ID: 1130162322

View in Genome Browser
Species Human (GRCh38)
Location 15:81414003-81414025
Sequence CCAGCAGAGGCAGCCGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130162322_1130162328 -10 Left 1130162322 15:81414003-81414025 CCGGAGCCGGCTGCCTCTGCTGG No data
Right 1130162328 15:81414016-81414038 CCTCTGCTGGCGCGGAGGTGCGG No data
1130162322_1130162329 -7 Left 1130162322 15:81414003-81414025 CCGGAGCCGGCTGCCTCTGCTGG No data
Right 1130162329 15:81414019-81414041 CTGCTGGCGCGGAGGTGCGGAGG No data
1130162322_1130162330 4 Left 1130162322 15:81414003-81414025 CCGGAGCCGGCTGCCTCTGCTGG No data
Right 1130162330 15:81414030-81414052 GAGGTGCGGAGGCAGAAGCGTGG No data
1130162322_1130162335 17 Left 1130162322 15:81414003-81414025 CCGGAGCCGGCTGCCTCTGCTGG No data
Right 1130162335 15:81414043-81414065 AGAAGCGTGGGCGGGAGCCTGGG No data
1130162322_1130162333 9 Left 1130162322 15:81414003-81414025 CCGGAGCCGGCTGCCTCTGCTGG No data
Right 1130162333 15:81414035-81414057 GCGGAGGCAGAAGCGTGGGCGGG No data
1130162322_1130162334 16 Left 1130162322 15:81414003-81414025 CCGGAGCCGGCTGCCTCTGCTGG No data
Right 1130162334 15:81414042-81414064 CAGAAGCGTGGGCGGGAGCCTGG No data
1130162322_1130162331 5 Left 1130162322 15:81414003-81414025 CCGGAGCCGGCTGCCTCTGCTGG No data
Right 1130162331 15:81414031-81414053 AGGTGCGGAGGCAGAAGCGTGGG No data
1130162322_1130162332 8 Left 1130162322 15:81414003-81414025 CCGGAGCCGGCTGCCTCTGCTGG No data
Right 1130162332 15:81414034-81414056 TGCGGAGGCAGAAGCGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130162322 Original CRISPR CCAGCAGAGGCAGCCGGCTC CGG (reversed) Intergenic
No off target data available for this crispr