Intronic
1114879079 14:26761435-26761457 AAGATGAGAATAATCACTGAAGG - Intergenic
1114903506 14:27097319-27097341 AAGAAAAAAAAAGTCACTGATGG - Intergenic
1115678258 14:35706076-35706098 ATGAAACGACAAGTCACAGATGG - Intronic
1116160931 14:41265882-41265904 AAGATTAGAGAAGTAACTCAGGG + Intergenic
1116504138 14:45657477-45657499 ATGAAAAGACAAGCCACAGAAGG - Intergenic
1116560301 14:46370180-46370202 AACAAAATACAGGTCACTGAGGG - Intergenic
1117050180 14:51852267-51852289 AAGATAAGTCAAGTTTCTGTAGG - Intronic
1117570548 14:57044744-57044766 AAGAGAAGACAAGTCTCCCAAGG - Intergenic
1117641289 14:57801717-57801739 AAGATAAGAAAAGGCAAAGAAGG + Intronic
1117745351 14:58863749-58863771 AAGCTAAGCCACGTCAGTGAAGG - Intergenic
1120999840 14:90443688-90443710 AAGCAAAGACAAGTCATAGAGGG + Intergenic
1121600103 14:95196987-95197009 AAGATAACATCAGTCACTCAAGG - Intronic
1125842949 15:42822209-42822231 ATGAAAAGACAAGTCACAGATGG - Intronic
1125919430 15:43516877-43516899 ATGAAGAGACAAGTCCCTGAAGG - Intronic
1125998066 15:44183225-44183247 AAGATGAGACAAGACAATGCTGG + Intronic
1126075852 15:44908542-44908564 CTGCTAAGACAAGTCAATGAAGG + Intergenic
1127081236 15:55382059-55382081 AAAATATTACAATTCACTGAAGG - Intronic
1127673245 15:61215509-61215531 ATGACAAGTCAAGTCAATGATGG - Intronic
1128577985 15:68789376-68789398 AAGAGAAGAAAAGGCCCTGAGGG - Intronic
1130065422 15:80599335-80599357 ATGAAAAGATAAGCCACTGATGG + Intergenic
1130154885 15:81341687-81341709 AAGATAAGACAAGTCACTGAAGG + Intronic
1131597784 15:93815559-93815581 AAGATAAAAAAAGTCAAAGAAGG + Intergenic
1131817891 15:96241369-96241391 AAGATAAGAAAATTTACTGGTGG - Intergenic
1135433710 16:22410030-22410052 ACGAGAAGACAAGCCACAGATGG - Intronic
1135522293 16:23186788-23186810 GAAAAAAAACAAGTCACTGATGG - Intronic
1135804468 16:25529724-25529746 ATGAAAAGACAAATCAATGATGG + Intergenic
1138091653 16:54179669-54179691 AAGAAAAGAAAAGAAACTGAAGG - Intergenic
1139260729 16:65590887-65590909 AAGAAATGAAAAGACACTGAAGG + Intergenic
1140224775 16:73068410-73068432 ACTAAGAGACAAGTCACTGATGG + Intergenic
1141311927 16:82922343-82922365 AATATAATTCAAGTCCCTGAAGG + Intronic
1142587665 17:983977-983999 TAAATAAGACAAGTCACACATGG - Intergenic
1143142240 17:4747387-4747409 GAGCTAAGGGAAGTCACTGAAGG - Intergenic
1144359176 17:14475494-14475516 ATGAAATGAAAAGTCACTGAAGG - Intergenic
1144711736 17:17405780-17405802 AAGATAAGACAAGGCGCTGGAGG + Intergenic
1145177747 17:20716085-20716107 AAAAAAAGACAAGTCAATGTAGG - Intergenic
1145720809 17:27070817-27070839 AAGGTCACACAAGTTACTGATGG + Intergenic
1148799976 17:50218301-50218323 AAAAAAAGAAAAGTCTCTGATGG - Intergenic
1149679938 17:58499157-58499179 AATATAGGACAGGTCATTGAGGG - Intronic
1149837455 17:59926031-59926053 AAAAAAAGACAAGTCAATGTAGG - Intronic
1149945110 17:60916754-60916776 ATGAAAAGACAACTCACAGAAGG + Intronic
1150081894 17:62247528-62247550 AAAAAAAGACAAGTCAATGTAGG + Intergenic
1150572726 17:66401811-66401833 AATATAAGAATAGACACTGAGGG + Intronic
1150918923 17:69462935-69462957 AAAAAAAGACAAGTCATTGCTGG - Intronic
1151859951 17:76753278-76753300 AAAATAACAAAAGTCTCTGACGG + Intronic
1154972079 18:21420074-21420096 ATGAAAAGACAAGCCACAGACGG + Intronic
1155341757 18:24820340-24820362 TAGATAAGAAAAATAACTGATGG - Intergenic
1155598742 18:27518322-27518344 AAAATAAGACAAGTCAATATTGG - Intergenic
1156637214 18:39046189-39046211 AAGATAAGACCAGGGACTAAGGG + Intergenic
1157866347 18:51188813-51188835 AAGTTAATACAAGTCAGTGAAGG - Intronic
1158656338 18:59338899-59338921 GAGCTAAGACAAGTCTTTGAAGG - Exonic
1158816055 18:61098546-61098568 AAGATGAGACTAGACAGTGAGGG - Intergenic
1162239871 19:9342197-9342219 AAGATATGACGACTCAGTGAAGG - Exonic
1164482881 19:28628495-28628517 AAGACAAGCCCAGTAACTGACGG + Intergenic
1165142411 19:33708171-33708193 ATGAAAAGACAAGCCACAGATGG - Intronic
1165822617 19:38686152-38686174 AAGGTCAGACAGGGCACTGATGG - Intronic
1166274217 19:41740623-41740645 AAGACAACACAAGCCACAGATGG - Intronic
1166622233 19:44311681-44311703 AAGATTACACAACTCACAGAAGG - Intergenic
925182576 2:1826762-1826784 CAGAGAAGTCAAGTCCCTGAAGG + Intronic
925215388 2:2090483-2090505 AAGAGATGACAACTCCCTGAAGG - Intronic
925547156 2:5029224-5029246 AAAAAAAGACATGACACTGAGGG - Intergenic
927183042 2:20461010-20461032 AAGATAAAAAAAGTAACAGAAGG + Intergenic
927425901 2:22980708-22980730 ATGAGAAGAAAAATCACTGAAGG - Intergenic
927602718 2:24458607-24458629 AAAATAAAAAAAGTCACAGATGG - Intergenic
928186018 2:29111568-29111590 AAGAATAGACAATTCACAGAAGG - Intronic
928346837 2:30506424-30506446 AAGATGAGTAAAGTCACTAATGG + Intronic
928350393 2:30547583-30547605 AAGATGAAAGAAGTCAATGAAGG + Intronic
928558980 2:32458846-32458868 AACATAAAAAAATTCACTGATGG - Intronic
928723292 2:34144328-34144350 AAGATAAGAAAACACACAGAGGG + Intergenic
929060115 2:37914928-37914950 AATTGGAGACAAGTCACTGAGGG - Intergenic
929897964 2:45977999-45978021 AGGATAAGACAAGTGACTACTGG - Intronic
930234582 2:48876515-48876537 AAAATCAGAGAAGTCACTAAGGG + Intergenic
930438313 2:51375534-51375556 AAGAGAAGATAATTCACAGATGG + Intergenic
930711482 2:54554881-54554903 AAGATGAGACTAGTGAATGAGGG - Intronic
931865254 2:66403301-66403323 ATGAAAAGACAAGCCACAGACGG + Intergenic
933032332 2:77345493-77345515 TAGAAAAGACAACTCATTGAAGG + Intronic
933177198 2:79188607-79188629 GAGAGAAGAAAAATCACTGAAGG + Intronic
934691416 2:96363144-96363166 AAAATATTACAACTCACTGAAGG + Intronic
934852563 2:97710767-97710789 AAGAGAACACAAGCCACTGCTGG - Intergenic
935164604 2:100559808-100559830 AAGATGAAAGAAGTCCCTGAGGG + Intergenic
935288303 2:101586379-101586401 AAGAAAAGTCAAGTACCTGATGG - Intergenic
936509455 2:113133284-113133306 AAGAAAAGACCAGTCCATGAGGG + Exonic
936643090 2:114337637-114337659 AAGAGAAGCAAAGTCACAGAAGG - Intergenic
937772055 2:125730816-125730838 AAGTTAAGACAAGACATAGAAGG + Intergenic
937864587 2:126739530-126739552 AACATCAGACATGTGACTGAAGG - Intergenic
940384185 2:153050961-153050983 GAGAGAAGAAAAGCCACTGAGGG + Intergenic
941484864 2:166067456-166067478 AAAAAAAGAGAAGTCAGTGATGG - Intronic
941891086 2:170582580-170582602 AAGAAAAAGCAAGCCACTGAAGG - Intronic
942462746 2:176179617-176179639 ATACAAAGACAAGTCACTGATGG + Intergenic
943604011 2:189954754-189954776 AATATCAGAAAAGTCACTGATGG - Intronic
943981138 2:194552349-194552371 AAGAAAAGAGAAACCACTGATGG + Intergenic
945446596 2:209945586-209945608 CAGATAATAGAAGACACTGAAGG - Intronic
946216273 2:218186245-218186267 AACATAGGGCAAGTCACTGGTGG - Intergenic
947897637 2:233690495-233690517 AAGATAAAACAAATCTCTGTTGG - Intronic
1169273255 20:4216764-4216786 AAGCTCTGACAGGTCACTGAGGG + Intergenic
1170179828 20:13517778-13517800 TATATAAGTAAAGTCACTGATGG - Intronic
1170338934 20:15301515-15301537 AATTTCAGACAGGTCACTGAAGG + Intronic
1171131710 20:22660110-22660132 AAGATAGGACAATGCACTGTCGG - Intergenic
1171261084 20:23735184-23735206 AGGATAAGAGAAGTGACTCAGGG + Intergenic
1174483394 20:50846285-50846307 CAGCTAAGACATGTCACAGAAGG - Intronic
1174936711 20:54878380-54878402 AAAAAAAAAAAAGTCACTGAGGG + Intergenic
1175391539 20:58630798-58630820 AAGAAAAGACTTCTCACTGAGGG - Intergenic
1177670217 21:24214789-24214811 AGGATAAGACTAATAACTGAGGG - Intergenic
1178829005 21:36039564-36039586 GAGAAAAGACAAGACACTGCAGG + Intronic
1178932920 21:36835184-36835206 ATGATCAGTAAAGTCACTGATGG + Intronic
1179066825 21:38032564-38032586 AAGAAAAGGGAAGTCACTGGAGG + Intronic
1179134689 21:38668966-38668988 AAGATAAGTCCAGAAACTGAGGG + Intergenic
1180575817 22:16772964-16772986 AAGATAAGAAAGGTCACTTCTGG - Intergenic
1182166266 22:28177077-28177099 ATGAAAAGTCAAGTCACAGACGG + Intronic
1182347162 22:29674347-29674369 AAGATGAGCCCAGTCACTGAGGG - Intronic
1182504357 22:30771330-30771352 AAGACAAGGCAAGTTGCTGAGGG + Intronic
1182525630 22:30916593-30916615 AAGAAAAGACTACTCAATGAAGG + Intergenic
1183246606 22:36698656-36698678 AAGAAAGGAGAAGCCACTGATGG + Intronic
1183758024 22:39788839-39788861 AAGAGATTACAACTCACTGAGGG + Intronic
949835300 3:8262731-8262753 ATGAAAAGATAAGTCACAGACGG - Intergenic
950173115 3:10852911-10852933 AAGATAAGATGAGGCACAGATGG + Intronic
952236877 3:31488988-31489010 AAAAAAAGATTAGTCACTGAAGG - Intergenic
952270200 3:31823479-31823501 AAGATAAGCCAAGCCACAAATGG + Intronic
952481161 3:33763305-33763327 GAGAAAAGACAATTCACAGATGG - Intergenic
955199389 3:56836623-56836645 AAGATACAAAAAGTCACTGTGGG + Intronic
955620928 3:60863128-60863150 AAGATAAGATGAATCATTGATGG + Intronic
955829786 3:62988851-62988873 AAGATAGCACAAGTAATTGAAGG + Intergenic
956987686 3:74722043-74722065 AAGATATGAGAAGTCCCTAAGGG - Intergenic
957425604 3:80035243-80035265 AAGACAATAGAAGTCACAGAAGG - Intergenic
958499929 3:94892347-94892369 AAGATAAGACAACTCAATTACGG + Intergenic
958731268 3:97962903-97962925 AAGAAAAGACAAATCACAAAGGG + Intronic
959457670 3:106583286-106583308 AAGAAAAGACAAGTTCCTAAAGG - Intergenic
959919598 3:111856200-111856222 CAGATAAAACAAGGCAGTGAAGG + Intronic
960194521 3:114749014-114749036 AAGGTAGGACAAGTCACAGGAGG + Intronic
960200459 3:114828966-114828988 AAGATAAGCCTGGTCACTTATGG + Intronic
962180005 3:133196757-133196779 AAGAGGACAAAAGTCACTGAAGG - Intronic
962825036 3:139093556-139093578 AAGCAAAGTGAAGTCACTGAAGG - Intronic
963837850 3:150074925-150074947 GAGATAAGAGAAGGCAGTGAGGG + Intergenic
963995822 3:151707391-151707413 AAGATAACAGCAGTCACTGTAGG - Intergenic
966166773 3:177028361-177028383 AAGATACTACAAGACATTGAAGG - Intronic
967699588 3:192576040-192576062 CAGATAAATCAGGTCACTGAGGG + Intronic
972831469 4:42819099-42819121 ACTAGAAGACAAGTCCCTGAGGG - Intergenic
973053302 4:45621989-45622011 AATATATGCCAAGTCACTGTGGG - Intergenic
974328679 4:60448181-60448203 AAGATAAGAAAAGTCACTGGTGG - Intergenic
974397775 4:61361605-61361627 AAGATTAGATGAGTCACTGTAGG + Intronic
975070039 4:70123429-70123451 AAGATAAGCCAAGGATCTGATGG + Intergenic
975989416 4:80241888-80241910 AAGATAAGGGAAGCCAATGAAGG - Intergenic
976103682 4:81593440-81593462 AAGATAGGACCATTCAGTGAGGG + Intronic
976353796 4:84090878-84090900 GAGATAAGAAAATTCCCTGAAGG - Intergenic
978129439 4:105177332-105177354 ATGAGAAGACAAGCCACAGATGG + Intronic
978963373 4:114711484-114711506 AAAATAAGTCAAGCCATTGAAGG - Intergenic
979461911 4:120993435-120993457 AAAATAAGACAAGGCACACAAGG + Intergenic
980533429 4:134084670-134084692 AAGAAAAGAGAAGTCTCAGAAGG + Intergenic
980749793 4:137073610-137073632 AAAATCAGTCAAGGCACTGAAGG - Intergenic
981786115 4:148481494-148481516 AAGAAAAGGCAAATTACTGAAGG - Intergenic
982388571 4:154839039-154839061 AAGATAAGAAAAGTCATTAGAGG - Intergenic
982528470 4:156507972-156507994 AAGATAAAAAAAGTCATAGAAGG + Intergenic
983795086 4:171852802-171852824 AAGATAAGTCAAGTCACTTCCGG + Intronic
986440977 5:7781519-7781541 AAGCTAAGAAAAGCCAATGATGG + Intronic
986914381 5:12599291-12599313 ATGAGAAAAAAAGTCACTGATGG - Intergenic
988026029 5:25691205-25691227 AAGATAAAACACGTATCTGAAGG + Intergenic
988239823 5:28595448-28595470 TAGATAAGAAAAGTCACATATGG - Intergenic
988922599 5:35957514-35957536 GAGTGAAGACAAGGCACTGATGG - Intronic
990229081 5:53690908-53690930 AAGAAAATCCAAGTAACTGATGG + Intergenic
991188729 5:63843169-63843191 AAAATATTACAAGTCACTGAAGG + Intergenic
991863943 5:71039604-71039626 AAGATAAGAATATTCACTGGTGG - Intronic
992851663 5:80816237-80816259 CAGCTATGACAAGTCAATGAAGG + Intronic
994141403 5:96345788-96345810 GAGATATGACAAGGAACTGAGGG - Intergenic
994255516 5:97589556-97589578 ATGAAAAGACAAGACACAGATGG - Intergenic
995968188 5:117935492-117935514 AAGATAACAAAAATAACTGAAGG + Intergenic
996988173 5:129593882-129593904 AAGATTAGAACAGCCACTGAGGG - Intronic
998221723 5:140287643-140287665 AAGAAAAGACAAGCCACAGATGG + Intronic
998762917 5:145452227-145452249 AAGTGACGACAAGTCATTGAGGG - Intergenic
999834166 5:155351750-155351772 ATGAGAAGACAAGTCACAGATGG + Intergenic
1000502918 5:162075101-162075123 AAGGAAAGAAAAGGCACTGAGGG + Intronic
1000715342 5:164636669-164636691 AAGATTTGACATGTCATTGAGGG + Intergenic
1001023203 5:168201179-168201201 AAGTTAACACCACTCACTGATGG - Intronic
1004523982 6:16388728-16388750 ATGTTAAAACAAGTCACTAAAGG - Intronic
1005731803 6:28704762-28704784 AAGCTAAGACAAGGCAAGGAAGG + Intergenic
1006418191 6:33917745-33917767 AAGCTAAGTAAAGTCAATGAAGG + Intergenic
1007896532 6:45367067-45367089 AAGCTACTACAAATCACTGATGG + Intronic
1009551427 6:65098538-65098560 AAGATAAGCCAATTTACTGCTGG - Intronic
1011579384 6:88842596-88842618 AACAGAAGACAATTCCCTGAAGG + Intronic
1011944807 6:92887693-92887715 AAGATAAGAAAAGCCACTTGAGG - Intergenic
1012107018 6:95175285-95175307 CAGATAAGACATGGCTCTGATGG + Intergenic
1012182180 6:96167921-96167943 GAGGTCAGAGAAGTCACTGAAGG + Intronic
1013457031 6:110339404-110339426 AAGAAAAAACAAGTCAATAAAGG + Intronic
1013539501 6:111093802-111093824 AAGCTAAGAGAACTCACTTATGG + Intronic
1014419372 6:121222112-121222134 AACAGAATACAACTCACTGAAGG + Intronic
1014478127 6:121900582-121900604 AAAATATTACAATTCACTGAAGG + Intergenic
1014689224 6:124541785-124541807 ATGTTAACACAAGTCTCTGATGG - Intronic
1015268865 6:131318253-131318275 AAGATTAGTCAATTTACTGAAGG - Intergenic
1015389297 6:132663196-132663218 AAGATAAGAGAAATCCCAGAAGG + Intergenic
1015666645 6:135637951-135637973 AGGAAAAAACAAGTCACAGAAGG - Intergenic
1015746882 6:136519648-136519670 AAAAGAAGAGAAGTCACTGCAGG + Intronic
1015783216 6:136893182-136893204 AAGAAAAAAAAAGCCACTGAAGG - Intronic
1015895116 6:138009508-138009530 AAGATGAGACAAGTTAGTAATGG + Intergenic
1017554858 6:155552044-155552066 AAGATAAGATATGCTACTGAAGG + Intergenic
1017919814 6:158861387-158861409 AAGAGAAAATAAGTAACTGATGG - Intergenic
1018441118 6:163814234-163814256 AAGACAAGGAAAGTCCCTGAGGG - Intergenic
1020499012 7:8891761-8891783 AAGGTAACACAATTCAATGAAGG - Intergenic
1020713905 7:11645329-11645351 AAAATAACACAAAACACTGATGG - Intronic
1020967687 7:14892428-14892450 AAGATAATAGATGACACTGAGGG + Intronic
1021542365 7:21774433-21774455 AGGAGCAGACAAGTCACTAAGGG - Intronic
1022308096 7:29169425-29169447 AAAATAGGACAAATCACTAATGG - Intronic
1023062214 7:36338940-36338962 AAGATAGGACAACTCAAAGAGGG - Intronic
1023357184 7:39379053-39379075 ATGGTAAGATAAGTCATTGATGG + Intronic
1024133469 7:46381612-46381634 AAAATATTACAATTCACTGAAGG + Intergenic
1027372865 7:77524998-77525020 AGGATAAGGAGAGTCACTGAAGG + Intergenic
1027615024 7:80411726-80411748 AAGAGAATACAAGTCAATTATGG + Intronic
1027674932 7:81145380-81145402 AAGAAAAGCCAAGGAACTGATGG + Intergenic
1027818667 7:83014008-83014030 AAGAGAAAACAAGCAACTGATGG + Intronic
1028396978 7:90380425-90380447 GTGAAAAGACAAGTCACAGAAGG - Intronic
1030465529 7:109898581-109898603 AAGATAAGAAAAATCACAAATGG - Intergenic
1030664819 7:112264886-112264908 AAAAGATGACAACTCACTGAAGG - Intronic
1030758241 7:113316761-113316783 AAGATAAGAAAATTCACTTTTGG - Intergenic
1033958033 7:146876240-146876262 AAGATGAGAGCAGACACTGAAGG + Intronic
1034366507 7:150553724-150553746 AATATTAGACAGATCACTGAGGG + Intergenic
1035135116 7:156695845-156695867 AAGAAAAAAAAAGACACTGATGG + Intronic
1035621954 8:1041905-1041927 AAGAGAAGAGCAGGCACTGATGG - Intergenic
1038109392 8:24478757-24478779 AAGAAAAGACAACCCACTGTTGG - Intronic
1038130655 8:24727478-24727500 AAGATGAGAGAAGGCACAGAAGG - Intergenic
1038770245 8:30471986-30472008 AACATAAGACAAGGAATTGATGG + Intronic
1038903902 8:31875578-31875600 AAGAAAAGAGAACCCACTGAAGG - Intronic
1039648658 8:39316014-39316036 AAGCTAAGACAAATCACTAGGGG - Intergenic
1039653227 8:39367133-39367155 ATAAAAAGACAAGTCACAGAGGG + Intergenic
1041308808 8:56492880-56492902 ATGAAAAGAGAAGTCACAGACGG - Intergenic
1041401164 8:57446833-57446855 GAGAAAAGAAAAGCCACTGATGG + Intergenic
1042126475 8:65542418-65542440 CACATAAAAAAAGTCACTGAAGG + Intergenic
1043483410 8:80675415-80675437 AATAAAAGAGAAGTTACTGAAGG + Intronic
1044495391 8:92872592-92872614 AAGAAAAAAAAAATCACTGAAGG + Intergenic
1045214368 8:100131717-100131739 AAGATCTAAAAAGTCACTGAAGG + Intergenic
1045846896 8:106647674-106647696 ATGATAAGCCAAACCACTGATGG - Intronic
1045952928 8:107872082-107872104 ATGAAAAGACAAGCCACAGATGG + Intergenic
1047405556 8:124582832-124582854 AAGAAAACACAACTCACTTAAGG - Intronic
1048396507 8:134019153-134019175 CAGAAAAGGCAAGACACTGATGG + Intergenic
1048703614 8:137123827-137123849 AGGATAAAACAACACACTGAAGG - Intergenic
1049003035 8:139838155-139838177 AAGAAGAGGCAAGTCACGGATGG - Intronic
1051089158 9:13385786-13385808 AAGACAAGGCAAGTCTCTTATGG - Intergenic
1051266568 9:15314891-15314913 AAAAGATTACAAGTCACTGAAGG + Intergenic
1051398637 9:16655444-16655466 GAGATAAAATAAGTCACTGCAGG - Intronic
1051969983 9:22876673-22876695 AATATAAGAAAAATAACTGAGGG - Intergenic
1052058282 9:23927281-23927303 ATGAAAAGACAAGTTACAGATGG + Intergenic
1052548371 9:29911006-29911028 AGGATAAGAAGAGTAACTGAAGG + Intergenic
1052804026 9:32996658-32996680 AAGAGAAGACAGCTCAATGAAGG - Intronic
1053343223 9:37357148-37357170 AAGAGAAGACAAGTCTCCCAAGG + Exonic
1053551419 9:39083188-39083210 AAGAAAAGAAAACCCACTGAAGG - Intronic
1053815534 9:41903305-41903327 AAGAAAAGAAAACCCACTGAAGG - Intronic
1054615062 9:67284135-67284157 AAGAAAAGAAAACCCACTGAAGG + Intergenic
1054879685 9:70131813-70131835 AAGATAGGACAACTGGCTGATGG - Intronic
1055250945 9:74304549-74304571 AAAATCAGACATGCCACTGAAGG - Intergenic
1055419421 9:76122796-76122818 AAGAAAAAATAAGTAACTGATGG - Intronic
1055748577 9:79478595-79478617 TTGATAAGACATTTCACTGATGG + Intergenic
1056197247 9:84240579-84240601 AAGAAAAGGCAAGTGAATGAAGG + Intergenic
1056205425 9:84315270-84315292 AACAGAACACAGGTCACTGAGGG + Intronic
1057085234 9:92203857-92203879 AAGATAAAACATGTTCCTGATGG - Intergenic
1057739878 9:97701742-97701764 AAGATAAAAGAAATCACTCAAGG + Intergenic
1057943307 9:99303729-99303751 AAGAGAAGACAAATCAGGGAAGG + Intergenic
1058336642 9:103837626-103837648 AATATAAGGCAAGTAACTGAGGG - Intergenic
1059578956 9:115522679-115522701 AAGAAAAGAGATCTCACTGATGG - Intergenic
1059884821 9:118734190-118734212 AAGAGAAGAGAAGACAATGAGGG + Intergenic
1061632849 9:131884287-131884309 AAGTTAAGAAAAGTCAATGAAGG + Intronic
1061650441 9:132044092-132044114 AAGAGAAAAAAAGTCACAGAGGG + Intronic
1062738367 9:138151432-138151454 AAGATAAGAAAAGACACCGCAGG - Intergenic
1186528540 X:10271960-10271982 AAGATAGGAAAAGTCACAAAGGG - Intergenic
1187037535 X:15557579-15557601 AAGATAACAAGAGTCATTGAGGG + Intergenic
1187359644 X:18613122-18613144 AAGAAAAAGTAAGTCACTGATGG - Intronic
1187578543 X:20584007-20584029 ATGAAAAGACAAGTCACAGATGG + Intergenic
1189788396 X:44580642-44580664 AAGATTATATGAGTCACTGAAGG + Intergenic
1190040799 X:47070416-47070438 TAGAAAACACTAGTCACTGAAGG + Intergenic
1190416201 X:50182806-50182828 GAGATATGACAAGTCACTCTAGG + Intergenic
1191727249 X:64294021-64294043 AAGCTAAGGCAAGACCCTGAAGG + Intronic
1192960373 X:76124221-76124243 CAGATAAGACCAGAGACTGAAGG - Intergenic
1194381626 X:93198967-93198989 AAGAGAAGAAAAGATACTGATGG + Intergenic
1194637045 X:96358964-96358986 AAAATGAGAATAGTCACTGAAGG - Intergenic
1195412694 X:104585561-104585583 AAGATGAGAAAAATAACTGATGG - Intronic
1196912347 X:120496927-120496949 AAGACAAGACAAGCCAATGCTGG - Intergenic
1198492538 X:137156922-137156944 ATAAAAAGACAAGTCACAGAAGG + Intergenic
1199621759 X:149707468-149707490 AGGATAAGACACTTTACTGAGGG - Intronic
1199923565 X:152436883-152436905 ATGAAAAGACAAGCCACAGAAGG + Intronic
1200477495 Y:3657506-3657528 AAGAGAAGAAAAGCCACTAAAGG - Intergenic
1201611644 Y:15849396-15849418 AAGATACGAAAAGTCAGTGATGG - Intergenic