ID: 1130158456

View in Genome Browser
Species Human (GRCh38)
Location 15:81374381-81374403
Sequence TCCAGGACTGTCAGGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130158456_1130158461 15 Left 1130158456 15:81374381-81374403 CCTTATGCCCTGACAGTCCTGGA 0: 1
1: 0
2: 1
3: 14
4: 164
Right 1130158461 15:81374419-81374441 TTTACATCTGTGACCATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130158456 Original CRISPR TCCAGGACTGTCAGGGCATA AGG (reversed) Intergenic
900476310 1:2877980-2878002 TCCAGGGCTGGCAGGGAACAGGG + Intergenic
903432052 1:23312303-23312325 ACCAGGATGGTCAGGGCAGAGGG - Intronic
904555923 1:31364239-31364261 TCCAGGAGTCTCAAGGCACAAGG - Exonic
904688485 1:32276502-32276524 TCCAGGACTGCCTGGGAAGAGGG + Intronic
905805672 1:40875441-40875463 CCCAGGACTGTCAAGGACTAGGG - Intergenic
906004170 1:42455150-42455172 TCCGGGACTGCTAGGGCAAATGG - Intronic
907456622 1:54580511-54580533 GACAGGAATGTCAGGGCAAAGGG - Intronic
907674474 1:56506102-56506124 TCCAGGGCTGCCTGGGCACAGGG - Intronic
908071892 1:60469646-60469668 TGCAGGAGTGGCAGGGCACAAGG - Intergenic
912451576 1:109770656-109770678 TCCAGGGCTGTCAGGGCAGTGGG - Intronic
912516189 1:110217909-110217931 TCCAGCACTGCCTGGGCACAAGG + Intronic
916104244 1:161419389-161419411 TCCAGATCTGTCAGGACAGAAGG + Intergenic
917667949 1:177243825-177243847 TCCAGGACTCTGAGGCCCTAAGG - Intronic
922900173 1:229130388-229130410 TCCAGGTCTGTGAGGCAATAGGG - Intergenic
924438831 1:244070058-244070080 TCCAAGACTGTAAGGTCATAAGG - Intergenic
1063204121 10:3814414-3814436 TCCAGCCCTGCCAGGACATATGG + Intergenic
1065457179 10:25919030-25919052 TCCAGGACTGTCCTGGAATTGGG + Intergenic
1066416111 10:35223441-35223463 GGCAGGACTTTCAGGGCATAAGG + Intergenic
1069632017 10:69902825-69902847 CCCAGGACTGCCAGGGCCTATGG + Exonic
1071138827 10:82483067-82483089 TCCAGGAAAGGCAGGGCAGATGG + Intronic
1074028633 10:109663172-109663194 TCCTGGGCTGTGAGAGCATAGGG - Intergenic
1074431409 10:113398029-113398051 TCCAGGACTCCCAGGGTATCTGG + Intergenic
1075095798 10:119469791-119469813 TCCAGAACCGTGAGGTCATAAGG + Intergenic
1075439647 10:122469527-122469549 TCCAGGACAGTTAGGGCAGTGGG + Intronic
1077364971 11:2157994-2158016 TCCAGGACTTGCAGGGCAGCTGG - Intronic
1077408472 11:2392931-2392953 CCCAGGAGTGTCAGGGCCTGAGG + Intronic
1078865265 11:15291359-15291381 TCCAGGACTGTGAGTGAATTTGG - Intergenic
1079385650 11:19977003-19977025 TCCAGGACTGTCAGCTCTTCAGG - Intronic
1081410992 11:42758419-42758441 TCTGGGACTGTAAGGGCAAAAGG - Intergenic
1081630792 11:44688301-44688323 GCCAGGACTGTCAGGGCTGAGGG + Intergenic
1082803361 11:57430775-57430797 CCCAAGACTGTCTGGGCTTAAGG + Intergenic
1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG + Intronic
1091193469 11:133713384-133713406 CCCAGGACTGAAAGGGCATCGGG + Intergenic
1091962203 12:4705565-4705587 TCCAGGGCTGTCAGGTATTAGGG + Intronic
1096001255 12:48132484-48132506 TCCAGTAATGTCAGGCCATTAGG + Intronic
1097140364 12:56897661-56897683 CCAAGGCCTGTCAGGGCATGGGG + Intergenic
1100015735 12:90008820-90008842 ACCAGGACTCTCCGGCCATATGG - Intergenic
1101641940 12:106592549-106592571 TCCAGAACTGGAAGGGCATCAGG - Intronic
1102796245 12:115691392-115691414 TCCAGGGGTGCCAGGGCATAAGG - Intergenic
1104529835 12:129559120-129559142 TACAGGGCTGTCAGCCCATAAGG + Intronic
1106103389 13:26713610-26713632 TCCAGAAATGTCTGGGCACAGGG - Intergenic
1106119661 13:26849632-26849654 TCCAGGGCTGTTAGTGCAAAGGG - Intergenic
1106431796 13:29687851-29687873 GCCAGGACTGCCAGGGCACATGG + Intergenic
1111001990 13:82196563-82196585 ACCAGTACTGTCATGGCAAATGG - Intergenic
1117178061 14:53165469-53165491 TGGAGGACAGGCAGGGCATATGG - Intergenic
1119323541 14:73745424-73745446 TCCAGCCATGTCAGGGCATGAGG - Intronic
1125597364 15:40895390-40895412 TCCAGGAGAATGAGGGCATAGGG + Intronic
1126363620 15:47871429-47871451 TCCAGGTCTGTATGGGCAAATGG - Intergenic
1129167471 15:73786925-73786947 GCCAGGACTGTTGGGGCATGGGG - Intergenic
1129909154 15:79211988-79212010 TCCAGGACTGTCAGACCCAAAGG + Intergenic
1130158456 15:81374381-81374403 TCCAGGACTGTCAGGGCATAAGG - Intergenic
1130644083 15:85708435-85708457 TTCAGGACTATCAGGGCAGCAGG + Intronic
1130823888 15:87523856-87523878 TCCAGGACTGTCAGTGCTGGTGG - Intergenic
1130869745 15:87961168-87961190 TCCAGGAAGCCCAGGGCATATGG + Intronic
1134263893 16:12676168-12676190 CCCAGGACTGCCAGGGGACATGG + Intronic
1135341418 16:21651368-21651390 CCCAGGACTTTCAGGCTATAGGG - Intronic
1137727445 16:50666693-50666715 TGCTGCACTGTGAGGGCATAGGG + Intronic
1140712537 16:77691715-77691737 TCCAAGAATCTCAGGGCAGAGGG + Intergenic
1141993448 16:87622878-87622900 TCCAGGGCTGGCAAGGCATTGGG + Intronic
1143636152 17:8164613-8164635 CCCGGGACTGTCAGTGCACAAGG - Intergenic
1146626755 17:34440724-34440746 TCCAGGGCAGTCAGGGGATGGGG + Intergenic
1148484000 17:47978852-47978874 TCAAGCAGTGTCAGGGCATCTGG - Exonic
1148747204 17:49925104-49925126 TCGCGGACACTCAGGGCATATGG - Intergenic
1149779789 17:59388215-59388237 TCCAGGACTGACACAGCAAAAGG - Intronic
1149979337 17:61297167-61297189 TCCATGACAGTCAATGCATATGG + Intronic
1151962970 17:77416919-77416941 TCCAGGGCTGTCTGGCCATTTGG + Intronic
1152307530 17:79529969-79529991 TCCAGGCCTGGCAGGCCAGATGG - Intergenic
1152381260 17:79943400-79943422 CCCAGGACAGGCAGGGCGTAGGG + Intronic
1152555191 17:81049555-81049577 CCCAGCACTGTCAGGGCGTCTGG + Intronic
1152990969 18:363096-363118 TCCAGGAATGACAGTGCAAAGGG + Intronic
1158213332 18:55074183-55074205 TGCAGGACTTTCAGGGCCCATGG + Intergenic
1163083862 19:14964653-14964675 TCCAGGTCTGTCTGAGCATGTGG + Intronic
1164716193 19:30392101-30392123 TCCAGGACTCTGAGGGGAGAAGG + Intronic
1165808545 19:38596605-38596627 TCTAGAAATGTCAGGGGATAAGG + Intronic
1166368042 19:42287087-42287109 TCCTGGGCTCTCAGGGCATGTGG - Exonic
928737187 2:34305976-34305998 TTCAGAGCTGTCATGGCATATGG + Intergenic
934123779 2:88866474-88866496 GCCAGGATTATCAGGGCATTTGG - Intergenic
938770834 2:134499453-134499475 TCCAGGGCTGTGTGGGCAAATGG - Intronic
939394857 2:141615425-141615447 TCTATGAGTGTCAGGGCATTTGG - Intronic
944901910 2:204223890-204223912 TACAAGACTGTCAGGGGAAAGGG + Intergenic
946176185 2:217923073-217923095 TCCAGGACTGTGGGGCCACAGGG - Intronic
947169091 2:227293196-227293218 TCCAGGACTGCCGGGTGATATGG + Exonic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
948383850 2:237569394-237569416 TTCATGGCTGTCAGGGGATAGGG + Intergenic
1168774220 20:434758-434780 TCCACGACTGTCAGATCAAAGGG + Intergenic
1172343567 20:34178881-34178903 CCCAGGACTGTCACTGCACACGG - Intergenic
1174216211 20:48918560-48918582 TCCAGGAGTGTCTGGCCATGTGG + Intergenic
1175404255 20:58716597-58716619 TCCAGGGCTGTGGGGGCACATGG - Intronic
1175988494 20:62776197-62776219 TCCACGACTGGCAGGGCTTGGGG + Intergenic
1178181096 21:30162394-30162416 TCCAGCACTGTGAGGTCACAGGG + Intergenic
1180020165 21:45118903-45118925 GCCAGGGCTTTTAGGGCATAAGG - Intronic
1181105867 22:20574915-20574937 TCCAGGTCTGTCTGGGCATTGGG - Intronic
1183285286 22:36958858-36958880 TCCAGGACTGTATGGGAAGAAGG - Intergenic
1184080539 22:42216433-42216455 TCCAGGACACTCAGCCCATATGG + Intronic
1184179236 22:42808634-42808656 TCCAGCACTTTCAGGCCAGAGGG + Intronic
1184951332 22:47844528-47844550 TGCAGGAGGGACAGGGCATAAGG + Intergenic
1185211891 22:49575210-49575232 TCAAGGACTGTCATGGGATCAGG + Intronic
949461932 3:4303329-4303351 CCCAGGACTGTCAGGGTAGTGGG + Exonic
949894405 3:8758500-8758522 TACAGGACTGTGCGGGCATCTGG + Intronic
951024523 3:17815641-17815663 TCCAGAACTGTCAGGGCTCAAGG - Intronic
951986377 3:28626131-28626153 TCCAGGAGAGCCAGGGCAAAGGG + Intergenic
953536790 3:43782854-43782876 TCTGGGGCTGTCTGGGCATATGG + Intergenic
953673595 3:44982784-44982806 TCCTGCAGTGTCTGGGCATAAGG - Intronic
953754697 3:45636189-45636211 GCCAGGCCTGTCAGGCCATGGGG + Exonic
955188372 3:56736840-56736862 TCCAGCACTTTCAGAGGATAAGG + Intronic
955725656 3:61929876-61929898 TCCACGACTCTCTGTGCATATGG - Intronic
958677288 3:97282034-97282056 TCCTTGACTGTCACAGCATATGG - Intronic
959087186 3:101863910-101863932 TCCAGGATTTTCAGGGCTTCTGG + Intergenic
968658808 4:1790354-1790376 CCCAGGACTGTCAGGGCCACGGG - Intergenic
968754789 4:2409608-2409630 TCCAAGGCTGTCAGGCCATGTGG - Intronic
969651681 4:8471731-8471753 TCCAGGACTGCCAGGGTATGGGG + Intronic
971512515 4:27444783-27444805 TCCAGAAGTGACAGGGCATGTGG - Intergenic
974962361 4:68719962-68719984 TGTAAGACTGTCAGGGGATAGGG + Intergenic
975907711 4:79234417-79234439 TGAATGACTATCAGGGCATATGG + Intronic
977598342 4:98908854-98908876 TCCAGGACTACCAGGGTTTACGG + Intronic
990927997 5:61051467-61051489 TCCAGGAATGTGAGGCCATTAGG + Intronic
991279145 5:64891291-64891313 TCCAGGACTTTCAGGAAATGAGG - Intronic
991633610 5:68681068-68681090 TCTAGGACTGTCAAGAGATATGG + Intergenic
991665145 5:68992265-68992287 TCCAGGACTGACAAAGCATATGG + Intergenic
995134894 5:108670665-108670687 GCCAGGGGTGTCAGGGCACAGGG + Intergenic
997426831 5:133808938-133808960 ACCAGGACTGTCAGGACGTGTGG + Intergenic
997734044 5:136200474-136200496 TCAAGGACTCACAGAGCATAAGG - Intergenic
998176672 5:139905542-139905564 TCCAGGGCTGTCTGGGGATGCGG + Intronic
1001121694 5:168986184-168986206 TCTAGCACTGTCAGGGAATTGGG - Intronic
1003149319 6:3535359-3535381 TGCAGGAGTGTCAGGGCTGATGG - Intergenic
1004304750 6:14489615-14489637 TCCAGAACTGTCAAGCCATCTGG + Intergenic
1006499423 6:34448465-34448487 CCCAGGGCTGGCAGGGCATACGG + Intergenic
1009389194 6:63125493-63125515 TCTAGGACTGTTAAGGCATTTGG + Intergenic
1019011267 6:168845229-168845251 CCCAGGAGTGTCAGGGGAGAAGG + Intergenic
1019427829 7:985644-985666 GCCTGGACTGTCAGGGCTTGGGG - Intronic
1021113146 7:16718756-16718778 TCAAAAACTGTCAGGGAATATGG - Intergenic
1021860301 7:24899362-24899384 ACTGGGACTGTCAGGTCATAGGG + Intronic
1022500476 7:30879504-30879526 TGCAGGTCTGGCAGGGCATTGGG - Intronic
1023238484 7:38116239-38116261 TCCAGGTCTGTCAGTACTTATGG + Intergenic
1032410403 7:131690113-131690135 TCCAGCACTGTCTTGGCACATGG + Intergenic
1034163387 7:149008126-149008148 TCCAGGGCTGGCATGGCAGAGGG + Intronic
1038117617 8:24575278-24575300 TCTAGGAATTTCAGGGCAAAGGG - Intergenic
1040691148 8:49940171-49940193 CCCAGGTCTTTCAGGGCATTTGG - Intronic
1041385940 8:57302507-57302529 TCCAGGACTGTCAAAACCTAAGG + Intergenic
1041639281 8:60179315-60179337 TCCATGACTGTCTGTGCAGAGGG + Intergenic
1042441294 8:68829476-68829498 GCCAGGAATGTCAGGGAATGAGG - Intergenic
1044649785 8:94481979-94482001 TCCAGGATACTCAGGGCATATGG - Intergenic
1045346801 8:101300702-101300724 TAGAGCACTGTCAGAGCATAGGG + Intergenic
1045503163 8:102758690-102758712 TCAAGGAGTGTCTGGGCATGAGG + Intergenic
1046496554 8:115022215-115022237 ACCAGGCCTGTCAGGGAGTAGGG - Intergenic
1049259233 8:141629857-141629879 GCCAGCTCTGTCAGGGCAGAGGG - Intergenic
1050497244 9:6256717-6256739 TCCCTTACTGTCAGGGGATATGG + Exonic
1051877006 9:21803511-21803533 TCAAGGCCTCTCAGGGCCTAGGG - Intronic
1052020548 9:23520671-23520693 TCCGGGCCTGTCAGGGAGTAGGG + Intergenic
1053416047 9:37947450-37947472 TCAAGGACTGTCAGGGCAGAGGG - Intronic
1056013830 9:82360918-82360940 TCCAGGAAGCTCAGGGCACAAGG - Intergenic
1061513779 9:131076707-131076729 CACAGGCCTGTCAGGGCAAAAGG + Intronic
1062280482 9:135749560-135749582 TCAAGGGCTGTCAGGGAAGATGG - Intronic
1062320117 9:135986626-135986648 TCCAGGCCTGTCAGAGCCAAGGG - Intergenic
1062387230 9:136317641-136317663 GCCAGGCATGTCAGGGCATGAGG + Intergenic
1186800959 X:13092242-13092264 TCCAGAACTGTCTGGTCAGAGGG + Intergenic
1187263528 X:17709579-17709601 TACAAGACTGACAGGGCAAATGG + Intronic
1195102918 X:101573780-101573802 TCCAGAACTGCCAGAGCATGAGG - Intergenic
1198213198 X:134533976-134533998 TCCAGGACTGGGAAGGCACACGG - Intergenic
1198239189 X:134766452-134766474 GCCAGGACTGGCAGGCCATCAGG + Intergenic
1200110762 X:153739831-153739853 TCCAGGCGTGTCAGGGCCTGAGG + Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200795337 Y:7336304-7336326 TTCAGGACTGTCAAGGGAGAAGG - Intergenic
1200967498 Y:9110522-9110544 ACCAGGAATGTCAGGTCATTGGG + Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1201853636 Y:18516770-18516792 ACCAGGAATGTCAGGCCATCGGG + Intergenic
1201879685 Y:18803614-18803636 ACCAGGAATGTCAGGCCATCGGG - Intronic
1202143333 Y:21751888-21751910 ACCAGGAATGTCAGGTCATTGGG + Intergenic
1202173898 Y:22079913-22079935 ACCAGGAATGTCAGGCCATCGGG - Intronic
1202217462 Y:22506469-22506491 ACCAGGAATGTCAGGCCATCGGG + Intronic
1202325724 Y:23689590-23689612 ACCAGGAATGTCAGGCCATCGGG - Intergenic
1202545047 Y:25980464-25980486 ACCAGGAATGTCAGGCCATCGGG + Intergenic