ID: 1130154886

View in Genome Browser
Species Human (GRCh38)
Location 15:81341690-81341712
Sequence ATAAGACAAGTCACTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 207}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130154881_1130154886 -6 Left 1130154881 15:81341673-81341695 CCCTCCACCTTCTAAAGATAAGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 207
1130154876_1130154886 16 Left 1130154876 15:81341651-81341673 CCCTGAAGTCCCGAGACCACAAC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 207
1130154882_1130154886 -7 Left 1130154882 15:81341674-81341696 CCTCCACCTTCTAAAGATAAGAC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 207
1130154878_1130154886 7 Left 1130154878 15:81341660-81341682 CCCGAGACCACAACCCTCCACCT 0: 1
1: 0
2: 6
3: 24
4: 259
Right 1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 207
1130154877_1130154886 15 Left 1130154877 15:81341652-81341674 CCTGAAGTCCCGAGACCACAACC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 207
1130154880_1130154886 0 Left 1130154880 15:81341667-81341689 CCACAACCCTCCACCTTCTAAAG 0: 1
1: 0
2: 7
3: 33
4: 524
Right 1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 207
1130154875_1130154886 17 Left 1130154875 15:81341650-81341672 CCCCTGAAGTCCCGAGACCACAA 0: 1
1: 0
2: 0
3: 14
4: 89
Right 1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 207
1130154879_1130154886 6 Left 1130154879 15:81341661-81341683 CCGAGACCACAACCCTCCACCTT 0: 1
1: 0
2: 1
3: 28
4: 252
Right 1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 207
1130154883_1130154886 -10 Left 1130154883 15:81341677-81341699 CCACCTTCTAAAGATAAGACAAG 0: 1
1: 0
2: 1
3: 17
4: 242
Right 1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130154886 Original CRISPR ATAAGACAAGTCACTGAAGG TGG Intronic
903421432 1:23220203-23220225 ACAATACAAGCCACTGAAGATGG + Intergenic
908020621 1:59894371-59894393 ATAAGAAGAACCACTGAAGGAGG - Intronic
909836078 1:80256752-80256774 ATGAGACTACTCAGTGAAGGAGG + Intergenic
911247015 1:95529375-95529397 ATAAGATAAGGCAGTGAAGGAGG - Intergenic
911592546 1:99764949-99764971 AAAAGACAAGTCACCAAATGTGG - Intronic
914932415 1:151947055-151947077 ACAAGACAAGTCATTTAAGTGGG + Intergenic
916304098 1:163309807-163309829 ATAAGAGGAATCACTGAAGCAGG + Intronic
916618990 1:166474791-166474813 GTATGAGAAGTCACTGAAGCAGG - Intergenic
917477228 1:175379193-175379215 AAAAAAAAAGTCACTGGAGGAGG + Intronic
917757031 1:178112132-178112154 ATAAGACCAGCCACAGAATGAGG - Intronic
918245423 1:182655366-182655388 ATAAGAAAAGTCACTGAGGAAGG + Intronic
921875677 1:220192842-220192864 AAAAGTCAAGTCAGTGAAGATGG + Intronic
1064332033 10:14402984-14403006 ATAAGACAAGAAGCTGGAGGAGG + Intronic
1065761849 10:28989959-28989981 AAAAGACAAATCACTGATGCAGG + Intergenic
1069190760 10:65485395-65485417 ATAAGACAAGTTACTCTAGATGG + Intergenic
1069718094 10:70533625-70533647 ATAAGATAATGCCCTGAAGGGGG - Intronic
1069793602 10:71039072-71039094 CTAAGACAGGTGTCTGAAGGAGG + Intergenic
1070609698 10:77925332-77925354 AGAAGACATGGCACTGAGGGAGG - Intronic
1071138128 10:82475677-82475699 ATAAAACAATTAACTGAAAGTGG + Intronic
1072075837 10:91972479-91972501 ATAAAACAAGTTACAGAAGTTGG - Intronic
1074384862 10:113008778-113008800 AAACCACAAGTCACTAAAGGAGG - Intronic
1076506884 10:130984277-130984299 CTATGGCAAGTCACTGAAGATGG - Intergenic
1077036263 11:495923-495945 AAAAGACAAAACACTGAGGGTGG + Intronic
1077694061 11:4377470-4377492 ATAATACAAGGGACTGAAGTAGG - Intergenic
1077972478 11:7209020-7209042 ATAAAAGAATTCACTCAAGGTGG - Intergenic
1079862325 11:25688815-25688837 CTATGACAAGTCAGTTAAGGTGG + Intergenic
1082984403 11:59155545-59155567 ATATAAAACGTCACTGAAGGAGG - Intergenic
1083279579 11:61618594-61618616 AGAAGAGAAGTCATTGTAGGTGG - Intergenic
1086208664 11:84292149-84292171 AAAAGAAATGTCACTGAAGCTGG + Intronic
1086564219 11:88206850-88206872 ATACAACAAATCACAGAAGGAGG - Intergenic
1087962756 11:104372700-104372722 AAAACAGAAGTCTCTGAAGGAGG + Intergenic
1089523910 11:119084320-119084342 TAAAGACAAGTAACTGAAGTGGG - Intergenic
1093047184 12:14460800-14460822 GTAAGACCACTCACTGTAGGTGG - Exonic
1096097061 12:48942456-48942478 AACAGACAACTAACTGAAGGAGG - Intronic
1099861250 12:88228193-88228215 AAAAGACAGGTCACTTAGGGTGG - Intergenic
1101320672 12:103670469-103670491 TTAAGGGAAGTCACTCAAGGGGG - Intronic
1103584770 12:121944107-121944129 ATGAGACAAGTCACAAAAGCAGG - Intronic
1103880477 12:124162360-124162382 CTAAGGCAACTCACAGAAGGTGG - Intronic
1105695813 13:22887395-22887417 ATACATCAAGTCACTGAAGTAGG + Intergenic
1106479032 13:30123142-30123164 AGCACACAAGTCAATGAAGGAGG - Intergenic
1106783135 13:33079885-33079907 ACAAACCCAGTCACTGAAGGTGG + Intergenic
1107637675 13:42409048-42409070 AGAAGAGAAGACACTGAAGGTGG - Intergenic
1107696704 13:43007553-43007575 ATAACACAAGTCACTGGAACAGG - Intergenic
1109569446 13:64167093-64167115 ATAAGACTAGAGACAGAAGGAGG + Intergenic
1109569905 13:64174440-64174462 ATAAGCCACCTCACTGAGGGAGG + Intergenic
1109657614 13:65414441-65414463 AAAAGACAACTCACTCACGGAGG - Intergenic
1110017280 13:70423217-70423239 AAAATAAAAATCACTGAAGGTGG - Intergenic
1111400120 13:87722960-87722982 TTAAGACAAGTCTCTGGAGAAGG - Intergenic
1114504354 14:23197758-23197780 AGAAGACAAGACATAGAAGGGGG - Intronic
1117570366 14:57042388-57042410 AGAAGACAAGTCTCCCAAGGAGG + Intergenic
1117570547 14:57044741-57044763 AGAAGACAAGTCTCCCAAGGAGG - Intergenic
1117980205 14:61335274-61335296 AGAAAACATGTTACTGAAGGGGG - Intronic
1120435015 14:84470555-84470577 ATAATACAAGTCCCTGAATCAGG - Intergenic
1120609136 14:86618996-86619018 CTGAGACAAGCAACTGAAGGAGG - Intergenic
1121196454 14:92077315-92077337 CTAACATCAGTCACTGAAGGAGG + Intronic
1122148377 14:99707743-99707765 AAAAAAAAAATCACTGAAGGAGG - Intronic
1123877746 15:24640777-24640799 TCAAGACAAGTCACTGGAGTGGG + Intergenic
1125669745 15:41462049-41462071 CTAAAAAAAGTCACTGAAGCTGG - Intronic
1127808075 15:62539501-62539523 CTAAGACAAGGGCCTGAAGGAGG + Intronic
1128754984 15:70176553-70176575 ATTAGATAAGTCAATGAAAGAGG - Intergenic
1130154886 15:81341690-81341712 ATAAGACAAGTCACTGAAGGTGG + Intronic
1130243219 15:82217917-82217939 ATATGACAAGAAACTGTAGGTGG + Intronic
1131833928 15:96371569-96371591 ATATGACAAATAAATGAAGGAGG - Intergenic
1131874486 15:96790214-96790236 ATGTGACAAGGAACTGAAGGTGG - Intergenic
1134749738 16:16616499-16616521 CTAAGACAAGTCCCTGAATCTGG + Intergenic
1134776364 16:16857110-16857132 ATAAGACAAGACACAGAGTGGGG + Intergenic
1134995734 16:18737116-18737138 CTAAGACAAGTCCCTGAATCTGG - Intergenic
1135080907 16:19434781-19434803 ACAAGATAAGGCACAGAAGGTGG - Intronic
1138194819 16:55044320-55044342 ATAAGGCGAGAAACTGAAGGAGG + Intergenic
1139176015 16:64688589-64688611 ATAAAACAAGTTACTGAAGAAGG + Intergenic
1139958440 16:70704409-70704431 ATAAGACAGGTCACTGATTTGGG + Intronic
1140135120 16:72198974-72198996 ATAAGACAAATCACTTAAAAGGG - Intergenic
1143045125 17:4071962-4071984 ATATGAAAAGTCAATGAAGGAGG + Intronic
1144039695 17:11399241-11399263 ATAAGACCAGGCACTGTAGCCGG - Intronic
1144711737 17:17405783-17405805 ATAAGACAAGGCGCTGGAGGAGG + Intergenic
1149569165 17:57660321-57660343 ACAAAACCAGTCACTGAGGGTGG + Intronic
1149609415 17:57949229-57949251 ATAAGACAAAGCACTGAGGAAGG - Intronic
1149833024 17:59888352-59888374 CTAAAGCAAGTCAGTGAAGGTGG + Intronic
1150572727 17:66401814-66401836 ATAAGAATAGACACTGAGGGTGG + Intronic
1151005482 17:70431370-70431392 AAAACACAAGTCAGTGAAGTAGG + Intergenic
1151868831 17:76822719-76822741 CTAAGACACGTCACTGAGAGTGG - Intergenic
1155699478 18:28725643-28725665 ATAAGAGAAGTACCTGAATGAGG + Intergenic
1156732770 18:40215512-40215534 ATGAGGCAAGTCACTTTAGGTGG - Intergenic
1156747267 18:40407297-40407319 ATAAGGGAGGTCACTCAAGGTGG - Intergenic
1157034898 18:43959946-43959968 AGAATACAAGTCCCTGAAGAAGG + Intergenic
1157576841 18:48749300-48749322 ATAAAGGAAGTCACTGAAGGTGG + Intronic
1157867469 18:51198223-51198245 TTAAGAAGAGTCACGGAAGGAGG + Intronic
1159672301 18:71236767-71236789 ATAAGACAAGCATCTGTAGGAGG + Intergenic
1164235422 19:23328481-23328503 AGAAGAAAAGACACTGAATGAGG + Intronic
1164300873 19:23962029-23962051 AGAAGAAAAGACACTGAATGAGG - Intergenic
1164563948 19:29312585-29312607 AGAAGAAAAGTCACCGAAAGGGG + Intergenic
1166792967 19:45408760-45408782 AGAAGACAAGACAGTGAAGCAGG + Exonic
925241318 2:2332243-2332265 ACAACACCAGTCAGTGAAGGGGG - Intergenic
926546153 2:14242834-14242856 ACAAAGCAAGTCACTGAAGTGGG + Intergenic
926686278 2:15700417-15700439 AGAATAAAATTCACTGAAGGTGG + Exonic
927266272 2:21155287-21155309 ATAAAACAAGACACTGAAATTGG - Intergenic
928149456 2:28812554-28812576 ATATAAAAATTCACTGAAGGAGG + Intronic
928191219 2:29170535-29170557 AAAAGACAAGTCACAGACTGGGG - Intronic
928207228 2:29294289-29294311 TTATGAGAAGTCACTGATGGAGG - Intronic
928558979 2:32458843-32458865 ATAAAAAAATTCACTGATGGTGG - Intronic
929528232 2:42726288-42726310 AGGAGGCAAGCCACTGAAGGGGG - Intronic
929870046 2:45751557-45751579 AAAAGTCAAGTCTCTGAAGGAGG + Intronic
931865257 2:66403304-66403326 AAAAGACAAGCCACAGACGGGGG + Intergenic
932035028 2:68236115-68236137 ATAAGACAATTCTCAGAAAGGGG - Intronic
933012537 2:77086242-77086264 ATAAGAGAAGTGAGTCAAGGAGG + Intronic
934676651 2:96254081-96254103 ATAAGAAAAGCCAATGACGGTGG + Exonic
935921861 2:108024351-108024373 ATATTAAAAGTCACTGAAGAAGG - Intergenic
935970799 2:108529013-108529035 ATACAACAAGTCACTGAGGTAGG + Intergenic
936369045 2:111887496-111887518 AAAAGACAACTCACAGAATGGGG + Intergenic
936419384 2:112348872-112348894 ATACAACAAGTCACTGAGGTAGG - Intergenic
936560193 2:113531287-113531309 GTAAGGCAAGGTACTGAAGGAGG - Intergenic
936774739 2:115959259-115959281 AAAAGACAAGTCACAGAGTGGGG - Intergenic
942552383 2:177132779-177132801 ATATGAGAAGTCACTGGTGGTGG - Intergenic
944559573 2:200922200-200922222 ATTATAAAAGTCAGTGAAGGAGG + Intronic
1170346463 20:15392282-15392304 ATAATAAAAGTCAATGATGGTGG - Intronic
1181367984 22:22394284-22394306 ATAAGAGTAGTCACTGGAAGTGG - Intergenic
1181371454 22:22421502-22421524 AGAAGAGCAGTCACTGAAAGTGG - Intergenic
1181374796 22:22448531-22448553 ATAAGAGCAGTCACTGGAAGTGG - Intergenic
1182225523 22:28795247-28795269 AGAGGACATGTCACTGAATGGGG + Exonic
1182395842 22:30035261-30035283 CCAAGACAACTCACTAAAGGTGG - Intergenic
1184818055 22:46887061-46887083 AAAAGGCAAGTCACAGAAGGAGG + Intronic
949202959 3:1402420-1402442 ATAAGAACAGTCAGTGATGGTGG + Exonic
950381712 3:12621050-12621072 ATAAAACAAGTTTCTGAAGGAGG - Intronic
951014348 3:17713593-17713615 AAAAGACAAGCCACAGAATGGGG + Intronic
951658147 3:25032219-25032241 ATAAGACAGCTCACTGATTGCGG - Intergenic
952577914 3:34796962-34796984 ATAAGCCACGTGCCTGAAGGAGG - Intergenic
953052803 3:39361471-39361493 GCAGGACAAGTCACTGAATGAGG - Intergenic
955452251 3:59081796-59081818 AAAAGACAATTCACAGAATGGGG - Intergenic
955726432 3:61937950-61937972 CTAAGATAATTCACTGAAGGGGG - Intronic
955829787 3:62988854-62988876 ATAGCACAAGTAATTGAAGGTGG + Intergenic
957572470 3:81965249-81965271 AAAATACAAGTCACTGCAGCAGG - Intergenic
958093942 3:88916111-88916133 ATGAGACCAGTCACTGAAAGTGG + Intergenic
958743785 3:98109198-98109220 ACAAGGCAAGACACTGAAAGAGG - Intergenic
958801420 3:98760554-98760576 ATAATACAAATCACTGACCGAGG - Intronic
960769476 3:121177313-121177335 AAAAGACAACTCACTGAGTGGGG + Intronic
963297639 3:143563595-143563617 ATAAGACAATCCAAGGAAGGGGG + Intronic
970248977 4:14094124-14094146 ATAAAACAAGTCAATGCATGTGG - Intergenic
972030646 4:34453495-34453517 ATGATACAAGTACCTGAAGGTGG - Intergenic
973053301 4:45621986-45622008 ATATGCCAAGTCACTGTGGGTGG - Intergenic
974066715 4:57085284-57085306 ATAACAGGAGTCACTGAAGAAGG - Intronic
974092933 4:57331330-57331352 AAAAGACAAGTCCCCAAAGGAGG + Intergenic
975067479 4:70086032-70086054 AAAAGAAAATTCACTGAAGTGGG + Intergenic
977580664 4:98721467-98721489 TTTAGGCAAGTCACTGGAGGAGG + Intergenic
982023443 4:151228658-151228680 ACAAAACAAATCACTGAGGGTGG + Intronic
982322885 4:154098456-154098478 CTAACACAAATCACTCAAGGTGG + Intergenic
984337099 4:178406849-178406871 AAAAGACAAGCCACTGACTGAGG + Intergenic
984377263 4:178947580-178947602 GTAAGACAAGTCATGGAAGCTGG + Intergenic
985584946 5:725956-725978 TTAATACAAGCCACTGAATGAGG + Intronic
985598451 5:810270-810292 TTAATACAAGCCACTGAATGAGG + Intronic
986205296 5:5619144-5619166 ATAACACAAGTCGCTGCAGAAGG - Intergenic
987180463 5:15362256-15362278 AAAAGAAGAGTCTCTGAAGGAGG + Intergenic
987314322 5:16710220-16710242 ATGTGACAAGTCATTGAAGGTGG + Intronic
987413560 5:17639102-17639124 AAATGACAATTCACTCAAGGAGG + Intergenic
989095830 5:37780485-37780507 ATACGTCAAGTCACTGAGGTAGG - Intergenic
991108814 5:62874150-62874172 AAAAGACAAGCCACAGAATGGGG + Intergenic
992733539 5:79696249-79696271 TTCTGACAAGTCACAGAAGGCGG - Intronic
993671291 5:90764556-90764578 ATGGGGCCAGTCACTGAAGGGGG - Intronic
994102140 5:95905049-95905071 AAAAGCCAAGTATCTGAAGGTGG - Intronic
996189837 5:120526502-120526524 ATAACACGAGTAAGTGAAGGAGG - Intronic
996572437 5:124946343-124946365 ATACAACAGGTGACTGAAGGCGG - Intergenic
1000217622 5:159178103-159178125 ATAAGCCATGGCACTAAAGGTGG - Intronic
1001213965 5:169838114-169838136 AGATCAAAAGTCACTGAAGGAGG + Intronic
1001505657 5:172277761-172277783 AAAAGACAACTCACAGAATGGGG + Intronic
1001675413 5:173508557-173508579 ATAATACTATTCACTGAAGTAGG - Intergenic
1002391091 5:178912351-178912373 ATAAGGAAAGGCACTAAAGGCGG - Intronic
1004417039 6:15434273-15434295 AAAAGATAAGTCACTGATTGAGG - Intronic
1007689406 6:43689442-43689464 AAAAGAAAAGTCAATCAAGGTGG + Intergenic
1008108520 6:47466948-47466970 TTAAGACAAATTAGTGAAGGAGG - Intergenic
1008306362 6:49906090-49906112 ATAAAGGAAGTCACTGAAGAAGG + Intergenic
1008951449 6:57164061-57164083 ATAACACAAATCATGGAAGGAGG - Intronic
1009409344 6:63347506-63347528 ATTAGAAAAGACACTGAAGCAGG - Intergenic
1012553956 6:100489889-100489911 AAAATACAAGGCACTGAATGAGG + Intergenic
1012853028 6:104469560-104469582 ATAACACAAGTCACAGTAGCAGG - Intergenic
1016897517 6:149067715-149067737 ATAAGATATGTCAATGTAGGGGG + Intronic
1017503026 6:155042928-155042950 ATAAGTAAAGTAACTGAGGGAGG - Intronic
1020499011 7:8891758-8891780 GTAACACAATTCAATGAAGGAGG - Intergenic
1020567282 7:9813568-9813590 ATAAGTGAAATCACTGCAGGTGG + Intergenic
1021542364 7:21774430-21774452 AGCAGACAAGTCACTAAGGGAGG - Intronic
1022265973 7:28755236-28755258 AGATGAGAGGTCACTGAAGGAGG + Intronic
1022511836 7:30940309-30940331 AAAAGACAAAACACTGAAAGAGG - Intronic
1023101815 7:36725800-36725822 CAAAAACAAGACACTGAAGGGGG - Intergenic
1024169312 7:46767808-46767830 ATCAGACAAACCACAGAAGGTGG + Intergenic
1024516843 7:50266540-50266562 ACAAGCCAAGGCAATGAAGGTGG - Intergenic
1027421653 7:78022798-78022820 ATATGAAAAATCACTGGAGGAGG - Intronic
1031111483 7:117615315-117615337 ATAAGCCAAGCCACTGACTGAGG - Intronic
1035145038 7:156806440-156806462 AAAAAATAAGTCACTGAAGTTGG - Intronic
1035914887 8:3608202-3608224 GAAAGACAGGACACTGAAGGTGG + Intronic
1036942500 8:13065070-13065092 ATAAAACAAATCACTGAATTGGG + Intergenic
1039035904 8:33359065-33359087 CTAAGACAAATCACAGAAGATGG + Intergenic
1039165604 8:34676416-34676438 ATTTGACAAATCACTGAAGTAGG - Intergenic
1039292068 8:36107198-36107220 AAAAGACAAGTTACAGATGGGGG + Intergenic
1039516637 8:38139247-38139269 ATAAGAGCAGTCACTGGAAGTGG - Exonic
1040707513 8:50147300-50147322 ATAACAAACTTCACTGAAGGTGG + Intronic
1041567010 8:59290029-59290051 GTAAGACAAGTCTCTTAATGTGG - Intergenic
1045855975 8:106765993-106766015 ATAATCCAAGTCACAGAACGAGG - Intronic
1048420154 8:134270295-134270317 ATAAGCCAAGAGACAGAAGGAGG + Intergenic
1049634100 8:143677005-143677027 ATACATCAAGTCACTGAGGGAGG + Intergenic
1049892674 9:85077-85099 GTAAGGCAAGGTACTGAAGGAGG + Intergenic
1050520896 9:6498630-6498652 AAAAGACAAAGCACTAAAGGTGG - Intronic
1050598800 9:7230284-7230306 AGAAGACAAGCCCATGAAGGTGG - Intergenic
1053733903 9:41085132-41085154 GTAAGGCAAGGTACTGAAGGAGG + Intergenic
1054694504 9:68346416-68346438 ATAAGGCAAGGTACTGAAGGAGG - Intronic
1055725060 9:79218608-79218630 ATAAGATAAGTGACTAAAGGAGG + Intergenic
1056623421 9:88234366-88234388 AGAAGACAATTCTCTGCAGGGGG + Intergenic
1059771256 9:117428619-117428641 ACAAGAAAAGTCACTGAATGAGG + Intergenic
1060659762 9:125397937-125397959 ACACGAGCAGTCACTGAAGGCGG - Intergenic
1061186307 9:129056346-129056368 CTAAGACAAGGCTCGGAAGGGGG - Intronic
1061609207 9:131735188-131735210 ATGAGTGAAGCCACTGAAGGAGG + Intronic
1186382065 X:9071338-9071360 ATATGACAAGGGACTGAGGGTGG - Intronic
1186558513 X:10586182-10586204 ATACATCAAGTCACTGAAGTGGG - Intronic
1187196525 X:17090672-17090694 AAAAGACAAGTCACAGACTGTGG - Intronic
1187714430 X:22088737-22088759 AAAAGACAAGCCACAGAATGGGG - Intronic
1190749740 X:53351507-53351529 AAAAGACAAGCCACAGAATGGGG + Intergenic
1190771449 X:53518019-53518041 ATACATCAAGTCACTGAAGTAGG + Intergenic
1192592780 X:72374749-72374771 AAAAGACAACTCACAGAATGGGG - Intronic
1194322174 X:92461765-92461787 ATGAGACAACCCACAGAAGGGGG + Intronic
1194898355 X:99473634-99473656 ATTAGACAAGTGGCTGAAGAAGG - Intergenic
1195565086 X:106331270-106331292 AAAAGACAAGGTATTGAAGGTGG + Intergenic
1195655830 X:107330549-107330571 ATTGGACTAGTCAGTGAAGGAGG + Intergenic
1196459860 X:115918860-115918882 ATACGTCAAGTCACTGAGGTAGG - Intergenic
1196521920 X:116684045-116684067 AAAAGACAATTTACTGAATGGGG - Intergenic
1197511614 X:127375806-127375828 ATTAGACAAATCACTGAGGCAGG + Intergenic
1200630336 Y:5575242-5575264 ATGAGACAACCCACAGAAGGGGG + Intronic
1201322817 Y:12719280-12719302 ATAAGAAAAGGCAATGAAGCTGG - Intronic