ID: 1130154887

View in Genome Browser
Species Human (GRCh38)
Location 15:81341691-81341713
Sequence TAAGACAAGTCACTGAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130154877_1130154887 16 Left 1130154877 15:81341652-81341674 CCTGAAGTCCCGAGACCACAACC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1130154881_1130154887 -5 Left 1130154881 15:81341673-81341695 CCCTCCACCTTCTAAAGATAAGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1130154875_1130154887 18 Left 1130154875 15:81341650-81341672 CCCCTGAAGTCCCGAGACCACAA 0: 1
1: 0
2: 0
3: 14
4: 89
Right 1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1130154879_1130154887 7 Left 1130154879 15:81341661-81341683 CCGAGACCACAACCCTCCACCTT 0: 1
1: 0
2: 1
3: 28
4: 252
Right 1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1130154880_1130154887 1 Left 1130154880 15:81341667-81341689 CCACAACCCTCCACCTTCTAAAG 0: 1
1: 0
2: 7
3: 33
4: 524
Right 1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1130154883_1130154887 -9 Left 1130154883 15:81341677-81341699 CCACCTTCTAAAGATAAGACAAG 0: 1
1: 0
2: 1
3: 17
4: 242
Right 1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1130154882_1130154887 -6 Left 1130154882 15:81341674-81341696 CCTCCACCTTCTAAAGATAAGAC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1130154876_1130154887 17 Left 1130154876 15:81341651-81341673 CCCTGAAGTCCCGAGACCACAAC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1130154878_1130154887 8 Left 1130154878 15:81341660-81341682 CCCGAGACCACAACCCTCCACCT 0: 1
1: 0
2: 6
3: 24
4: 259
Right 1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130154887 Original CRISPR TAAGACAAGTCACTGAAGGT GGG Intronic
902025596 1:13381207-13381229 GAATACAAGTGACTGAACGTTGG - Intergenic
903912673 1:26739185-26739207 TAAGAAAAGTTACAGAAGCTGGG - Intronic
906665729 1:47620619-47620641 GAAGAGCAGTCACTGAAGTTAGG - Intergenic
909521705 1:76576034-76576056 TGAGACAAGGAACAGAAGGTTGG + Intronic
912181426 1:107223343-107223365 TATGACAAGTCAGTAAAGGAAGG + Intronic
912669423 1:111610583-111610605 CAACACCAGTCACTGAAGATGGG + Intronic
913006767 1:114641091-114641113 TAAGAAGATTCTCTGAAGGTAGG + Intronic
914397976 1:147289081-147289103 TAAAACAAGTTACTGAAAGAAGG + Intronic
916600699 1:166290645-166290667 GAAGTCGAGTCACTGATGGTTGG + Intergenic
917814328 1:178692108-178692130 AAAGCCAAGTCACTGCAGCTAGG - Intergenic
918219036 1:182418897-182418919 TCAGAGAAGAAACTGAAGGTTGG - Intergenic
918484245 1:185012457-185012479 TAATACAAGTAATTGTAGGTAGG - Intergenic
918757246 1:188354637-188354659 TAAGACATGTCATTGAAGTCAGG - Intergenic
921875678 1:220192843-220192865 AAAGTCAAGTCAGTGAAGATGGG + Intronic
922647612 1:227305491-227305513 TCAGAGAAGTCTCTTAAGGTTGG + Intronic
924120987 1:240797816-240797838 TCAGAGAAGTCTCTTAAGGTTGG - Intronic
924403725 1:243719222-243719244 TAAGAAAAGTCTCTGAGAGTTGG - Intronic
1063037044 10:2296672-2296694 TAAGTGAAGTCACTAAATGTGGG - Intergenic
1067555882 10:47270468-47270490 TAAGACAATTCAGTGAAGAAAGG - Intergenic
1068134591 10:52939640-52939662 CAAGTCAAGTCACTGATTGTGGG - Intergenic
1068203522 10:53815930-53815952 TAAGACAAGTAACTGCTGATCGG + Intronic
1071833844 10:89399306-89399328 TAAGACAAATCACAGAATGAAGG - Intronic
1072770948 10:98136868-98136890 TAAGACCTGTCACATAAGGTCGG + Intronic
1073597355 10:104814238-104814260 TAATACTACTCACTGCAGGTAGG - Intronic
1073716370 10:106112549-106112571 TAAGACAAGTCACCTGGGGTAGG + Intergenic
1075862820 10:125691929-125691951 TCAGCGAAGTCACTGAAGGGTGG + Intergenic
1079229503 11:18637486-18637508 TCAGAAAAGTAAGTGAAGGTCGG + Intergenic
1080263187 11:30373041-30373063 CAATAGAAGTCACTGAAAGTAGG - Intergenic
1081788099 11:45762570-45762592 TAAGTCAAATCACTGTAAGTCGG + Intergenic
1085568718 11:77540247-77540269 GAAGACAAGTCAGTGGAGGCAGG - Intronic
1093047183 12:14460799-14460821 TAAGACCACTCACTGTAGGTGGG - Exonic
1093214217 12:16344536-16344558 CAAGACAATTCACTGAAGAAAGG - Intergenic
1094341963 12:29422424-29422446 AAGGACATTTCACTGAAGGTTGG + Intronic
1096852277 12:54448203-54448225 AAAGACCAGTCATGGAAGGTGGG + Intergenic
1102796549 12:115693873-115693895 TAAGAAAAGTCACTGAGTTTGGG - Intergenic
1103312047 12:120018161-120018183 TAAGTCAAATCTCTGAGGGTGGG - Intronic
1103367481 12:120393825-120393847 TAAGATAACTCACTGAAGCATGG - Intergenic
1104484123 12:129134913-129134935 TTAGACCAGTCACTGATGCTGGG - Intronic
1107637674 13:42409047-42409069 GAAGAGAAGACACTGAAGGTGGG - Intergenic
1109260666 13:60142224-60142246 TTATACAAATTACTGAAGGTAGG + Intronic
1111400119 13:87722959-87722981 TAAGACAAGTCTCTGGAGAAGGG - Intergenic
1111897136 13:94155798-94155820 GAAGACAAGTCTCTAAAGGGAGG - Intronic
1111973254 13:94939335-94939357 TTCGATAAGTTACTGAAGGTTGG + Intergenic
1115583651 14:34787990-34788012 TGAGACAAGTCACTTAATCTGGG + Intronic
1117745349 14:58863745-58863767 TAAGCCACGTCAGTGAAGGGAGG - Intergenic
1117981619 14:61347618-61347640 TGAGACAAGACACTTAATGTAGG + Intronic
1118115285 14:62769156-62769178 TAAGACAAGTGAGTTAAGGGAGG - Intronic
1118803215 14:69210125-69210147 TTAGAAAAGCCACTGGAGGTAGG - Intronic
1121592223 14:95124787-95124809 TAGGTTAAGTCCCTGAAGGTGGG + Intronic
1124453138 15:29816561-29816583 TGTGAGAAGTCACTGAAGTTTGG - Intronic
1125669744 15:41462048-41462070 TAAAAAAAGTCACTGAAGCTGGG - Intronic
1127379562 15:58419316-58419338 TGAGACAGCCCACTGAAGGTGGG + Intronic
1128534474 15:68480351-68480373 GAAGACAAGTCACTGCATGGAGG - Intergenic
1130154887 15:81341691-81341713 TAAGACAAGTCACTGAAGGTGGG + Intronic
1131573609 15:93564357-93564379 TAAGAAAAATCACTGCAGGCTGG - Intergenic
1131903483 15:97115313-97115335 AAAGTTCAGTCACTGAAGGTTGG - Intergenic
1134749739 16:16616500-16616522 TAAGACAAGTCCCTGAATCTGGG + Intergenic
1134995733 16:18737115-18737137 TAAGACAAGTCCCTGAATCTGGG - Intergenic
1138913000 16:61425490-61425512 TAAAGCAGGTCACTGAAGGAAGG - Intergenic
1139176016 16:64688590-64688612 TAAAACAAGTTACTGAAGAAGGG + Intergenic
1140665415 16:77222989-77223011 TAAGACAAGTGAGTACAGGTAGG - Intergenic
1140738132 16:77917222-77917244 TAAGACAAGAGACAGGAGGTAGG + Intronic
1149167747 17:53773887-53773909 TAAGACCAGTCAATGAAGAATGG - Intergenic
1149569166 17:57660322-57660344 CAAAACCAGTCACTGAGGGTGGG + Intronic
1151868830 17:76822718-76822740 TAAGACACGTCACTGAGAGTGGG - Intergenic
1152833893 17:82516884-82516906 TAAGACATGTAAATGTAGGTCGG + Intergenic
1153385409 18:4488811-4488833 TAAGACAAATAAATGAAGGAAGG + Intergenic
1156225278 18:35099679-35099701 GCAGACAATTCACTGAAGTTTGG + Intronic
1156747266 18:40407296-40407318 TAAGGGAGGTCACTCAAGGTGGG - Intergenic
1157732889 18:50020078-50020100 TGAGACAGGTGACTGAGGGTAGG - Intronic
1157867470 18:51198224-51198246 TAAGAAGAGTCACGGAAGGAGGG + Intronic
1161158067 19:2744957-2744979 TAAGAAAATTCACTGAAAGCCGG + Intergenic
1163509329 19:17725892-17725914 TGAGCCCAGTCACCGAAGGTGGG - Exonic
1164532158 19:29056924-29056946 CAAGACAGGTCCCTGGAGGTGGG - Intergenic
926861968 2:17319268-17319290 TAAGAGTACTCACTGTAGGTTGG + Intergenic
927266271 2:21155286-21155308 TAAAACAAGACACTGAAATTGGG - Intergenic
928334033 2:30380567-30380589 TAAGTCAAGTCATTGTAAGTTGG - Intergenic
928369828 2:30732692-30732714 AAAGAGAAGACACTGAAGGGAGG - Intronic
929036423 2:37697065-37697087 AAAAACAAGTCAATGAAGGAAGG - Intronic
929870047 2:45751558-45751580 AAAGTCAAGTCTCTGAAGGAGGG + Intronic
930639133 2:53837499-53837521 TCAGAAAAGTCACTCAAGGCTGG + Intergenic
931512626 2:63017250-63017272 GCAGGCAGGTCACTGAAGGTTGG - Intronic
932798530 2:74718594-74718616 GAAGACAGGTCACAGAAGGCAGG + Intergenic
933092241 2:78135853-78135875 GTAGACTAGTCACTGGAGGTGGG - Intergenic
933177200 2:79188611-79188633 GAAGAAAAATCACTGAAGGGAGG + Intronic
933249221 2:80010010-80010032 TAAGAAAAGTTATTGGAGGTAGG - Intronic
933993485 2:87650433-87650455 GAAGACAAGACCCTGAAGTTTGG - Intergenic
936300378 2:111300450-111300472 GAAGACAAGACCCTGAAGTTTGG + Intergenic
936560192 2:113531286-113531308 TAAGGCAAGGTACTGAAGGAGGG - Intergenic
938919140 2:135977245-135977267 TAAGAGAAGACACTGAGGATTGG + Intronic
939688838 2:145232432-145232454 TAAGAAAAGTCAGTGTAGGCCGG - Intergenic
940221831 2:151360839-151360861 TAAGAAAAATTACTGAGGGTGGG + Intronic
941093440 2:161207317-161207339 TAAGAGAACTCGCTGAAGTTAGG - Intronic
941167498 2:162098299-162098321 TCAGAGTAGTCACTGAATGTAGG + Intergenic
941385823 2:164850618-164850640 CAAGTCAATTCACTGAAGCTAGG + Intergenic
942124100 2:172805708-172805730 TCAGGCAAGAGACTGAAGGTGGG - Intronic
942221773 2:173775901-173775923 AAAGAAAAGTGACTCAAGGTTGG - Intergenic
1171396006 20:24833634-24833656 GAAGAAATGTCCCTGAAGGTAGG - Intergenic
1173034245 20:39393623-39393645 CCAGACCAGTCACTGAATGTGGG - Intergenic
1174483081 20:50844841-50844863 TGGAACAAGTCACTGCAGGTAGG - Intronic
1174566546 20:51468864-51468886 TTAGCCAAGCCACTGAAGGATGG + Intronic
1179802719 21:43818832-43818854 AAAGACAAGGCAGTGAATGTTGG - Intergenic
1184004922 22:41700625-41700647 CAAGAAAACTCACTGCAGGTCGG - Intronic
949913903 3:8941462-8941484 TGAAACAAGTTACTAAAGGTAGG - Exonic
950590657 3:13933999-13934021 TAAGACAAAGCACGGGAGGTGGG + Intergenic
950711838 3:14818816-14818838 TAAGACAAAGCACGGGAGGTGGG + Intergenic
953052802 3:39361470-39361492 CAGGACAAGTCACTGAATGAGGG - Intergenic
955498648 3:59562654-59562676 CATGTCAAGTCACTGAGGGTAGG - Intergenic
957369782 3:79278571-79278593 TAAGACAACTCACTGGAGAAAGG + Intronic
958068270 3:88574061-88574083 TATGACAACTCATTGATGGTAGG - Intergenic
958093943 3:88916112-88916134 TGAGACCAGTCACTGAAAGTGGG + Intergenic
959919600 3:111856204-111856226 TAAAACAAGGCAGTGAAGGGAGG + Intronic
960821169 3:121734092-121734114 AAAGACAAGTCACTGAAGCCAGG + Intronic
971491421 4:27215987-27216009 TATCACAGGTCACTGAGGGTTGG + Intergenic
972831468 4:42819095-42819117 GAAGACAAGTCCCTGAGGGTAGG - Intergenic
974118074 4:57605463-57605485 TAAAGCAAATCACTGAAGATGGG - Intergenic
975238661 4:72031198-72031220 TTAGACAAGTCACTAAACCTTGG + Intergenic
976445024 4:85120086-85120108 AATGTCAACTCACTGAAGGTAGG + Intergenic
979544463 4:121924124-121924146 TTAGACATGTCATTGAAGCTTGG + Intronic
979826688 4:125244741-125244763 AAAGACATTTCACTGAAAGTAGG + Intergenic
983500027 4:168488048-168488070 TATCACAACTCACTGGAGGTAGG + Intronic
987314323 5:16710221-16710243 TGTGACAAGTCATTGAAGGTGGG + Intronic
988922597 5:35957510-35957532 GAAGACAAGGCACTGATGGGAGG - Intronic
989678075 5:43996457-43996479 AAAGACAAGTCTGTGAAGGATGG + Intergenic
990500526 5:56391851-56391873 TAAGACAAGTCTCTTAAAGACGG - Intergenic
994102139 5:95905048-95905070 AAAGCCAAGTATCTGAAGGTGGG - Intronic
994716136 5:103323709-103323731 AAAGACAAATCTCTGAAGGAAGG + Intergenic
995529801 5:113081298-113081320 TAAGGCAAGTCACTCAACTTGGG + Intronic
998659474 5:144220119-144220141 TAAGACAAATCCCTCGAGGTGGG - Intronic
999037181 5:148365272-148365294 TAAACCAAGTTACTGAAGTTTGG + Intergenic
1000217621 5:159178102-159178124 TAAGCCATGGCACTAAAGGTGGG - Intronic
1000414166 5:160965973-160965995 TAAAACAAGTGACTGAAAATAGG + Intergenic
1001075240 5:168621863-168621885 TATGAGAAGTCACTGGAAGTGGG - Intergenic
1002758702 6:184997-185019 AAAGACAAGACACTGGAGCTGGG - Intergenic
1003575144 6:7286085-7286107 TACGACAGCTCACTGAAGGAAGG - Exonic
1004218573 6:13724921-13724943 TAAGAGAACTCTCTGAATGTTGG + Intergenic
1004493423 6:16140201-16140223 TATGACAAGTCATCGAAGGAAGG + Intronic
1007270297 6:40630971-40630993 TAAGAGAAGCCACTGGTGGTGGG - Intergenic
1010813987 6:80333289-80333311 AAAGACAAGAAACTGAAGCTGGG - Intronic
1012346230 6:98190563-98190585 TAAGAAACGTCACTAAAAGTTGG - Intergenic
1013156790 6:107499823-107499845 TAAAACAAGCCACTGAACGAAGG - Intronic
1013583254 6:111556371-111556393 TAGGACAGGTCTCTGAAGGGAGG + Intergenic
1018112932 6:160553816-160553838 TAAAGCAAGTCACAGAAGGACGG - Intronic
1020567283 7:9813569-9813591 TAAGTGAAATCACTGCAGGTGGG + Intergenic
1022766050 7:33413588-33413610 TAAGACAAGACCATGAAGGAAGG - Intronic
1023101814 7:36725799-36725821 AAAAACAAGACACTGAAGGGGGG - Intergenic
1026468885 7:70677717-70677739 TAAGAAAAGTCACCCGAGGTGGG - Intronic
1026947807 7:74327585-74327607 TCAGACAAGTCACTTAAAATGGG - Intronic
1029024307 7:97399729-97399751 TAAGGGAACTCACTGAAGTTTGG + Intergenic
1029950642 7:104580714-104580736 CAAGACAAGTTGCTGAGGGTAGG - Intronic
1031263121 7:119548505-119548527 TATGATAAGCCACTGAAGCTTGG - Intergenic
1032684877 7:134223278-134223300 TAATTCAAGTCGCTGAAGGCAGG + Intronic
1034920376 7:155074962-155074984 TAAGACAATTCCCTAATGGTAGG + Intronic
1035914888 8:3608203-3608225 AAAGACAGGACACTGAAGGTGGG + Intronic
1036005714 8:4660816-4660838 GAAGACATTTCACTGAAGATAGG + Intronic
1037123731 8:15319922-15319944 TAAGACAACTGCCTGAAGTTTGG - Intergenic
1039203379 8:35121779-35121801 TAGGAAGAGTCACTGAAGTTTGG + Intergenic
1039516636 8:38139246-38139268 TAAGAGCAGTCACTGGAAGTGGG - Exonic
1041373255 8:57186839-57186861 TAGGACAAGTCACTGGGGGAAGG + Intergenic
1043677407 8:82974404-82974426 TAAGACAATTTGCTGAAGCTTGG - Intergenic
1046660101 8:116939283-116939305 TAAGACAATTTACTAATGGTTGG - Intronic
1047044409 8:121035771-121035793 TAAAACATGTCAGTAAAGGTAGG + Intergenic
1049892675 9:85078-85100 TAAGGCAAGGTACTGAAGGAGGG + Intergenic
1051796092 9:20872294-20872316 TAATACAAGTCACTGCACCTGGG - Intronic
1053733904 9:41085133-41085155 TAAGGCAAGGTACTGAAGGAGGG + Intergenic
1054694503 9:68346415-68346437 TAAGGCAAGGTACTGAAGGAGGG - Intronic
1055922629 9:81477543-81477565 TAAGACAAGTTATTGAAAGTAGG + Intergenic
1059771257 9:117428620-117428642 CAAGAAAAGTCACTGAATGAGGG + Intergenic
1060754542 9:126203223-126203245 GAAGGCAAGGCACTGAATGTTGG + Intergenic
1188627803 X:32308483-32308505 TCAAAAAAGTCAATGAAGGTAGG + Intronic
1189641890 X:43081688-43081710 TAAGAAAGGTCTCTGAAAGTTGG - Intergenic
1191212754 X:57906549-57906571 TAAGAGAAATCAATTAAGGTGGG + Intergenic
1192960372 X:76124217-76124239 TAAGACCAGAGACTGAAGGAAGG - Intergenic
1193996675 X:88374264-88374286 TAAGTCAAATCACTGTAAGTTGG + Intergenic
1199353855 X:146837147-146837169 CAATTCAAGTGACTGAAGGTTGG + Intergenic
1201977606 Y:19869707-19869729 TAAGAAAAAGCACTGGAGGTCGG + Intergenic