ID: 1130169218

View in Genome Browser
Species Human (GRCh38)
Location 15:81494626-81494648
Sequence CTGGATATTGAGGTGAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130169218_1130169226 19 Left 1130169218 15:81494626-81494648 CCAGGTCTCACCTCAATATCCAG No data
Right 1130169226 15:81494668-81494690 AATGGGATATAATTATTTCCAGG No data
1130169218_1130169224 2 Left 1130169218 15:81494626-81494648 CCAGGTCTCACCTCAATATCCAG No data
Right 1130169224 15:81494651-81494673 TTGTAAGTGATTCCTGGAATGGG No data
1130169218_1130169223 1 Left 1130169218 15:81494626-81494648 CCAGGTCTCACCTCAATATCCAG No data
Right 1130169223 15:81494650-81494672 TTTGTAAGTGATTCCTGGAATGG No data
1130169218_1130169222 -4 Left 1130169218 15:81494626-81494648 CCAGGTCTCACCTCAATATCCAG No data
Right 1130169222 15:81494645-81494667 CCAGGTTTGTAAGTGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130169218 Original CRISPR CTGGATATTGAGGTGAGACC TGG (reversed) Intergenic
No off target data available for this crispr