ID: 1130168892

View in Genome Browser
Species Human (GRCh38)
Location 15:81491513-81491535
Sequence CGGTGGTATTAGAGAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130168888_1130168892 0 Left 1130168888 15:81491490-81491512 CCTGAAATGATCTGGCAAGTGCA No data
Right 1130168892 15:81491513-81491535 CGGTGGTATTAGAGAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130168892 Original CRISPR CGGTGGTATTAGAGAGAAGG TGG Intergenic
No off target data available for this crispr